Дисбиоз кишечника: Дисбиоз кишечника

Содержание

Дисбиоз (дисбактериоз) кишечника | ФБУН «Ростовский научно-исследовательский институт микробиологии и паразитологии» Роспотребнадзора

Высококвалифицированные сотрудники нашего института  осуществляют:

1.    Бактериологический посев на дисбактериоз кишечника + чувствительность к бактериофагам, противогрибковым препаратам и антибиотикам до и после лечения. Данные исследования проводят с целью  выявления наличия бактерий, вызывающих такие заболевания, как дизентерия, сальмонеллез, брюшной тиф, а также нарушение микробного состава.

2.   Копрологические исследования (копрограмма). Этот вид исследования кала позволяет диагностировать нарушение функций желудка, поджелудочной железы, печени, ускоренного прохождения пищи через желудок и кишечник, нарушение всасывания в тонкой кишке; воспалительный процесс в желудочно-кишечном тракте, язвенный, аллергический и спастический колит.

3. Наличие кишечных ферментов (энтерокиназы, липазы, амилазы и др.). Показатель количества и эффективности работы пищеварительных ферментов в тонком кишечнике.

4.    Кишечные вирусы (ротавирусы, норовирусы, энтеровирусы, астровирусы) – могут вызывать острые инфекционные заболевания с разной степенью выраженности (бессимптомно, в легкой форме – с однократной рвотой и поносом, а также в тяжелой форме с выраженной интоксикацией). Особенно кишечные инфекции опасны у детей до 1-го года. Подтверждение присутствия вирусов в кале необходимо для выбора правильной тактики лечения больного.

         При исследовании кишечника в институте применяются новые, высокотехнологические методы, основанные на выявлении местных иммунологических и метаболических процессов, протекающих в кишечнике, что позволяет улучшить диагностику, лечение и профилактику заболеваний кишечника.

     Клинические анализы выполняются как «классическим» бактериологическим методом, так и с применением бактериологических анализаторов Vitek-2, масс-спектрометра Bruker, ПЦР в режиме real-time и др.

Важно отметить, что обратившийся в наш институт за медицинским обследованием человек получает максимально возможную информацию из одной пробы материала, что значительно облегчает обследование пациентов и дает максимально полную информацию для лечащего врача. 

 

Дисбактериоз — миф российской медицины

Тем не менее, как дань дремучим совковым традициям, «дисбактериоз» продолжает слетать с языка многих практикующих врачей, особенно педиатров. По-прежнему стандарты медосмотров малышей включают тестирование кала на «дисбактериоз». При этом давно известно, что искать корреляцию между составом флоры в кале и реальным ее соотношением в криптах кишечника — все равно, что гадать на кофейной гуще. Во-первых, основу кишечной флоры составляют бактероиды, которые не растут на питательных средах. Во-вторых, соотношение бактерий на выходе имеет очень мало общего с тем, что живет в кишке. В-третьих, все то время, пока вы собираете и несете ваши бесценные фекалии в лабораторию, жизнь в них не прекращается, и уже через несколько часов вся флора и фауна кала радикально видоизменяется. А потому все заключения о «преобладании патогенной флоры над нормальной» в таком анализе попросту смехотворны.

В общем, всем нам надо понимать, что такого самостоятельного заболевания, как дисбактериоз, в природе нет.

Существуют лишь ряд временных состояний организма (те же вирусные диареи или длительная антибиотикотерапия), которые могут привести к временному же дисбалансу нормальной флоры. При этом дисбаланс этот, как правило, не качественный, а количественный. В пример могу привести чрезмерный рост бактерии Clostridium difficile с развитием псевдомембранозного колита на фоне длительной терапии антибиотками.

Чаще же всего дискомфорт в животе обусловлен не мифическими заболеваниями, а совершенно реальным бунтом организма против всякой колы и прочей мак-дряни. Если вашего ребенка в животе не прекращается “шум и гам”, в первую очередь посмотрите, что он у вас ест.

У взрослых под «дисбактериозом» нередко скрываются синдром раздраженного кишечника, синдром избыточного бактериального роста в тонкой кишке, лактазная недостаточность, а также другие невыявленные состояния, при которых нарушается баланс кишечной флоры. Эти расстройства надо лечить, воздействуя на причину такого дисбаланса, а не сам дисбаланс, который является лишь следствием.

На теме дисбактериоза активно паразитируют различные производители кисломолочных продуктов питания, пробиотиков (препаратов с живыми бактериальными культурами) и пребиотиков (веществ, не перевариваемых человеком, но являющихся пищей для ряда бактерий).

Как я уже объяснил в колонке о кишечной флоре, бактерии пробиотиков могут становиться лишь транзитными колонистами, тогда как цель всех лечебных мероприятий заключается в восстановлении баланса СОБСТВЕННОЙ микрофлоры.

В ряду многочисленных препаратов для коррекции дисбактериоза хочу выделить особо абсурдный класс лекарств — бактериофаги. Бактериофаги — это такие вирусы, которые поражают бактерий. Когда-то ученые предложили использовать их против стафилококков, кишечных палочек и других возбудителей диарей. Однако исследования показали, что бактериофаги полностью разрушаются в желудке, и от таких препаратов во всем мире давно уже отказались. Точнее, во всем мире, кроме России — у нас эти псевдолекарства популярны и по сей день, и особенно хорошо неэффективные препараты лечат несуществующие дисбактериозы.

Если ваш врач уверенно заявляет, что ваша микрофлора разбалансирована, и вы вовсю уже «страдаете дисбактериозом», не паникуйте! Попытайтесь отыскать грамотного специалиста, который не станет жонглировать несуществующими диагнозами и назначать фуфломицины, а займется общепринятой диагностикой, которая позволит отличить инфекционную или органическую патологию кишечного тракта от физиологических и психосоматических расстройств. И не спешите разоряться в аптеках! Лучше сэкономьте деньги на полноценное питание себе и вашим детям, «подкормите» микрофлору естественным образом — здоровой пищей. Растительные волокна овощей, фруктов и зерновых — лучшая поддержка для

worldmedicine.by — Аллергия и дисбиоз кишечника

В последние годы отмечается значительный рост числа аллергических болезней среди населения Беларуси, что требует особого внимания к проблеме как со стороны специалистов аллергологической службы, так и родителей. В связи с этим большое значение придается вопросам профилактики, диагностики и лечения аллергии и ее проявлений. Этот вопрос мы обсудили с главным внештатным аллергологом комитета по здравоохранению г. Минска Галиной Викторовной РАЧИНСКОЙ.

Развитие многих аллергических заболеваний происходит на фоне изменения состава нормальной микрофлоры кишечника, то есть на фоне дисбиоза.

Наиболее выражена данная взаимосвязь у детей, в связи с незрелостью иммунной системы и ее повышенной реактивностью по отношению к аллергенам. Основным местом проникновения аллергенов в организм ребенка является ЖКТ – слизистая кишечника. На фоне развития дисбиоза нарушается пищеварение, уменьшается защитная функция слизистой оболочки, что способствует

стойкому проникновению аллергенов в организм ребенка, формированию длительной и стойкой сенсибилизации, что, в свою очередь приводит к формированию того или иного аллергического заболевания.

Для взрослых также характерна связь кожных аллергозов с дисбиозом кишечника.

— Скажите, пожалуйста, каковы 

современные подходы к применению препаратов для нормализации микрофлоры кишечника, с целью профилактики аллергических заболеваний?

Комплексная терапия аллергических заболеваний включает лечение дисбиоза кишечника, что подразумевает коррекцию рациона питания и прием пробиотиков. Пробиотические препараты – лекарственные средства, содержащие культуры бактерий, которые, при назначении их в адекватных количествах, оказывают пользу для здоровья человека. На сегодняшний день к данным препаратам предъявляется целый ряд требований, они должны быть непатогенными и нетоксичными, содержать

большое число жизнеспособных 

организмов, быть резистентными в отношении желудочного, билиарного и панкреатического секретов, обладать высокой адгезивной и антагонистической способностью к патогенным и условно-патогенным микроорганизмам, не угнетать нормальную микрофлору кишечника. В последние годы в арсенале врачей появляется все больше эффективных

препаратов. Одним из таких является препарат Лацидофил-WM.

Лацидофил-WM представляет собой сочетание двух штаммов лактобактерий Lactobacillus rhamnosus-

Rosell 11 и Lactobacillus acidophilus Rosell 52. В одной капсуле препарата содержится не менее 2 млрд. живых бактерий. Данные штаммы об

адают высоким уровнем выживаемости при преодолении кислотного барьера желудка и щелочного барьера 12-перстной кишки. Помимо высокой резистентности Lactobacillus rhamnosus и acidophilus обладают адгезивной способностью к эпителию

кишечника (энтероцитам), способны надежно прикрепляться к кишечной стенке и длительно сохраняться в живом виде. Препарат имеет высокий профиль безопасности, так как содержит только представителей нормальной микрофлоры кишечника, разрешен к применению с 6 месяцев. Лацидофил –WM не содержит примесей молока, что позволяет применять его пациентам с аллергией на коровье молоко, и, за счет содержания в нем значительного количества 

лактобактерий, улучшает переносимость лактозы (молочного сахара) у лиц с лактазной недостаточностью.

— Что бы вы посоветовали пациентам, которые страдают различными формами аллергии?

— Соблюдать рекомендации лечащего врача и не заниматься самолечением.

 

Исследование микробиоценоза кишечника (дисбактериоз)

Код услуги

77010190

Описание

Дисбактериоз кишечника, синдром избыточного бактериального роста, дисбиоз кишечника.  Цель исследования.изучение флоры толстой кишки , выявление дисбиотических состояний. Определение чувствительности выделенной условно-патогенной микрофлоры к бактериофагам. Исследуемый материал.Кал. Показания к исследованю. Длительно протекающие кишечные расстройства. Затянувшийся период реконвалесценции после ОКИ. Дисфункция кишечнника у лиц , длительно подвергающихся воздействию вредных факторов ( излучение, химиотерапия, гормональная терапия). Наличие системной воспалительной реакции или бактериемии. Частые респираторные инфекции. Аллергические заболевания.  Диагностическое значение.Кишечная микрофлора это весьма лабильная система, подверженная колебаниям. Поэтому чтобы отличить так называемые временные вариации состава микрофлоры от дисбактериоза необходимо проведение кратных исследований с интервалом в несколько дней.  По характеру отклонений микрофлоры кишечника от нормы условно выделяют 3 степени дисбактериоза: I степень — незначительное снижение количества бифидо и лактобактерий на 1-2 степени, снижение содержания кишечной палочки с нормальной ферментативной активностью или появление измененных кишечных палочек (лактозоотрицательных и гемолитических)  II степень — снижение концентрации бифидобактерий  и лактобактерий,  повышение численности условно — патогенных микроорганизмов, III степень — значительной снижение или полное отсутствие бифидобактерий и лактобактерий, численное превосходство условно — патогенных энтеробактерий, псевдомонад, кандид, стафилококков. Подготовка к исследованию.  Кал собирают в стерильный контейнер с ложечкой сразу после дефекации в количестве 1-2 г. При запорах можно использовать слабительные средства только растительного происхождения (сена , свекла, слабительный чай, чернослив) Кал должен быть нормальной консистенции. Нельзя использовать клизму. Микробиологическое исследование производится не ранее, чем через 7-10 дней после прекращения приема антибиотиков, химиопрепаратов. Результат через 5 рабочих дней. Результат бактериологического исследования не является диагнозом. Диагноз ставит только лечащий врач  на основании совокупности результатов различных исследований, общего состояния пациента, клинической картины.

Подготовка

Кал для исследования отбирается из средней порции в количестве 1-2г (2 ложечки) в специальный стерильный контейнер. При запорах можно использовать слабительные средства только растительного происхождения (сена, слабительный чай,чернослив, свекла). Кал должен быть нормальной консистенции. Нельзя использовать клизму. Доставка кала в течение 2 часов, кроме воскресенья.

Дисбиоз кишечника у обезьян, инфицированных SARS-COV-2

Группа французских ученых из Лилльского центра по изучению инфекций и иммунитета в сотрудничестве с CEA, INRAE, Институтом Пастера и больницей Сент-Антуан в Париже показала, что вирус SARS-CoV-2, вызывающий Covid-19, провоцирует развитие дисбиоза кишечника у обезьян и сохраняется даже после избавления организма от вируса.

Тщательно регулируемое взаимодействие между кишечной микробиотой и организмом хозяина влияет на многие физиологические функции, включая иммунный гомеостаз. Доклинические и клинические данные указывают на временное изменение состава микробиоты кишечника при острых респираторных вирусных инфекциях. В случае Covid-19 изучение микробиоты кишечника во время инфекции особенно важно, учитывая, что SARS-CoV-2 может связываться с рецепторами ангиотензинпревращающего фермента (АПФ) 2 типа в кишечнике. Известно, что вирус обнаруживается в кишечнике до 25% пациентов, а изменения микробиоты кишечника, связанные с легочными и кишечными осложнениями, могут влиять на тяжесть заболевания. Это доклиническое исследование — первое, в котором изучалось влияние инфекции SARS-CoV-2 на изменение микробиоты кишечника обезьян.

Обезьяна — удобная модель для изучения инфекции SARS-CoV-2

Об инфекции Covid-19 у человека собрано много данных, но они не позволяют проследить весь ход заболевания, начиная от доинфекционной стадии и заканчивая периодом после выздоровления. Для восполнения недостающей информации было проведено исследование на двух видах обезьян — яванских макаках и макаках-резус. Эти приматы — хорошая модель для изучения Covid-19, поскольку вирус SARS-CoV-2 реплицируется в верхних и нижних дыхательных путях, вызывая заболевание легких и дыхательных путей в отсутствие явных клинических симптомов. По две обезьяны каждого вида были инфицированы интраназально и интратрахеально. За 9 дней до заражения, а также через 0, 3, 5, 7, 10, 13, 20 и 26 дней после заражения (ДПЗ) у животных брали образцы крови (для измерения уровней цитокинов) и стула. Через 4 ДПЗ у двух обезьян развилась преходящая диарея.

Дисбиоз кишечника сохраняется даже после выздоровления от Covid-19…

Результаты секвенирования гена 16S рРНК показали значимые изменения в составе микробиоты кишечника обезьян, при этом максимальные изменения отмечались на 10–13 ДПЗ. У двух обезьян вирус не обнаруживался в носоглотке и трахее через 20 ДПЗ, но все еще обнаруживается в стуле. Некоторые изменения микробиоты сохранялись после исчезновения SARS-CoV-2 из верхних дыхательных путей даже через 26 ДПЗ. Во время инфекции наблюдались значимые изменения в количестве бактериальных таксонов, особенно на 13 ДПЗ. В частности, относительное преобладание Acinetobacter и некоторых представителей родов семейства Ruminococcaceae положительно коррелировало с наличием SARS-CoV-2 в верхних дыхательных путях.

…а также изменяется функциональная активность кишечной микробиоты

Для оценки функциональных последствий изменений микробиоты кишечника, связанных с инфекцией, ученые использовали метаболомический подход. Целью исследования было количественное определение трех наиболее важных категорий метаболитов микробиоты: короткоцепочечных жирных кислот (КЦЖК), желчных кислот и метаболитов триптофана. Уровни КЦЖК изменялись на протяжении всей инфекции, особенно в период между 2 и 13 ДПЗ. У инфицированных животных также были выявлены изменения в содержании нескольких желчных кислот и метаболитов триптофана. Относительное преобладание нескольких таксонов, известных как продуценты КЦЖК (в основном из семейства Ruminococcaceae), отрицательно коррелировало с некоторыми системными маркерами воспаления, в то время как наличие представителей рода Streptococcus коррелировало с теми же маркерами сильно и положительно. Результаты исследования показали, что экспериментальная инфекция SARS-CoV-2 у обезьян связана с нарушением состава и функциональной активности микробиоты кишечника. Ученые делают вывод, что дисбиоз после разрешения инфекции также может влиять на длительность сохранения симптомов Covid-19 и у людей.

Страница статьи : Клиническая медицина

Бондаренко В.М., Мацулевич Т.В. Дисбактериоз кишечника, как клинико-лабораторный синдром: современное состояние проблемы. М., 2007.

Циммерман Я.С., Циммерман И.Я. Классификация гастроэнтерологических заболеваний и клинических синдромов. 4е изд. Пермь, 2014.

Отраслевой стандарт: «Дисбактериоз кишечника» ОСТ 91.500 11.0004 от 9.06.2003.

Билибин А.Ф. Проблема дисбактериоза в клинике. Терапевтический архив. 1967: 11: 21-8.

Билибин А.Ф. Дисбактериоз, аутоинфекция и их значение в патологии и клинике человека. Клиническая медицина. 1970; 2: 7-12.

Nissle A. Ǘber die Grundladen einer neuen ursachligen Bekanfung der patologischen Darmflora. Dtsch. Med. Wschr. 1916; 42: 1181-4.

Циммерман Я.С. Дисбиоз («дисбактериоз») кишечника и/или синдром избыточного бактериального роста. Клиническая медицина. 2005; 4: 14-22.

Циммерман Я.С. Эубиоз и дисбиоз желудочно-кишечного тракта: мифы и реалии. Клиническая медицина. 2013; (1): 4-11.

Циммерман Я.С. О сущности понятия «дисбактериоз» (дисбиоз) кишечника и правомерности использования этого термина. Российский журнал гастроэнтерологии, гепатологии и колопроктологии. 2000; 1: 81-4.

Циммерман Я.С. Антибактериальная терапия и ее влияние на эндоэкологическую систему «макроорганизм — эндосимбионтные бактерии» (на примере Helicobacter pylori-ассоциированных заболеваний). Клиническая фармакология и терапия. 2015; 2: 5-12.

Blaser M.J. Falkow S. Исчезающая микробиота. Клиническая фармакология и терапия. 2014; 23 (4): 7-15.

Барышникова Н.В., Ткаченко Е.И., Успенский Ю.Т. Синдромы избыточного бактериального роста (дисбиоза) в тонкой кишке и дисбиоза толстой кишки. Вестник клуба панкреатологов. 2009; 1: 86-90. (Украина).

Macfarlane G.T. Human colonic bacteria: Role in nutrition, phisiology and pathology. CRC — Press, 1995: 1-18.

Huse S.M., Ye Y., Zhou Y., Fodor A.A. A core human microbiome as viewed trough 16 Sr RNA sequence clusters. PLoS One. 2012; 7 (6): e34242.

Eckburg P.B., Bik E.M., Bernstein C.N. et al. Diversiti of the human intestinal microbial flora. Science. 2005; 308: 1635-8.

Ардатская М.Д. Дисбактериоз кишечника: понятие, диагностика, принципы лечебной коррекции. Consilium medicum. 2008; 8: 86-92.

Урсова Н.И. Иммунологическая функция интестинальной микрофлоры, её нарушения и возможности коррекции. Альманах клинической медицины. 2015; 40: 35-46.

Tannock G.W. Normal microflora. — London: Chapman, Hall, 1995.

Кучумова С.Ю. Полуэктова Е.А., Шептулин А.А., Ивашкин В.Т. Физиологическое значение кишечной микрофлоры. Российский журнал гастроэнтерологии, гепатологии и колопроктологии. 2011; 5: 17-27.

Bäckhed F., Ley R.E., Sonnenburg J.L. et al. Host-bacterial mutualism in the human intestine. Science. 2005; 307 (5717): 1915-20.

Magalhaes J.G., Tattoli I., Girardin S.E. The intestinal epithelial barrier: How to distanguisth between the microbial flora and pathogens. Semin. Immunol. 2007; 19 (2): 106-15.

Guarner F., Malagelada J.R. Gut microflora in health and disease. Lancet. 2003:361 (9356): 512-9.

Sekirov I., Russel S.L., Antunes R.C., Finley B.B. Gut microflora in health and disease. Physiol. Rev. 2010; 90 (3): 859-904.

Черешнев В.А., Циммерман Я.С., Морова А.А. Причины и последствия разрушения природной экологической системы «макроорганизм — эндосимбионтные бактерии», выработанной в процессе эволюции и естественного отбор. Клиническая медицина. 2001; (9): 4-8.

Vinderola G. Proposed model: Mechanisms of immunomodulation induced by probiotic bacteria. Clin. Vaccine Immunol. 2007; 14 (5): 485-92.

Kelly D., Konway S., Aminov R. Commensal gut bacteria: Mechanisms of immune modulation. Trends. Immunol. 2005; 26 (6): 326-33.

Perdigon G., Fuller R., Roja R. Lactic acid bacteria and their effect in the immune system. Curr. Issues Intest. Microbiol. 2001; 2 (1): 27-42.

Quigley E. Microflora modulation of motility. J. Neurogastroenterol. Motil. 2011; 17: 140-7.

O’Hara A.M., Shanahan F. The gut flora as a forgotten organ. EMBO Rep. 2006; 7 (7): 688-93.

Минушкин О.Н. Дисбактериоз кишечника: современное состояние проблемы. Consilium medicum. 2004; 9 (7): 59-64.

Hentges D.J. Human intestinal microflora in health and disease. — New-York: Academic press, 1995.

Jernberg C., Lofmark S.,Edlung C., Janssen J. Long-term impacts of antibiotic exposure on the human intestinal microbiota. Microbiology. 2010; 156: 3216-23.

Митрохин С.Д. Дисбактериоз: современный взгляд на проблему. Инфекция и антимикробная терапия. 2000; 5: 15-7.

Циммерман Я.С., Циммерман И.Я. Антибиотико-ассоциированная диарея и псевдомембранозный колит — суть клинически манифестные формы кишечного дисбиоза. Клиническая медицина. 2005; (12): 12-19.

Рапопорт С.И. Антибиотико-ассоциированный энтероколит. Клиническая медицина. 2004; (1): 60-1.

Berlett J.G. Antibiotic-associated diarrhea. N. Engl. J. Med. 2002; 346 (5): 334-339.

Nustrat A., von Eichel — Streiber C., Turner J.R.et al. Clostridium difficile toxsins A and B result in selected movement of teigh, junction-associated proteins from the membrane. Gastroenterology. 1998; 114 (4): 1644-51.

Терапевтический справочник Вашингтонского университета. — 2ое русск. изд. — М., 2000: 439.

Codling C., O’Mahony L., Shandahan F. et al. A molecular analysis of fecal- and mucosal communities in irritable bowel syndrome Dig. Dis. Sci. 2010; 55: 392-7.

Blum S., Schiffrin E.J. Intestinal microflora and homeostasis of the mucosal immune response: Implication for probiotic bacteria? Curr. Issues Intest. Microbiol. 2003; 4 (2): 53-60.

Барановский А.Ю., Кондрашина Э.А. Дисбактериоз и дисбиоз кишечника. — С.-Петербург, 2000.

Saltzman I.R., Russel R.M. Nutritional consequences of intestinal bacterial overgrowth. Compr. Ther. 1994; 20: 23-30.

Лыкова Е.А., Бондаренко В.М., Парфёнов А.И., Мацулевич Т.В. Синдром избыточного бактериального роста в тонкой кишке: патогенез, клиническое значение и тактика терапии. Экспериментальная и клиническая гастроэнтерология. 2005; (6): 51-7.

Pimental M., Chow E.V., Lin H.C. Eradication of small intestinal overgrowth reduce symptoms in irritable bowel syndrome. Am. J. Gastroenterol. 2000; 95: 3501-6.

Bouhkik Y., Alain S., Atter A. et al. Bacterial populatians contaminating the upper gut in patients with small intestinal bacterial overgrowth syndrome. Am. J. Gastroenterol. 1999; 94: 1327-31.

Robin-Browne R.M. Bacterial infections of the small intestine and colon. Curr. Opin. Gastroenterol. 1996; 10: 68-75.

Toskes Ph. P., Kumar A. Enteric bacterial flora and bacterial overgrowth syndrome. — Slesinger. Fordtran’s gastrointestinal and liver disease. — Philadelphia-London-Toronto, 1998; 2: 1523-35.

Воробьёв А.А., Абрамов Н.А., Бондаренко В.М., Шендеров Б.А. Дисбактериоз — актуальная проблема медицины. Вестник РАМН. 1997; 3: 4-7.

Малов В.А. Антибиотико-ассоциированные поражения кишечника. Врач. 2000; (10): 16-19.

Диагностика и лечение синдрома раздражённой кишки (Материалы «круглого стола»). Российский журнал гастроэнтерологии, гепатологии и колопроктологии. 1999; 2: 61-71.

Shida K., Nanno M. Probiotics and immunology: Separating the wheat from the chaff. Trands. Immunol. 2008; 29 (11): 565-73.

Белоус С.С., Халиф И.Л., Коренева Т.К., Конович Е.А. Влияние пробиотиков на состав микрофлоры толстой кишки и уровень сывороточных цитокинов у пациентов с синдромом раздражённого кишечника. Фарматека. 2015; 15: 44-57.

Thornton G., O’Sullivan M., O’Sullivan D. et al. Human intestinal probiotic bacteria — production of antimicrobial factors. Ir. J. Med. Sci. 1993; 162 (9): 363-8.

Collins M.D. Probiotics, prebiotics and synbiotics: Approaches for modulating the microbial ecology of the gut. Am. J. Clin. Nutr. 1999; 69 (Suppl): 1052-7.

Fuller R., Gibson G.R. Probiotics and prebiotics: Microflora management for improved gut health. Clin. Microbial. Infect. 1998; 4: 477-80.

Шендеров Б.А. Медицинская микробная экология и функциональное питание. В 2 т. — М., 1998.

Михайлова Т.Л., Каминская Т.Ю., Румянцев В.Т. Биопрепараты и пищевые факторы в коррекции дисбактериоза. Российский журнал гастроэнтерологии, гепатологии и колопроктологии. 1999; (3): 67-70.

McFarland L.V., Bernosconi I.P. Энтерол (Saccharomyces boulardii): свойства нового биотерапевтического агента. Клиническая фармакология и терапия. 1997; 1: 38-45.

Top J., Mondot S., Levenez F. et al. Towards the human intestinal microbiota philogenetic core. Environ. Microbiol. 2009; 11 (10): 2574-84.

Ситкин С.И., Ткаченко Е.И., Вахитов Т.Я. Филометаболическое ядро микробиоты кишечника. Альманах клинической медицины. 2015; 40: 12-34.

Чернин В.В. Симбионтное пищеварение человека. Тверь, 2013.

Чернин В.В., Парфёнов А.И., Бондаренко В.М. и др. Симбионтное пищеварение человека: физиология, клиника, диагностика и лечение её нарушений. Тверь, 2013.

Дисбиоз кишечника и некротизирующий энтероколит: оценка причинно-следственной связи с использованием критериев Брэдфорда Хилла

  • Pammi, M. et al. Дисбактериоз кишечника у недоношенных детей, предшествующий некротизирующему энтероколиту: систематический обзор и метаанализ. Микробиом 5 , 31 (2017).

    ПабМед ПабМед Центральный Google ученый

  • Ван Ю. и др. Анализ фекальной микробиоты недоношенных детей с некротизирующим энтероколитом и без него на основе гена 16S рРНК. ISME J. 3 , 944–954 (2009).

    КАС пабмед ПабМед Центральный Google ученый

  • Миллар, М. Р. и др. Применение ПЦР гена 16S рРНК для изучения кишечной флоры недоношенных детей с некротизирующим энтероколитом и без него. Дж. Клин. микробиол. 34 , 2506–2510 (1996).

    КАС пабмед ПабМед Центральный Google ученый

  • Гроер М.В. и др. Развитие микробиома кишечника недоношенных детей: приоритет исследований. Микробиом 2 , 38 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Мшвилдадзе М. и др. Кишечная микробная экология у недоношенных детей, оцененная с помощью методов, не основанных на культуре. Ж. Педиатр. 156 , 20–25 (2010).

    ПабМед ПабМед Центральный Google ученый

  • Май, В.и другие. Фекальная микробиота у недоношенных детей до развития некротизирующего энтероколита. PLoS ONE 6 , e20647 (2011).

    КАС пабмед ПабМед Центральный Google ученый

  • Zhou, Y. et al. Продольный анализ кишечного микробиома недоношенных детей до некротизирующего энтероколита: исследование случай-контроль. PLoS ONE 10 , e0118632 (2015).

    ПабМед ПабМед Центральный Google ученый

  • Уорнер Б.Б. и др. Бактериальный дисбиоз кишечника и некротизирующий энтероколит у новорожденных с очень низкой массой тела при рождении: проспективное исследование случай-контроль. Ланцет 387 , 1928–36 (2016).

    Google ученый

  • Линдберг Т. П. и др. Микробные паттерны кишечника недоношенных детей, связанные с развитием некротизирующего энтероколита. Дж. Матерн. Фетальная неонатальная мед. 9 , 1–10 (2018).

  • Хилл, А.B. Окружающая среда и болезнь: связь или причинность? Проц. R Соц. Мед. 58 , 295–300 (1965).

    КАС пабмед ПабМед Центральный Google ученый

  • Федак К.М., Бернал А., Кэпшоу З.А. и Гросс С. Применение критериев Брэдфорда Хилла в 21 веке: как интеграция данных изменила вывод о причинно-следственных связях в молекулярной эпидемиологии. Аварийный. Темы Эпидемиол. 12 , 14 (2015).

    ПабМед ПабМед Центральный Google ученый

  • Полин Р.А. и др. Некротизирующий энтероколит у доношенных детей. Ж. Педиатр. 89 , 460–462 (1976).

    КАС пабмед Google ученый

  • Балланс, В. А., Дамс, Б. Б., Шенкер, Н. и Клигман, Р. М. Патология неонатального некротизирующего энтероколита: десятилетний опыт. Ж. Педиатр. 117 , S6–S13 (1990).

    КАС пабмед Google ученый

  • Tait, R. A. & Kealy, W. F. Некротизирующий энтероколит новорожденных. Дж. Клин. Патол. 32 , 1090–1099 (1979).

    КАС пабмед ПабМед Центральный Google ученый

  • Berdon, W. E. et al. Некротизирующий энтероколит у недоношенных детей. Радиология 83 , 879–887 (1964).

    КАС пабмед Google ученый

  • Remon, J. I. et al. Глубина бактериальной инвазии в ткани резецированного кишечника является прогностическим фактором летальности при хирургическом некротизирующем энтероколите. Ж. Перинатол. 35 , 755–762 (2015).

    КАС пабмед ПабМед Центральный Google ученый

  • Груша, Б.L. Пневматоз кишечника: обзор. Радиология 207 , 13–19 (1998).

    КАС пабмед Google ученый

  • Bury R.G., Tudehope D. 2001 Энтеральные антибиотики для профилактики некротизирующего энтероколита у новорожденных с низкой массой тела при рождении или недоношенных. Кокрановская система базы данных. Ред. CD000405 .

  • Махешвари, А. Иммунологические и гематологические нарушения при некротическом энтероколите. клин. перинатол. 42 , 567–585 (2015).

    ПабМед ПабМед Центральный Google ученый

  • Gephart, S.M. et al. Изменение парадигмы определения, обнаружения и диагностики НЭК: взгляды на стадии Белла и биомаркеры НЭК. Семин. Педиатр. Surg. 27 , 3–10 (2018).

    ПабМед Google ученый

  • Коггинс, С.А., Винн, Дж. Л. и Вайткамп, Дж. Х. Инфекционные причины некротизирующего энтероколита. клин. перинатол. 42 , 133–154 (2015), ix.

    ПабМед Google ученый

  • Нантакумар, Н. Н., Фусунян, Р. Д., Сандерсон, И. и Уокер, В. А. Воспаление в развивающемся кишечнике человека: возможный патофизиологический вклад в некротизирующий энтероколит. Проц. Натл акад. науч. США 97 , 6043–6048 (2000).

    КАС пабмед Google ученый

  • Моллитт, Д. Л., Тепас, Дж. Дж. 3-й и Талберт, Дж. Л. Микробиология неонатального перитонита. Арх. Surg. 123 , 176–179 (1988).

    КАС пабмед Google ученый

  • Бочча Д., Столфи И., Лана С. и Моро М.Л. Вспышки внутрибольничного некротизирующего энтероколита: эпидемиология и меры борьбы. евро. Дж. Педиатр. 160 , 385–391 (2001).

    КАС пабмед Google ученый

  • Gregersen, N. et al. Klebsiella pneumoniae с бета-лактамазной активностью расширенного спектра, связанная со вспышкой некротизирующего энтероколита. Педиатр. Заразить. Дис. J. 18 , 963–967 (1999).

    КАС пабмед Google ученый

  • Хилл, Х.Р., Хант, К.Э. и Матсен, Дж.М. Внутрибольничная колонизация клебсиеллой типа 26 в отделении интенсивной терапии новорожденных, связанная со вспышкой сепсиса, менингита и некротизирующего энтероколита. Ж. Педиатр. 85 , 415–419 (1974).

    КАС пабмед Google ученый

  • Ван Акер, Дж. и др. Вспышка некротизирующего энтероколита, ассоциированного с Enterobacter sakazakii в сухих молочных смесях. Дж. Клин. микробиол. 39 , 293–297 (2001).

    ПабМед ПабМед Центральный Google ученый

  • Torrazza, R. M. et al. Кишечная микробная экология и факторы окружающей среды, влияющие на некротизирующий энтероколит. PLoS ONE 8 , e83304 (2013).

    ПабМед ПабМед Центральный Google ученый

  • Морроу, А.Л. и др. Ранние микробные и метаболические признаки предсказывают более позднее начало некротизирующего энтероколита у недоношенных детей. Микробиом 1 , 13 (2013).

    ПабМед ПабМед Центральный Google ученый

  • Хофлер, М. Размышления Брэдфорда Хилла о причинности: контрфактическая точка зрения. Аварийный. Темы Эпидемиол. 2 , 11 (2005).

    ПабМед ПабМед Центральный Google ученый

  • Макмертри, В.Э. и др. Бактериальное разнообразие и обилие клостридий снижаются с увеличением тяжести некротизирующего энтероколита. Микробиом 3 , 11 (2015).

    ПабМед ПабМед Центральный Google ученый

  • Smith, B. et al. Исследование ранней кишечной микрофлоры у недоношенных детей с некротизирующим энтероколитом и без него двумя разными методами. Педиатр. Рез. 71 , 115–120 (2012).

    КАС пабмед Google ученый

  • Сим, К. и др. Дисбиоз, предшествующий некротизирующему энтероколиту у глубоконедоношенных детей. клин. Заразить. Дис. 60 , 389–397 (2015).

    КАС пабмед Google ученый

  • de la Cochetiere, M. F. et al. Ранняя кишечная бактериальная колонизация и некротизирующий энтероколит у недоношенных детей: предполагаемая роль Clostridium. Pediatr Res 56 , 366–370 (2004).

    ПабМед Google ученый

  • Romano-Keeler, J. et al. Различные микробные сообщества слизистой оболочки у детей раннего возраста с хирургическим некротизирующим энтероколитом коррелируют с возрастом и воздействием антибиотиков. PLoS One 13 , e0206366 (2018 г.).

    ПабМед ПабМед Центральный Google ученый

  • Стюарт, К.Дж. и др. Микробиота кишечника недоношенных: изменения, связанные с некротизирующим энтероколитом и инфекцией. Acta Paediatr 101 , 1121–1127 (2012).

    КАС пабмед Google ученый

  • Normann, E., Fahlen, A., Engstrand, L. & Lilja, H.E. Микробные профили кишечника у крайне недоношенных детей с некротизирующим энтероколитом и без него. Acta Paediatr 102 , 129–136 (2013).

    ПабМед Google ученый

  • Вандро С. и др. Микробиом и метаболом стула недоношенных детей индивидуализированы и не зависят от последствий для здоровья, включая некротический энтероколит и поздний сепсис. мСфера 3 (2018).

  • Itani, T. et al. У недоношенных детей с некротизирующим энтероколитом наблюдается несбалансированная микробиота кишечника. Acta Paediatr 107 , 40–47 (2018).

    ПабМед Google ученый

  • Barron, L.K. et al. Независимость бактериального состава кишечника от тяжести неонатального некротизирующего энтероколита. J Pediatr Surg 52 , 993–998 (2017).

    ПабМед ПабМед Центральный Google ученый

  • Brown, C. T. et al. Госпитализированные недоношенные дети колонизированы родственными бактериальными штаммами с отчетливыми протеомными профилями. MBio 9 , e00441–18 (2018).

    КАС пабмед ПабМед Центральный Google ученый

  • Рави А. и др. Ассоциация подвижности кишечной микробиоты с местонахождением больницы и массой тела при рождении у недоношенных детей. Pediatr Res 82 , 829–838 (2017).

    ПабМед Google ученый

  • Stewart, C.J. et al. Временное бактериальное и метаболическое развитие кишечника недоношенных выявляет специфические признаки в норме и при заболевании.Микробиом 4 , 67 (2016).

  • Heida, F.H. et al. Микробиота кишечника, связанная с некротизирующим энтероколитом, присутствует в меконии: результаты проспективного исследования. Clin Infect Dis 62 , 863–870 (2016).

    КАС пабмед Google ученый

  • La Rosa, P. S. et al. Паттерн прогрессирования бактериальных популяций в кишечнике недоношенных детей. Proc Natl Acad Sci USA 111 , 12522–12527 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Itani, T. et al. Создание и развитие кишечной микробиоты недоношенных детей в больнице третичного уровня в Ливане. Anaerobe 43 , 4–14 (2017).

    ПабМед Google ученый

  • Грегори, К. Э. и др. Влияние приема материнского грудного молока на приобретение кишечного микробиома у недоношенных детей. Микробиом 4 , 68 (2016).

    ПабМед ПабМед Центральный Google ученый

  • Конг, X. и др. Модели развития микробиома кишечника в раннем возрасте недоношенных детей: влияние кормления и пола. PLoS ONE 11 , e0152751 (2016).

    ПабМед ПабМед Центральный Google ученый

  • Парм, У., Мецвахт, Т., Ilmoja, M.L. & Lutsar, I. Колонизация кишечника аэробными микроорганизмами связана с путем и типом питания у недоношенных новорожденных. Нутр. Рез. 35 , 496–503 (2015).

    КАС пабмед Google ученый

  • Равех-Садка Т. и др. Кишечные бактерии редко встречаются у совместно госпитализированных недоношенных детей, независимо от развития некротизирующего энтероколита. Elife 4 , e05477 (2015).

  • Арболея С. и др. Развитие кишечной микробиоты у недоношенных новорожденных и влияние перинатальных антибиотиков. Ж. Педиатр. 166 , 538–544 (2015).

    КАС пабмед Google ученый

  • Арболея С. и др. Становление и развитие кишечной микробиоты у недоношенных новорожденных. FEMS микробиол. Экол. 79 , 763–772 (2012).

    КАС пабмед Google ученый

  • Май, В.и другие. Нарушения развития кишечной микробиоты, связанные с поздним сепсисом у недоношенных детей. PLoS ONE 8 , e52876 (2013).

    КАС пабмед ПабМед Центральный Google ученый

  • Schwiertz, A. et al. Развитие бактериального состава кишечника у госпитализированных недоношенных детей по сравнению с доношенными детьми, находящимися на грудном вскармливании. Педиатр. Рез. 54 , 393–399 (2003).

    ПабМед Google ученый

  • Ho, T.B.T. et al. Дихотомическое развитие микробиома кишечника у недоношенных детей. Микробиом 6 , 157 (2018).

    ПабМед ПабМед Центральный Google ученый

  • Gibson, M.K. et al. Динамика развития микробиоты кишечника недоношенных детей и антибиотикорезистом. Нац. микробиол. 1 , 16024 (2016).

    КАС пабмед ПабМед Центральный Google ученый

  • Моровиц, М. Дж. и др. Геномный анализ кишечной микробной колонизации недоношенного ребенка с разрешением штамма. Проц. Натл акад. науч. США 108 , 1128–1133 (2011).

    КАС пабмед Google ученый

  • Брукс, Б. и др.Микробы в отделении интенсивной терапии новорожденных напоминают микробы, обнаруженные в кишечнике недоношенных детей. Микробиом 2 , 1 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Гринвуд, К. и др. Раннее эмпирическое применение антибиотиков у недоношенных детей связано с более низким бактериальным разнообразием и более высоким относительным обилием энтеробактерий. Ж. Педиатр. 165 , 23–29 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Аагард, К.и другие. Плацента содержит уникальный микробиом. Науч. Перевод Мед. 6 , 237ra265 (2014).

    Google ученый

  • Палмер К., Бик Э. М., Ди Джулио Д. Б., Релман Д. А. и Браун П. О. Развитие кишечной микробиоты младенцев человека. PLoS Биол. 5 , e177 (2007).

    ПабМед ПабМед Центральный Google ученый

  • Домингес-Бельо, М.Г. и др. Способ родоразрешения определяет приобретение и структуру исходной микробиоты в различных средах обитания новорожденных. Проц. Натл акад. науч. США 107 , 11971–11975 (2010 г.).

    ПабМед Google ученый

  • MacQueen, B.C. et al. Повышенные уровни фекального кальпротектина при некротизирующем энтероколите связаны с активацией нейтрофилов, вытесняющих нейтрофильные внеклеточные ловушки. Ж. Перинатол. 36 , 862–869 (2016).

    КАС пабмед ПабМед Центральный Google ученый

  • Ho T.B.T., et al. Кишечный дисбактериоз и фекальная экспрессия кальпротектина у недоношенных детей. Педиатр. Рез. 85 , 361–368 2018. в печати.

    ПабМед ПабМед Центральный Google ученый

  • Чжан М., Чжан С. и Чжан Дж.Диагностическое значение фекального кальпротектина у недоношенных детей с некротизирующим энтероколитом. клин. лаборатория 62 , 863–869 (2016).

    КАС пабмед Google ученый

  • Lu, M.C. et al. Колибактин способствует гипервирулентности pks( + ) K1 CC23 Klebsiella pneumoniae при инфекциях менингита у мышей. Фронт. Клетка. Заразить. микробиол. 7 , 103 (2017).

    ПабМед ПабМед Центральный Google ученый

  • Штраус Д.C., Lonon, MK, Woods, D.E. & Garner, CW. Производство внеклеточного токсического комплекса различными штаммами Pseudomonas cepacia. J. Med. микробиол. 30 , 17–22 (1989).

    КАС пабмед Google ученый

  • Stone, H.H., Kolb, L.D. & Geheber, C.E. Бактериологические аспекты перфоративного некротизирующего энтероколита. Южное Мед. J. 72 , 1540–1544 (1979).

    КАС пабмед Google ученый

  • Каниони, Д.и другие. Гистопатология и микробиология изолированного ректального кровотечения у новорожденных: так называемый «экхимотический колит». Гистопатология 30 , 472–477 (1997).

    КАС пабмед Google ученый

  • Rhoads, J.M. et al. Изменение фекальной микрофлоры и повышение фекального кальпротектина у младенцев с коликами. Ж. Педиатр. 155 , 823–828 e821 (2009 г.).

    КАС пабмед Google ученый

  • Арриета, М.К., Стимсма, Л. Т., Амениогбе, Н., Браун, Э. М. и Финли, Б. Кишечный микробиом в раннем возрасте: здоровье и болезни. Фронт. Иммунол. 5 , 427 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Koenig, J.E. et al. Последовательность микробных консорциумов в развивающемся кишечном микробиоме младенцев. Проц. Натл акад. науч. США 108 (Приложение 1), 4578–4585 (2011).

    КАС пабмед Google ученый

  • Фаллани, М.и другие. Детерминанты кишечной микробиоты человека после введения первого прикорма в образцах младенцев из пяти европейских центров. Микробиология 157 , 1385–1392 (2011).

    КАС пабмед Google ученый

  • Мохан Кумар, К. и др. Индуцированное тринитробензолсульфоновой кислотой повреждение кишечника у новорожденных мышей активирует транскрипционные сети, подобные тем, которые наблюдаются при некротизирующем энтероколите у человека. Педиатр. Рез. 81 , 99–112 (2016).

    ПабМед ПабМед Центральный Google ученый

  • Мохан Кумар, К. и др. Цитокины и факторы роста в развивающемся кишечнике и при некротическом энтероколите. Семин. перинатол. 41 , 52–60 (2016).

    ПабМед ПабМед Центральный Google ученый

  • Гуд, М.и другие. Амниотическая жидкость ингибирует передачу сигналов Toll-подобного рецептора 4 в кишечном эпителии плода и новорожденного. Проц. Натл акад. науч. США 109 , 11330–11335 (2012 г.).

    КАС пабмед Google ученый

  • Хакам Д. Дж., Апперман Дж. С., Гришин А. и Форд Х. Р. Нарушение передачи сигналов энтероцитов и дисфункция кишечного барьера в патогенезе некротизирующего энтероколита. Семин. Педиатр.Surg. 14 , 49–57 (2005).

    ПабМед Google ученый

  • Leaphart, C.L. et al. Критическая роль TLR4 в патогенезе некротизирующего энтероколита путем модулирования повреждения и восстановления кишечника. Дж. Иммунол. 179 , 4808–4820 (2007 г.).

    КАС пабмед Google ученый

  • Smythies, L. E. et al. Макрофаги кишечника человека проявляют глубокую воспалительную анергию, несмотря на активную фагоцитарную и бактерицидную активность. Дж. Клин. Вкладывать деньги. 115 , 66–75 (2005).

    КАС пабмед ПабМед Центральный Google ученый

  • Махешвари, А. и др. Цитомегаловирус блокирует индуцированную стромой кишечника подавляющую регуляцию макрофагальной инфекции ВИЧ-1. Дж. Лейкок. биол. 80 , 1111–1117 (2006).

    КАС пабмед Google ученый

  • Махешвари, А.и другие. TGF-β2 подавляет продукцию цитокинов макрофагами и воспалительные реакции слизистой оболочки в развивающемся кишечнике. Гастроэнтерология 140 , 242–253 (2011).

    КАС пабмед Google ученый

  • Намачиваям, К. и др. Smad7 ингибирует аутокринную экспрессию TGF-бета2 в эпителиальных клетках кишечника при некротическом энтероколите павианов. утра. Дж. Физиол. Гастроинтест. Физиол печени. 304 , G167–G180 (2013 г.).

    КАС пабмед Google ученый

  • Мохан Кумар, К. и др. Smad7 прерывает передачу сигналов TGF-β в кишечных макрофагах и способствует воспалительной активации этих клеток во время некротизирующего энтероколита. Педиатр. Рез. 79 , 951–961 (2016).

    КАС пабмед ПабМед Центральный Google ученый

  • Нантакумар, Н. и др.Механизм чрезмерного воспаления кишечника при некротическом энтероколите: незрелый врожденный иммунный ответ. PLoS ONE 6 , e17776 (2011).

    КАС пабмед ПабМед Центральный Google ученый

  • Монтгомери Р.К., Малберг А.Е. и Гранд Р.Дж. Развитие желудочно-кишечного тракта человека: двадцать лет прогресса. Гастроэнтерология 116 , 702–731 (1999).

    КАС пабмед Google ученый

  • Martin, N. A. et al. Активный транспорт желчных кислот снижает уровень муцина 2 в подвздошной кишке новорожденных: последствия для развития некротизирующего энтероколита. PLoS ONE 6 , e27191 (2011).

    КАС пабмед ПабМед Центральный Google ученый

  • Zhang, C. et al. Абляция клеток Панета в присутствии Klebsiella pneumoniae вызывает повреждение, подобное некротизирующему энтероколиту (НЭК), в тонком кишечнике неполовозрелых мышей. Дис. Модель мех. 5 , 522–532 (2012).

    КАС пабмед ПабМед Центральный Google ученый

  • Haworth, JC & Dilling, L. Концентрация гамма-А-глобулина в сыворотке, слюне и выделениях из носоглотки младенцев и детей. J. Lab Clin. Мед. 67 , 922–933 (1966).

    КАС пабмед Google ученый

  • Брандцаэг, П., Нильссен Д.Е., Рогнум Т.О. и Трейн П.С. Онтогенез иммунной системы слизистой оболочки и дефицит IgA. Гастроэнтерол. клин. Север Ам. 20 , 397–439 ​​(1991).

    КАС пабмед Google ученый

  • Глисон, М. и др. Онтогенез секреторной иммунной системы человека. австр. NZ J. Med. 12 , 255–258 (1982).

    КАС пабмед Google ученый

  • Мелландер, Л., Carlsson, B. & Hanson, L.A. Появление секреторных антител IgM и IgA к Escherichia coli в слюне в раннем младенчестве и детстве. Ж. Педиатр. 104 , 564–568 (1984).

    КАС пабмед Google ученый

  • Криппс А.В., Глисон М. и Клэнси Р.Л. Онтогенез иммунного ответа слизистой оболочки у детей. Доп. Эксп. Мед. биол. 310 , 87–92 (1991).

    КАС пабмед Google ученый

  • Вимаес, К.и другие. Выработка иммуноглобулина А в младенчестве и детстве. Скан. Дж. Иммунол. 58 , 642–648 (2003).

    КАС пабмед Google ученый

  • Fitzsimmons, S.P. et al. Подклассы иммуноглобулина А в слюне младенцев, а также в слюне и молоке их матерей. Ж. Педиатр. 124 , 566–573 (1994).

    КАС пабмед Google ученый

  • Бхат, Н.М. и др. Онтогенез и функциональные характеристики клеток B-1 (CD5 + B) человека. Междунар. Иммунол. 4 , 243–252 (1992).

    КАС пабмед Google ученый

  • Chen, Z.J. et al. Полиреактивные антигенсвязывающие В-клетки являются преобладающим типом клеток в репертуаре В-клеток новорожденных. евро. Дж. Иммунол. 28 , 989–994 (1998).

    КАС пабмед Google ученый

  • Бауэр, К.и другие. Диверсификация генов тяжелых цепей Ig у недоношенных новорожденных, подвергшихся преждевременному воздействию антигенов окружающей среды. Дж. Иммунол. 169 , 1349–1356 (2002).

    КАС пабмед Google ученый

  • Фуи, Ф. и др. Высокопроизводительное секвенирование выявляет неполное кратковременное восстановление микробиоты кишечника младенцев после парентерального лечения антибиотиками ампициллином и гентамицином. Антимикроб.Агенты Чемотер. 56 , 5811–5820 (2012).

    КАС пабмед ПабМед Центральный Google ученый

  • Cotten, C.M. et al. Длительная начальная эмпирическая антибиотикотерапия связана с повышенной частотой развития некротизирующего энтероколита и смерти детей с экстремально низкой массой тела при рождении. Педиатрия 123 , 58–66 (2009).

    ПабМед ПабМед Центральный Google ученый

  • Александр В.Н., Нортрап В. и Биззарро М.Дж. Воздействие антибиотиков в отделении интенсивной терапии новорожденных и риск некротизирующего энтероколита. Ж. Педиатр. 159 , 392–397 (2011).

    ПабМед ПабМед Центральный Google ученый

  • Esmaeilizand, R. et al. Воздействие антибиотиков и развитие некротизирующего энтероколита у глубоко недоношенных новорожденных. Педиатр. Детское здоровье 23 , e56–e61 (2018 г.).

    ПабМед Google ученый

  • Абдель Гани, Э. А. и Али, А. А. Эмпирическое лечение антибиотиками и риск некротизирующего энтероколита и смерти у новорожденных с очень низкой массой тела при рождении. Энн. Саудовская Мед. 32 , 521–526 (2012).

    ПабМед ПабМед Центральный Google ученый

  • Куппала, В. С., Майнцен-Дерр, Дж., Морроу, А. Л. и Шиблер, К.R. Длительное начальное эмпирическое лечение антибиотиками связано с неблагоприятными исходами у недоношенных детей. Ж. Педиатр. 159 , 720–725 (2011).

    КАС пабмед ПабМед Центральный Google ученый

  • Cantey, JB, Pyle, A.K., Wozniak, P.S., Hynan, L.S. & Sanchez, PJ. Раннее воздействие антибиотиков и неблагоприятные исходы у недоношенных детей с очень низкой массой тела при рождении. Ж. Педиатр. 203 , 62–67 (2018).

    КАС пабмед Google ученый

  • Weintraub, A.S. et al. Антенатальное воздействие антибиотиков у недоношенных детей с некротизирующим энтероколитом. Ж. Перинатол. 32 , 705–709 (2012).

    КАС пабмед Google ученый

  • Greenberg R.G., et al., Eunice Kennedy Shriver National Institute of Child H, Исследования развития человека в неонатальном периоде N Продление ранней антибиотикотерапии у крайне недоношенных детей. Педиатр. Рез . 85 , 994–1000 (2019).

    ПабМед ПабМед Центральный Google ученый

  • Гупта, Р. В. и др. Блокаторы рецепторов гистамина-2 изменяют фекальную микробиоту у недоношенных детей. Ж. Педиатр. Гастроэнтерол. Нутр. 56 , 397–400 (2013).

    КАС пабмед Google ученый

  • Guillet, R. et al.Ассоциация терапии блокаторами Н3 и более высокой частотой некротизирующего энтероколита у новорожденных с очень низкой массой тела при рождении. Педиатрия 117 , e137–e142 (2006).

    ПабМед Google ученый

  • Мор, К., Атали-Джейп, Г., Рао, С. и Патоле, С. Связь ингибиторов секреции желудочного сока и более высокой частоты некротизирующего энтероколита у недоношенных детей с очень низкой массой тела при рождении. утра. Дж. Перинатол. 30 , 849–856 (2013).

    ПабМед Google ученый

  • Winter, S.E. & Baumler, A.J. Дисбиоз в воспаленном кишечнике: шанс благоволит подготовленному микробу. Микробы кишечника 5 , 71–73 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Атараши, К. и др. Эктопическая колонизация оральными бактериями в кишечнике вызывает индукцию и воспаление клеток Th2. Наука 358 , 359–365 (2017).

    КАС пабмед ПабМед Центральный Google ученый

  • Лармонье, С. Б., Шехаб, К. В., Гишан, Ф. К. и Киела, П. Р. Динамика Т-лимфоцитов при воспалительных заболеваниях кишечника: роль микробиома. Биомед. Рез. Междунар. 2015 , 504638 (2015).

    КАС пабмед ПабМед Центральный Google ученый

  • Цзэн, М.Ю., Инохара Н. и Нуньес Г. Механизмы воспалительного бактериального дисбиоза в кишечнике. Иммунол слизистых оболочек. 10 , 18–26 (2017).

    КАС пабмед Google ученый

  • Friede, T., Rover, C., Wandel, S. & Neuenschwander, B. Метаанализ нескольких небольших исследований орфанных заболеваний. Рез. Синтез. Методы 8 , 79–91 (2017).

    ПабМед Google ученый

  • Бин, Дж.В., Ливенсе С., Циммерманн Л.Дж., Крамер Б.В. и Вольфс Т.Г. Хориоамнионит как фактор риска некротизирующего энтероколита: систематический обзор и метаанализ. Ж. Педиатр. 162 , 236–242 e232 (2013).

    ПабМед Google ученый

  • Связь между кишечной микробиотой и патогенезом ревматоидного артрита

    В последнее время расширились характеристики и понимание кишечной микробиоты, что представляет собой широкую область исследований, особенно в области аутоиммунных заболеваний.Микробиота кишечника является основным источником микробов, которые могут оказывать благотворное, а также патогенное воздействие на здоровье человека. Роль кишечного микробиома как медиатора воспаления стала проявляться совсем недавно. Было замечено, что микробиота отличается у субъектов с ранним ревматоидным артритом по сравнению с контрольной группой, и это открытие определило это исследование как возможный аутоиммунный процесс. Исследования кишечной микробиоты показали, что ревматоидный артрит характеризуется увеличением и/или уменьшением групп бактерий по сравнению с контролем.В этом обзоре мы представляем доказательства связи дисбиоза кишечника с аутоиммунными механизмами, участвующими в развитии ревматоидного артрита.

    1. Введение

    Ревматоидный артрит (РА) представляет собой системное, воспалительное и хроническое заболевание, характеризующееся стойким иммунным ответом, которое приводит к воспалению и разрушению суставов. Задействованные этиопатогенные механизмы сложны и включают взаимодействие между врожденным и приобретенным иммунным ответом с участием антигенпрезентирующих клеток (АПК), образование аутореактивных Т-клеток и выработку аутоантител, направленных против их собственных клеточных структур, таких как ревматоидный фактор (РФ) и антитела к антицитруллиновым белкам (АСРА).Эти антитела часто присутствуют в крови задолго до каких-либо признаков воспаления суставов, что позволяет предположить, что запуск аутоиммунитета может происходить в разных местах суставов, например, в желудочно-кишечном тракте или дыхательных путях [1]. Эпидемиологические исследования предполагают, что ревматоидный артрит является результатом сложных взаимодействий между генами, экологическими и гормональными факторами и иммунной системой [2, 3].

    Существует генетическая предрасположенность к ревматоидному артриту по склонности к семейной агрегации, конкордантности между монозиготными близнецами и ассоциации с некоторыми антигенами гистосовместимости [4, 5].Оценки наследуемости предполагают 60–70% генетических факторов риска, ответственных за развитие ревматоидного артрита [6]. Исследования ассоциации генов-кандидатов или полногеномных ассоциаций выявили различные локусы риска, связанные с этиологией ревматоидного артрита. В настоящее время при этом заболевании описано около 100 генов, связанных с восприимчивостью, защитой, тяжестью, активностью и реакцией на лечение [6]. Полиморфизмы человеческого лейкоцитарного антигена (HLA) являются наиболее важными генетическими факторами риска. HLA являются важной частью иммунной системы, запускающей Т-клетки иммунной системы для выработки антител.Ассоциации РА с аллелями HLA-DRB1 наблюдались во всех расовых и этнических популяциях [7, 8]. Общий эпитоп (SE), мотив последовательности из 5 аминокислот в положениях 70–74 цепи HLA-DR β , является наиболее значимым генетическим фактором риска ревматоидного артрита [9]. Некоторые аллели SE, такие как HLA-DRB10401, представляют более высокий риск, чем другие; более того, наличие двух аллелей SE и, в частности, HLA-DRB10401/0404 обуславливает высокий риск развития заболевания, а также влияет на тяжесть заболевания [10].Аллели SE ассоциированы с ACPA-позитивным ревматоидным артритом, но относительно слабо связаны с ACPA-негативным ревматоидным артритом [8]. Аллели SE могут способствовать генетической предрасположенности к ревматоидному артриту, вызывая иммунную дисрегуляцию (контролирующую как специфичность, так и количество выработки ACPA) или преждевременное старение иммунитета [10].

    У генетически предрасположенных к заболеванию лиц последующие факторы внешней среды могут вызвать развитие ревматоидного артрита. Бактериальные и вирусные компоненты являются привлекательным источником антигенов, способных индуцировать ревматоидный артрит, и поэтому наиболее изучены в качестве потенциальных причинных агентов [3].Однако на сегодняшний день нет убедительных доказательств причинно-следственной связи микроорганизма с ревматоидным артритом.

    В последние годы характеризация и понимание этой кишечной микробиоты расширились и представляют собой широкое поле исследований, особенно при аутоиммунных заболеваниях. Микробиота кишечника является основным источником микробов, которые могут оказывать благотворное, а также патогенное воздействие на здоровье человека [11]. Воодушевленный исследованиями, показывающими изменения состава кишечной микробиоты при аутоиммунных заболеваниях, таких как ревматоидный артрит, возобновился интерес к изучению микроорганизмов как потенциальных кандидатов в развитии аутоиммунитета [11–14].

    Результаты, подтверждающие идею о том, что начало аутоиммунитета может быть связано с желудочно-кишечным трактом, следующие: (1) микробный состав у субъектов с ранним ревматоидным артритом отличается от контрольной группы с уменьшением количества определенных бактерий, принадлежащих к семейству Bifidobacterium и Bacteroides [15, 16] и заметное увеличение видов, принадлежащих к роду Prevotella [17]. (2) В мышиных моделях парентеральная инъекция фрагментов клеточных стенок различных кишечных бактерий вызывает артрит [17], и в этой модели артрит не развивается при разведении в безмикробных условиях; в противном случае он проявляется при введении видов кишечных бактерий [18].(3) Было показано, что диета влияет на уровень воспалительной активности [19]. (4) Некоторые препараты, используемые для лечения ревматоидного артрита, обладают антимикробным действием (хлорохин, сульфасалазин, миноциклин и рокситромицин) [20–23]. (5) Измененный микробиом частично восстанавливался до нормы у пациентов с клиническим улучшением после назначения базисных противоревматических препаратов [5, 18]. Таким образом, различия в составе кишечной микробиоты и в функции иммунной системы могут определять, у каких пациентов развивается заболевание.

    В настоящее время предпринимаются большие усилия для изучения пациентов с ревматоидным артритом в доклинической фазе. Осведомленность о механизмах, которые инициируют аутоиммунный процесс, а также о механизмах, участвующих в переходе от доклинической фазы к клинической, может привести к стратегиям вмешательства, которые позволят предотвратить или лечить его на очень ранних стадиях заболевания. В некоторых публикациях предполагается, что раннее лечение ревматоидного артрита приводит к лучшим отдаленным результатам и, возможно, к увеличению частоты безмедикаментозной ремиссии [24].Концепция профилактики — это новая область исследований в области ревматологии, в которой модификации микробиоты могут стать новым способом модулирования заболевания.

    2. Иммунопатогенез ревматоидного артрита

    Понимание сложных молекулярных процессов, играющих роль в патогенезе ревматоидного артрита, все еще остается сложной задачей. У предрасположенных к генетическим и экологическим факторам лиц с потерей иммунологической толерантности к аутоантигенам возникают аутоиммунные явления и образование аутоантител [25].Это отсутствие иммунологической толерантности представляет собой первый шаг к аутоиммунитету. Дисрегуляция иммунной системы характеризуется наличием аутоантител и аутореактивных Т-клеток. Неадекватное образование аутореактивных В-клеток является наиболее очевидным изменением иммунной системы у этих пациентов; их выявляют задолго до появления болезни. Наиболее важными являются RF и ACPA, которые распознают различные белки в цитруллиновой форме [26]. Наряду с повышенной продукцией аутоантител в синовиальной оболочке суставов больных ревматоидным артритом повышен уровень провоспалительных цитокинов.Суставы больных РА представляют собой сложные ткани, в которые вовлечены врожденные и адаптивные иммунные клетки, а также резидентные клетки суставов, такие как синовиоциты и хондроциты [27].

    Было идентифицировано несколько типов клеток, которые вносят вклад в патогенный контекст при ревматоидном артрите. В ревматоидной синовиальной оболочке дендритные клетки обнаруживаются главным образом в лимфоцитарных скоплениях и периферических сосудах, что предполагает их происхождение из периферической крови. Аллели MHC экспрессируются APC, которые процессируют внеклеточные пептиды до CD4 + Т-клеток, стимулируя секрецию провоспалительных цитокинов, которые стимулируют В-клетки к выработке антител [25].У пациентов с этим заболеванием наблюдается нарушение функции циркулирующих регуляторных Т-клеток (Treg) и увеличение числа Т-хелперов 17 (Th27) в плазме и синовиальной жидкости [28]. Трансформирующий фактор роста β , происходящий из макрофагов и дендритных клеток, и интерлейкин-1 β , 6, 21 и 23 обеспечивают среду, которая поддерживает дифференцировку Th27 и подавляет дифференцировку регуляторных Т-клеток, тем самым сдвигая гомеостаз Т-клеток в сторону воспаления [29].

    Посттрансляционные модификации (ПТМ) имеют решающее значение для функции и антигенности белков.Три ПТМ, в первую очередь вовлеченные в ревматоидный артрит, представляют собой гликозилирование, карбамилирование и цитруллинирование [25]. Цитруллинирование является результатом превращения аргинина в цитруллин с помощью фермента пептидиларгининдезиминазы (PAD), и это является основной важной посттранскрипционной модификацией, связанной с распознаванием аутоантигена при ревматоидном артрите [25]. Цитруллин может изменять структуру белка и генерировать новые эпитопы, связанные с продукцией ACPA. ACPA, присутствующие у пациентов с ревматоидным артритом, демонстрируют различную тонкую специфичность и степень перекрестной реактивности с различными цитруллинированными и/или посттрансляционно модифицированными пептидами/белками, включая фибриноген, фибронектин, α-энолазу, коллаген II типа и гистоны [30].

    В таблице 1 обобщены соответствующие аспекты эволюции этого заболевания. Доклинический ревматоидный артрит включает период, в течение которого аутоиммунитет выявляется до начала воспаления и/или повреждения клинически выраженной ткани, генетические факторы риска и факторы риска окружающей среды взаимодействуют, вероятно, последовательно, чтобы инициировать и распространять развитие аутоиммунитета, что в конечном итоге приводит к выявляемым воспаление и поражение тканей [24, 31]. Причастен ли какой-либо другой фактор риска к возникновению и/или распространению заболевания, пока неизвестно.

    9118 Клинические проявления

    фаза посвящения заболевания (взаимодействие между генетическими гормональными факторами окружающей среды) Preclinial RA клинические РА

    Генетические и эпигенетические факторы Гормональные факторы Экологические факторы Иммунологические изменения
    Shared Epitope, PTPN22, stcrl3, ctla4, traf1, padi4, fcrl3, tnfip3
    ДНК метилирование
    Дисгулируемые марка гистона
    : женщина 4 : 1
    Артрит улучшается во время беременности, но рецидивирует после родов
    Микробиота полости рта, легких и кишечника
    Курение
    Кремнеземная пыль
    Ожирение
    Диета
    Неадекватная реакция на пептиды
    Клетки T21 и рост аутореактивных клеток B18 Расширение изотипа антител использование и переключение классов
    Изменения в сетях растворимых цитокинов и хемокинов
    Измененные Th27-клетки и соотношения Th27/регуляторные Т-клетки
    Активация сигнальных молекул
    Иммуноопосредованное воспаление тканей
    Изменения аутоантител, такие как гликозилирование
    Клеточная экспансия

    Клинические проявления 9118

    Неспецифические симптомы
    Артрит
    Костяные эрозии
    Системные симптомы
    Формы вмешательства
    Суспензию курения
    Избегайте воздействия кремнезема
    Здоровое питание
    Поддержание адекватного веса
    Модификации микробиоты?
    В исследованиях раннее использование ритуксимаба или абатацепта
    Модификации микробиоты?
    Противовоспалительные
    Биологические и небиологические препараты, модифицирующие заболевание
    Глюкокортикоиды

    Реакция ACPA на переход от клинической фазы артрита к преклинической может быть важной.Анализ репертуара ACPA до постановки диагноза у пациентов с ревматоидным артритом показал, что этот иммунный ответ начинается очень ограниченным образом и распространяется до нескольких месяцев или даже лет (распространение эпитопа, от одного первоначально распознанного эпитопа к реактивности ко многим различным эпитопам) до постановки диагноза. ревматоидного артрита [10, 24, 32, 33]. Распространение эпитопов в сторону более цитруллинированных совместимо с возможностью того, что один антиген (но не всегда один и тот же) отвечает за запуск иммунного ответа [16, 32].Соколов и др. [33] сообщили, что ранее идентифицированные аутоантитела были направлены против различных лигандов врожденного иммунного ответа, включая цитруллинированные гистоны, фибриноген и бигликан. Со временем титры ACPA и разнообразие эпитопов ACPA увеличиваются, особенно перед началом артрита. ACPA могут быть изотипами IgG, IgA или IgM с измененным статусом гликозилирования, что обеспечивает усиленное связывание Fc-рецептора и цитруллинированного антигена [34]. ACPA сами по себе могут быть патогенными, активируя либо макрофаги, либо остеокласты посредством образования иммунных комплексов и взаимодействия с Fc-рецепторами или, возможно, связывая мембранный цитруллинированный виментин, тем самым способствуя потере костной массы [34].

    С момента первоначального описания антител как цитруллинированных антигенов у субпопуляции пациентов с ревматоидным артритом стало ясно, что цитруллинированные эпитопы большого числа аутоантигенов, а также антигенов, полученных из микроорганизмов, могут быть распознаны высокоспецифичными антителами к ревматоидному артриту. 30]. Изменения в определенных участках слизистой оболочки предполагают, что микробные факторы могут влиять на иммунный ответ слизистой оболочки, что также играет важную роль в раннем патогенезе ревматоидного артрита [35].Изменения в разнообразии состава и уровне численности микробиоты, то есть дисбактериоз, могут вызывать несколько типов аутоиммунных и воспалительных заболеваний из-за дисбаланса субпопуляций Т-клеток, таких как клетки Th2, Th3, Th27 и Treg [27].

    Дисбактериоз в одном или нескольких участках слизистой оболочки приводит к иммунным изменениям и нарушению толерантности к цитруллинированным аутоантигенам [35]. Слизистые поверхности тела, такие как дыхательный и желудочно-кишечный тракт, выполняют сложные задачи, поскольку они должны (1) оставаться устойчивыми к безвредным антигенам окружающей среды, пищи и микробов для обеспечения функции органов и (2) запускать эффективные иммунные реакции против вторгающихся патогенов [36].Ткани легких и кишечника содержат иммунологические клетки, способные инициировать иммунный ответ; привлекательной возможностью является то, что запуск опосредованного Т-клетками иммунитета к цитруллинированным аутоантигенам может происходить в слизистых оболочках после презентации неоантигенов АПК [1, 31]. В слизистой оболочке могут существовать возможные роли цитруллинированных микробных антигенов и молекулярной мимикрии, сигналов Toll-подобных рецепторов (TLR) и других врожденных иммунных активаторов и сигналов опасности [35]. Ассоциированная со слизистой оболочкой бактериальная флора и частицы курения или окружающей среды (кремнеземная пыль) воздействуют на иммунные клетки (нейтрофилы, дендритные клетки и макрофаги) как патоген-ассоциированные молекулярные паттерны и повреждают их, что приводит к возникновению воспаления, увеличению циркулирующих цитокинов и хемокинов наряду с продукция аутоантигенов.Цитруллинированные антигены процессируются и представляются АПК Т-клеткам, которые активируются и, в свою очередь, активируют В-клетки, что приводит к продукции аутоантител [31]. Аутоантигены при ревматоидном артрите не являются ткане- и органоспецифичными, а включают большой набор посттрансляционно модифицированных белков [31]. Курение и другие раздражители могут инициировать цитруллинирование за счет активации PAD, образования лимфоидных структур, которые могут усиливать презентацию антигена и продукцию Т- и В-клеток [31].Потенциальные механизмы, с помощью которых сигаретный дым (CS) способствует ревматоидному артриту, включают высвобождение внутриклеточных белков из реактивных окислительных веществ, активированных или поврежденных клеток, усиление функции аутореактивных В-клеток и изменение (а) многих клеточных сигнальных путей, участвующих в клеточной активации, (b ) антиген-представляющие клетки, поврежденные сигаретным дымом, (c) регуляторные функции Т-клеток и (d) активация Т-клеток антигенами, обнаруженными в сигаретном дыме [37].

    3. Микробиота и иммунная система

    Микробное воздействие на желудочно-кишечный тракт и дыхательные пути являются ключевыми детерминантами общего иммунного тонуса этих слизистых барьеров и представляют собой ведущую цель будущих стратегий вмешательства [36].Кишечник является входом для различных антигенов окружающей среды в виде пищи или инфекционных агентов. Кишечная микробиота является фактором, влияющим на метаболический гомеостаз и иммунную систему [5]; это место замечательного взаимодействия между микроорганизмами и человеческим телом. Микроорганизмы устанавливают симбиотические отношения с эпителиальной и лимфоидной тканью [12, 25]. Кишечные бактерии синтезируют и изменяют различные соединения, влияющие на физиологию и иммунитет. Однако не все взаимодействия между хозяином и микробиотой способствуют здоровью, особенно виды резидентных бактерий, по-видимому, активируют иммунную систему, что приводит к воспалительным заболеваниям [38, 39].Разнообразная и сбалансированная микробиота необходима для развития соответствующего иммунного ответа [40].

    Преимущества кишечной микробиоты для хозяина зависят от сложных взаимодействий с клетками хозяина [41]. Исследования с использованием безмикробных и гнотобиотических животных, колонизированных определенными бактериями, предоставили прямые доказательства решающей роли микробиоты в развитии и поддержании иммунной системы хозяина [41] и сохранении ее функций, таких как созревание кишечной лимфоидной ткани, секреция иммуноглобулина А. и производство важных антимикробных пептидов [42].У аксеничных мышей наблюдали скудный рост лимфоидной ткани и изменения в развитии Т-клеток и субпопуляций В-лимфоцитов; в некоторых случаях у этих мышей не развивались заболевания, характерные для обычных субъектов, вероятно, из-за дефектов адаптивной иммунной системы в отсутствие микробиоты, а не из-за отсутствия микроорганизмов как таковых. Консервативные молекулярные паттерны, либо экспрессируемые на поверхности симбиотических бактерий, либо секретируемые в кишечнике, могут взаимодействовать с рецепторами распознавания паттернов (PRR), которые экспрессируются на эпителиальных и лимфоидных клетках или внутри них, чтобы инициировать трансдукцию и транскрипцию сигналов от набора молекул. которые опосредуют защиту хозяина или метаболическую активность в кишечнике [40].

    Было показано, что кишечная комменсальная микробиота модулирует ответы Т-клеток и Treg, которые необходимы для эффективной защиты хозяина от патогенов, обходя аутоиммунные реакции и другие иммунопатологические последствия [43]. В качестве первой линии защиты хозяина от патогенов врожденный иммунный ответ опирается на семейство рецепторов, известных как PRR, включая TLR и рецепторы, подобные домену олигомеризации, связывающему нуклеотиды (NLR). TLR являются ключевыми рецепторами врожденного иммунитета для восприятия ассоциированных с патогенами молекулярных паттернов (PAMP), которые представляют собой специфическую патогенную «молекулярную сигнатуру».«После обнаружения микробных PAMP TLR позволяют инициировать воспалительные реакции и в конечном итоге устранять патогенные захватчики [43]. Компоненты грамположительных и грамотрицательных бактерий взаимодействуют с TLR, опосредуя как врожденный, так и адаптивный иммунитет, а также другие клеточные функции слизистого барьера [40]. Эпителиальные клетки имеют TLR на своей клеточной мембране, которые позволяют распознавать PAMP и активировать передачу сигналов, опосредованную связывающим белком MyD88, которая заканчивается индукцией воспалительной реакции и выработкой провоспалительных цитокинов, таких как фактор некроза опухоли-альфа (TNF- α ), интерлейкин-6 или интерлейкин-1 β .Клетки врожденного иммунного ответа собственной пластинки постоянно исследуют содержимое просвета кишечника на наличие чужеродных антигенов и составляют еще один защитный механизм [28]. Поскольку комменсальные бактерии различаются по своей способности стимулировать рецепторы врожденного иммунитета (TLR и NLR), структура высвобождаемых химических медиаторов значительно различается, определяя провоспалительные или противовоспалительные реакции. Липополисахарид грамотрицательных бактерий связывается с TLR-4, тогда как пептидогликан и другие компоненты клеточной стенки грамположительных бактерий сигнализируют через путь TLR-2, генерируя иммунный ответ [11].Грамположительные анаэробные бактерии содержат большее количество полисахаридов и пептидогликанов, которые могут действовать как антигенные стимуляторы.

    После взаимодействия с антигеном дендритные клетки играют важную роль в дифференцировке незрелых лимфоцитов CD4 + в клетки Th2, Th27 или Th3. Дифференцировка Т-хелперов, по-видимому, находится под сильным влиянием кишечной микробиоты [11, 16, 42]. Дендритные клетки действуют как APC, отображая заряженные пептиды в своих молекулах MHC класса II.Презентация этих молекул В-клеткам или рецепторам Т-клеток делает эти клетки чувствительными к инициации адаптивного иммунного ответа [28]. При ревматоидном артрите дендритные клетки могут участвовать в поддержании воспалительного процесса, регулируя презентацию антигена, и тогда презентация антигена или артритогенных антигенов будет аномально продолжительной, что может способствовать сохранению воспаления. Макрофаги и дендритные клетки постоянно обнаруживают антигены в просвете кишечника и оценивают наличие вредных антигенов.Антигены представлены молекулами MHC II и взаимодействуют с В-клетками или рецепторами Т-клеток, вызывая адаптивные иммунные ответы. В зависимости от микробного антигена затем создается специфическая цитозиновая среда, которая влияет на определенный тип дифференцировки Т-хелперов. В то время как Т-хелперные клетки 1-го типа (Th2) развиваются в ответ на внутриклеточные патогены и продуцируют интерферон, как Т-хелперные клетки 2-го типа (Th3), так и Th27-клетки стимулируются внеклеточными микроорганизмами. Клетки Th27 способствуют защите от внеклеточных патогенов за счет продукции IL-17 и IL-22, которые индуцируют изменение класса иммуноглобулинов в В-лимфоцитах и ​​продукцию Reg3g эпителиальными клетками соответственно [14].Иммунный ответ, генерируемый эффекторными Т-клетками, регулируется субпопуляцией, известной как регуляторные Treg-клетки. Кишечные Treg-клетки играют важную роль в поддержании иммунной толерантности к пищевым антигенам и микробиоте кишечника [44]. Клетки Treg сохраняют толерантность к собственным антигенам и устраняют аутоиммунитет. CD4 + CD25 + Treg-клетки являются супрессорными клетками, которые экспрессируют транскрипционный фактор Foxp3 и незаменимы для поддержания иммунной толерантности и гомеостаза путем подавления аберрантного или чрезмерного иммунного ответа. Lactobacillus и Bifidobacterium infantis оказывают противовоспалительное действие за счет индукции CD4 + CD25 + FoxP3 + Treg-клеток [11]. Полисахарид А Bacteroides fragilis действует как иммуномодулятор и стимулирует клетки CD4 + Treg через интерлейкин-2-зависимый механизм для продукции IL-10 [11].

    Принимая во внимание тот факт, что дендритные клетки играют основную роль в формировании иммунного ответа, было высказано предположение, что комменсальные бактерии влияют на функцию и дифференцировку дендритных клеток, тем самым модулируя иммунный ответ [11, 23].Таким образом, дисбактериоз кишечника может вызывать артрит, влияя на дифференцировку подгрупп Т-клеток. Он также влияет на степень экспрессии Toll-подобных рецепторов антигенпрезентирующих клеток и может способствовать дисбалансу в соотношении клеток Th27/Treg. При развитии клеток Th27, активирующих локальные воспалительные каскады с повреждением тканей, и у предрасположенных лиц этот локальный иммунный ответ может привести к системному аутоиммунитету с аутореактивными клетками Th27.

    Наиболее заметное влияние окружающей среды на дифференцировку клеток Th27 оказывает микробиота.В последнее время большое внимание уделяется сегментоядерным нитчатым бактериям (SFB) из-за их способности индуцировать продукцию и активацию клеток Th27 в кишечнике с секрецией интерлейкина-17 [23, 27]. SFB составляют группу грамположительных бактерий, родственных клостридиям, которые плотно прилегают к пейеровым бляшкам в тонком кишечнике и могут стимулировать иммунный ответ, индуцируя секрецию IgA и активируя В-клетки. Эти бактерии необходимы для развития аутоиммунитета в мышиной модели артрита K/BxN [45], а применение антибиотиков предотвращает прогрессирование артрита [13, 30, 31].Исследования на мышиных моделях показали, что индукция клеток T FH и Th27 предшествует возникновению артрита, что указывает на роль обоих типов клеток. Моноколонизация с помощью SFB усиливает выработку аутоантител и ускоряет прогрессирование заболевания за счет образования клеток Th27, хотя индуцированный микробиотой процесс, зависящий от клеток T FH , также может спровоцировать заболевание [44]. Тенг и др. [46] продемонстрировали, что SFB запускает аутоиммунный артрит, индуцируя дифференцировку и миграцию кишечных T-фолликулярных хелперных клеток (T FH ) в системные лимфоидные участки, что приводит к увеличению продукции аутоантител и обострению артрита.Напротив, Block et al. [45, 47] подтвердили роль кишечной микробиоты в дифференцировке клеток T FH и формировании зародышевого центра. Истощение кишечной микробиоты у мышей антибиотиками снижало количество клеток T FH и уровни продукции антител. Они пришли к выводу, что кишечная микробиота регулирует развитие артрита посредством T FH независимо от клеток Th27.

    4. Дисбактериоз при ревматоидном артрите

    Важность кишечного микробиома в аутоиммунитете, связанном с ревматоидным артритом, была выявлена ​​как в моделях на мышах, так и в исследованиях на людях.Изменения микробиоты связаны с риском и тяжестью заболевания. Три места были особенно связаны с ним, в основном легкие, слизистая оболочка полости рта и желудочно-кишечный тракт. Тем не менее, место(а) запуска начального иммунного ответа еще предстоит проверить. В то время как точные механизмы, которые повышают риск, не полностью понятны для каждого из них, вполне вероятно, что локальный тканевой стресс приводит к посттрансляционной модификации пептидов с последующим образованием антител, выступающих в качестве общего механизма [48].

    Аномалии дыхательных путей и цитруллинирование легочной ткани обнаруживаются как у больных ревматоидным артритом, так и у лиц из групп риска. Это предполагает, что легкие являются возможным местом генерации аутоиммунитета [49]. Доказательства ранней роли адаптивного иммунитета и иммунной активации в легких этих пациентов получены в протеомном исследовании, в котором два общих цитруллинированных пептида виментина были описаны в бронхиальной ткани у пациентов с ранним ревматоидным артритом и синовиальной ткани у пациентов с уже установленным заболеванием. некоторые сведения об иммунном процессе, инициированном в легких [25].Слизистая оболочка легких как аутоиммунное происхождение процесса основывается на следующих наблюдениях: ACPA-позитивных больных без артрита в мокроте присутствуют; отмечаются микроскопические и макроскопические изменения в легких при раннем ревматоидном артрите и у нелеченных ACPA-положительных больных; легочные изменения были продемонстрированы при компьютерной томографии с высоким разрешением у субъектов без заболевания, но с ACPA-положительным; образцы легочной биопсии от пациентов с ACPA-положительным диагнозом с установленным АР позволяют предположить, что ACPA вырабатываются локально.Однако точные молекулярные механизмы, которые могут быть ответственны за запуск иммунитета в слизистой оболочке легких, относительно не изучены. Известно, что воздействие на легкие вредных агентов, в том числе дыма, может вызывать усиление экспрессии и активацию ЗПА [1]. Было высказано предположение, что цитруллинированные белки могут стать аутоантигенами и тем самым вызвать реакцию иммунной системы у людей с генетической предрасположенностью к ревматоидному артриту.

    Курение и пародонтит способствуют цитруллинированию белка и продукции ACPA [50].Внимание в деснах обусловлено заболеванием пародонта, чаще встречается у лиц с ревматоидным артритом или коррелирует с его активностью. Было высказано предположение, что пародонтальные патогены вызывают системное воспаление или диссеминируют в пораженные ткани. Действительно, при РА сообщалось об увеличении специфического IgG к пародонтальным патогенам, включая Prevotella intermedia и Porphyromonas gingivalis [51]. Присутствие P. intermedia и P. gingivalis в поддесневом зубном налете, а также в синовиальной жидкости подтверждает роль микробиоты в инициировании или поддержании хронического воспаления [52].Поперечные исследования выявили корреляцию между РА и более высокими титрами сывороточных антител против предполагаемых пародонтальных патогенов, таких как P. gingivalis , Prevotella melaninogenica и Tannerella forsythia [53]. Пероральная инокуляция P. gingivalis и Prevotella nigrescens усугубляла тяжесть артрита в экспериментальной мышиной модели, направляя иммунный путь на выработку IL-17 и генерацию ответа Th27 [54].Эффекты двух бактерий отличались тем, что P. nigrescens , в отличие от P. gingivalis , подавляли защитные цитокины 2-го типа, включая IL-4. P. gingivalis экспрессирует фермент с аминодеиминазной активностью, который превращает С-концевой аргинин в цитруллин, аналогичный ферменту, участвующему в этиологии ревматоидного артрита. Цитруллинирование бактериальных и человеческих белков с помощью PAD может обнажать скрытые эпитопы, что приводит к потере толерантности у генетически восприимчивых людей.Считается, что результирующий иммунный ответ вместе с эндогенным цитруллинированием продуцирует ACPA [4]. Тот факт, что курение тесно связано с наличием пародонтита и инфекции P. gingivalis , дает косвенные доказательства в пользу этой гипотезы. Однако последние эпидемиологические данные не продемонстрировали четкой связи между пародонтитом и ревматоидным артритом [1].

    Недавно микробиота кишечника была предложена в качестве незаменимого фактора окружающей среды в прогрессировании ревматоидного артрита [5, 18, 27, 55–57].Беннике и др. [43] идентифицировали 21 цитруллинированный пептид в ткани толстой кишки как у пациентов с ревматоидным артритом, так и у контрольной группы, которые ранее были обнаружены в легочной ткани и синовиальной жидкости у пациентов с РА. Три цитруллинированных белка (цитруллинированный виментин, фибриноген-альфа и актин) являются известными мишенями для ACPA, подтверждая, что слизистая оболочка толстой кишки может быть потенциальным местом нарушения иммунной толерантности к цитруллинированным эпитопам. Цитруллиновый виментин был обнаружен с повышенным содержанием в ткани толстой кишки этих пациентов по сравнению с контрольной группой, что может указывать на то, что начальный запуск ревматоидного артрита не ограничивается только определенным местом в организме, но может происходить во многих других местах [43].Таким образом, это исследование подтверждает гипотезу о том, что слизистая оболочка толстой кишки может служить местом нарушения иммунной толерантности к цитруллиновым белкам, вызывая выработку ACPA у пациентов с ослабленной иммунной системой.

    5. Микробиота кишечника при ревматоидном артрите

    Потенциальная роль микробиоты кишечника в этиопатогенезе ревматоидного артрита подтверждается исследованиями на животных моделях, исследованиями микробиомы кишечника и косвенно влиянием диеты и пробиотиков на степень воспаления деятельность.Патофизиологические механизмы, с помощью которых микробиота кишечника связана с артритом, вероятно, многофакторны; предполагаемые механизмы включают активацию антигенпрезентирующих клеток за счет воздействия на TLR или NLR, способность вызывать цитруллинизацию пептидов за счет ферментативного действия, антигенную мимикрию, изменения проницаемости слизистой оболочки кишечника, контроль иммунной системы хозяина (запуск дифференцировки Т-клеток) и увеличение опосредованного Т-хелперами типа 17 воспаления слизистой оболочки.

    Несмотря на существование моделей на животных, хорошо известно, что не существует модели на животных, которая полностью представляет ревматоидный артрит [58].Однако мышиные модели артрита индуцируют эрозивный полиартрит путем внутрибрюшинной инъекции фрагментов клеточной стенки Streptococcus pyogenes , Lactobacillus casei и Eubacterium aerofaciens [59–61]. Артритогенность бактериальных структур зависит от вида бактерий, и, что примечательно, даже бактерии из нормальной микробиоты кишечника вызывают экспериментальный артрит у животных [17]. У гнотобиотических мышей артрит не развивается, и введения SFB достаточно для реинтеграции клеток Th27 из собственной пластинки, большей продукции аутоантител и быстрого развития деструктивного артрита [62].Лечение антибиотиками предотвращает и подавляет фенотип, сходный с ревматоидным артритом, в нескольких мышиных моделях [4, 18, 28], а у генетически предрасположенных мышей дисбиоз повышает чувствительность к артриту за счет активации аутореактивных Т-клеток в кишечнике [63].

    Роль кишечной микробиоты в патогенезе артрита была продемонстрирована индукцией/обострением артрита в экспериментальных мышиных моделях [55, 64–66]. Исследования на мышах-гнотобиотиках показали, что нарушения кишечной микробиоты могут вызывать выработку провоспалительных цитокинов, интерлейкина-17 и повышение уровня клеток Th27 даже во внекишечных тканях [11].Затем клетки Th27 мигрируют в периферическую лимфоидную ткань и секретируют IL-17, который, в свою очередь, действует непосредственно на В-клетки и индуцирует системную дифференцировку В-клеток и выработку антител [67]. В конечном итоге это может привести к развитию аутоиммунного заболевания за счет распознавания молекулярных паттернов кишечной микробиоты [67]. У мышей с нокаутом антагониста рецептора IL-1 (IL-1Ra), у которых спонтанно развивается аутоиммунный артрит, опосредованный Т-клетками, заболевание не развивается при выращивании в стерильной среде. Однако колонизация пригородным Lactobacillus bifidus вызывает быстрое начало заболевания, тяжесть и заболеваемость, сравнимые с артритом, наблюдаемым у мышей. L. bifidus вызывает артрит в этой модели, способствуя дисбалансу гомеостаза клеток Treg-Th27 и опосредованно через передачу сигналов Toll-подобных рецепторов (TLR2-TLR4) [28, 65]. Лю и др. [64] обнаружили, что род Lactobacillus был значительно более распространен у мышей, восприимчивых к коллаген-индуцированному артриту (CIA-), до начала артрита, чем у мышей, устойчивых к CIA. Примечательно, что у безмикробных мышей с микробиотой от мышей, восприимчивых к CIA, наблюдалась более высокая частота индукции артрита, чем у обычных мышей с микробиотой от мышей, устойчивых к CIA.Моноколонизации безмикробных мышей K/BxN с SFB было достаточно, чтобы стимулировать выработку аутоантител и патогенных клеток Th27, а также вызвать артрит [66]. Системные дефициты стерильных животных отражают потерю клеток Th27 из собственной пластинки кишечника. Введение одного вида резидентных кишечных нитчатых бактерий восстанавливало компартмент клеток Th27 в собственной пластинке; продукция аутоантител и артрит возникали быстро. Таким образом, один комменсальный микроб благодаря своей способности стимулировать специфическую субпопуляцию Т-хелперных клеток может привести к аутоиммунному заболеванию [66].Эти результаты свидетельствуют о том, что комменсальные бактерии могут вызывать аутоиммунный артрит, индуцируя Th27-ответ в кишечнике. Следовательно, состав кишечной микробиоты играет ключевую роль в балансе между воспалительными Th-клетками и супрессорными Treg-клетками для поддержания иммунной толерантности в здоровых условиях [27].

    Взаимодействие между генетическими факторами хозяина, такими как MHC, и кишечной микробиотой и его влияние на развитие ревматоидного артрита трудно изучать у людей из-за высокой изменчивости генетических факторов и диеты [11].Исследование, проведенное Gomez et al. [68] представили первую демонстрацию того, что гены HLA и кишечная среда взаимодействуют, влияя на предрасположенность к артриту. Это исследование показало различия в фекальном микробиоме восприимчивых к ревматоидному артриту трансгенных мышей HLA-DRB10401 по сравнению с мышами DRB10402, устойчивыми к развитию ревматоидного артрита. В частности, микробный состав самок мышей DRB10401 значительно отличался от микробов самок DRB10402, и это приводило к увеличению проницаемости кишечника и транскриптов цитокинов типа Th27 у мышей DRB10401.Анализ показал, что кишечная флора мышей, предрасположенных к артриту, содержала большее количество Clostridium sp. бактерии, в то время как те из DRB10402, устойчивые к артриту, были обогащены семействами Porphyromonadaceae и Bifidobacteriaceae [68]. Последний микроорганизм был связан с противовоспалительным ответом в иммунной системе слизистой оболочки кишечника посредством подавления пролиферации Т-клеток и продукции провоспалительных цитокинов, а также путем ингибирования ядерного фактора kB.Результаты показывают разницу в микробном составе кишечника между двумя штаммами, предполагая, что гены MHC могут быть прямо или косвенно вовлечены в определение микробного состава кишечника и взаимодействия между кишечными комменсалами [13, 18]. Кроме того, они продемонстрировали, что дисбиоза недостаточно, так как для него требуется генетическая предрасположенность хозяина из-за неспособности индукции воспалительной реакции у диких животных даже при наличии проартритогенной кишечной флоры [13, 28].

    За последние десятилетия было проведено несколько исследований, пытавшихся связать воспаление слизистой оболочки кишечника и суставов. Эрола и др. [69] сообщили, что фекальный профиль жирных кислот бактериальных клеток значительно отличался у пациентов с ревматоидным артритом, в основном за счет анаэробных бактерий, по сравнению с контрольной группой. Они поддерживают идею о том, что ревматоидный артрит представляет собой состояние хронического воспаления, которое может быть мотивировано или усугублено чрезмерным ростом патогенных бактерий или недостатком обычных иммуномодулирующих бактерий [5, 16, 18, 57, 70].Вахтовуо и др. [16] также описали различия в разнообразии фекалий у лиц с ревматоидным артритом по сравнению с пациентами с фибромиалгией, характеризующиеся нижними бактериями bundi, Bacteroides-Porphyromonas-Prevotella , подгруппой Bacteroides fragilis и группой Eubacterium rectale-Clostridium coccoides. у пациентов с ревматоидным артритом [6]. С другой стороны, Ньюкирк и соавт. [71] выявили различия в типах колонизации возбудителя E. coli у лиц с ревматоидным артритом, у РФ-позитивных пациентов чаще наблюдалась колонизация E.coli , филогенетическая группа D, в то время как RF-негативные пациенты чаще были колонизированы E. coli , филогенетической группой B2, и эти люди также имели более низкие баллы суставов и маркеры воспаления, но более высокие ответы антител IgA против E. coli .

    Наблюдение за тем, что кишечная микробиота отличается у пациентов с ранним ревматоидным артритом по сравнению с контрольной группой, возобновило интерес к изучению кишечной микробиоты как возможного места происхождения аутоиммунных процессов; исследования, оценивающие кишечную микробиоту, показывают, что ревматоидный артрит характеризуется увеличением и/или уменьшением бактериальных групп по сравнению с контролем [5, 18, 55–57].Высокопроизводительное секвенирование образцов стула в 5 исследованиях пациентов с РА показало дисбактериоз кишечника [5, 18, 55, 57, 63], а в 2 исследованиях сообщалось о чрезмерном размножении Prevotella sp. у больных ранним РА, особенно P. copri (табл. 2) . Различия между бактериями, о которых сообщалось в исследованиях, могут зависеть от течения заболевания во времени (т. е. раннее или установленное), субъектов, включенных в контрольные группы (здоровые или родственники первой степени родства), получаемого лечения и географического положения, так как исследования не показывают ту же закономерность.

    9118 МЛ возрастные связи: метавозрастные группы.
    родственников контрольной группы

    Автор (Год публикации) Дизайн Субъекты включены Метод используется Результаты в Группе RA против элементов управления
    Shinebaum et др. [70] Случай-контроль 25 пациентов с РА по сравнению с контролем Оценка количества бактерий в фекальной культуре Значительно более высокая частота носительства Clostridium perfringens в популяции РА, чем в контрольной группе (88% против 48%, ).Количество кишечных палочек также имело тенденцию к повышению
    Eerola et al. [69] Случай-контроль 74 ранее не получавших лечения РА и 91 контрольная группа без РА Газожидкостная хроматография бактериальных CFA Изменение профиля CFA при РА по сравнению с контрольной группой, вероятно, вызванное анаэробными бактериями
    Vaahtovuo et al. [16] Случай-контроль 50 человек с РА и 50 человек с фибромиалгией Проточная цитометрия, гибридизация 16S рРНК и окрашивание ДНК Prevotella группа, Bacteroides fragilis подгруппа и Eubacterium rectal Clostridium coccoides группа
    Toivanen et al.[57] Случай-контроль 25 ранее не получавших лечения пациентов с ранним РА и 23 контрольных пациента, страдающих невоспалительной болью Prevotella и родов Porphyromonas , чем в контроле (4,7% против 9,5%, ). Количество бактерий, принадлежащих к группе Bacteroides-Prevotella-Porphyromonas , было в среднем у пациентов с РА вдвое меньше, чем в контроле
    Scher et al.[18] Поперечное исследование 44 ранее не получавших лечения пациентов с РА, 26 получавших лечение РА, 16 пациентов с псориатическим артритом и 28 здоровых лиц из контрольной группы %) численность и уменьшение Bacteroides
    Liu et al. [56] Случай-контроль 15 человек с ранним РА и 15 здоровых Количественная ПЦР в реальном времени Фекальная микробиота больных РА содержала значительно больше Lactobacillus (10.62 ± 1,72 копий/г), чем в контрольной группе (8,93± 1,60 копий/г)
    Zhang et al. [5] Когорта 77 ранее не получавших лечения лиц с РА и 80 неродственных здоровых лиц контрольной группы; 17 человек, ранее не получавших лечения, с РА в паре с 17 здоровыми родственниками; и 21 образец от пациентов, получавших DMARD, с ревматоидным артритом Метагеномное дробовое секвенирование и исследование метагеномных ассоциаций Кишечник ревматоидного артрита был обогащен грамположительными бактериями и обеднен грамотрицательными бактериями, включая около протеобактерий и грамотрицательных Firmicutes семейства Veillonellaceae.MLG, обогащенные RA, образовали большой кластер, включающий бактерии Clostridium asparagiforme , Gordonibacter pamelaeae , Eggerthella lenta и бактерии Lachnospiraceae. Наблюдалась тенденция к увеличению численности P. copri в зависимости от продолжительности РА в первый год
    Maeda et al. [63] Кросс-секционное исследование 25 пациентов с ранним РА, ранее не получавших лечения, и 23 здоровых человека из контрольной группы Глубокое секвенирование на основе 16S рРНК
    Чен и др.[55] Случай-контроль 40 Субъекты с РА, получавшие лечение 16S рибосомная ДНК Увеличение числа прочтений из филума Actinobacteria в группе РА (0,45 по сравнению с 0,04%) 3 1 степени с АР и 17 здоровых лиц) Уменьшение Faecalibacterium и экспансия Collinsella aerofaciens и Eggerthella lenta

    Тойванен и др. [57] сравнили фекальную микробиоту 25 пациентов с ранним РА с микробиотой пациентов с невоспалительной болью с использованием олигонуклеотидного зонда против 16S РНК. У пациентов с ранним РА достоверно меньше бактерий, относящихся к роду Bacteroides sp., Prevotella sp. и Porphyromonas sp. В другом исследовании Scher et al. [18] сообщили, что люди с ранним РА с большей вероятностью содержат Prevotella copri по сравнению с контрольной группой.Кроме того, они продемонстрировали, что пероральное введение P. copri усиливало местную воспалительную реакцию в мышиной модели колита. Таким образом, P. copri изменяет кишечную проницаемость. Такое увеличение может привести к проникновению бактерий и/или их компонентов по всему телу; это один из предполагаемых механизмов, связывающих дисбиоз с патогенезом артрита. Интересно, что относительная численность P. copri показала отрицательную корреляцию с наличием общего эпитопа, предполагая, что состав кишечного микробиома человека также может частично зависеть от генома хозяина, и предполагая наличие дисбактериоза до появления клинических признаков. фенотип.

    В соответствии с этими результатами Maeda et al. [63] наблюдали, что P. copri в изобилии присутствовали в микробиоте кишечника у японских пациентов с ранним РА, которые не получали медикаментозного лечения. Они определили, что P. copri per se обладают высокой способностью индуцировать связанные с клетками Th27 цитокины, такие как IL-6 и IL-23. Увеличенный Prevotella sp. обилие связано с усиленным воспалением слизистой оболочки, опосредованным Т-хелперами 17 типа, что согласуется с отмеченной способностью Prevotella sp.в управлении иммунными ответами Th27 in vitro [51]. В другом исследовании Pianta et al. [72] определили, что подгруппы пациентов с ревматоидным артритом имеют дифференциальную иммунную реактивность IgG или IgA с P. copri. Как у пациентов с впервые выявленным ревматоидным артритом, так и у пациентов с хроническим ревматоидным артритом в подгруппе были обнаружены ответы антител IgA либо на Pc-p27, либо на весь организм, что коррелировало с ответами цитокинов Th27 и частыми ACPA. Вторая подгруппа имела антитела IgG P.copri , которые были ассоциированы с ДНК Prevotella в синовиальной жидкости, P.copri -специфические ответы Th2 и менее частые ACPA. Пациенты с РА имели IgA, IgG или не имели специфических антител, что указывает на то, что у отдельных пациентов могут развиваться разные иммунные реакции на P. copri , что, в свою очередь, может иметь значение для риска заболевания и исходов.

    Молекулярная мимикрия из-за схожести последовательностей между чужеродным и собственным пептидом является одним из таких механизмов, который, как известно, приводит к перекрестной активации аутореактивных Т- или В-клеток патогенного происхождения.Эти Т- и В-клетки могут перекрестно реагировать с эпитопами хозяина, что приводит к аутоиммунитету [67]. В недавней работе Pianta et al. [73] описали два белка, полученных из распространенных типов кишечных бактерий, которые могут вызывать иммунный ответ у пациентов с РА. N -Ацетил-глюкозамин-6-сульфатаза (GNS) и филамин A (FLNA) были идентифицированы как аутоантигены, вызывающие ответы как Т-, так и В-клеток, более чем у 50% пациентов с РА, но не у здоровых людей из контрольной группы или у пациентов с другие ревматические заболевания.Представленный HLA-DR пептид GNS имеет выраженную гомологию последовательностей с эпитопами сульфатазных белков Prevotella sp. и Parabacteroides sp., тогда как пептид FLNA, представленный HLA-DR, имеет гомологию с эпитопами белков Prevotella sp. и Butyricimonas sp., еще один кишечный комменсал. Ответы Т-клеток на соответствующие микробные и собственные пептиды сильно коррелировали. Это исследование предоставляет доказательства того, что эпитопы Т-клеток родственного порядка кишечных микробов, в частности Prevotella sp., могут перекрестно реагировать с собственными эпитопами белков с высокой экспрессией в суставах, особенно у пациентов с аллелями SE.

    Кроме того, Prevotella sp. может быть не единственным родом, участвующим в воспалительном заболевании. Чжан и др. [5] использовали технологию метагеномного дробового секвенирования для анализа образцов фекалий, зубов и слюны у большой когорты пациентов с РА, а также у здоровых людей. Анализ дифференциально представленных метагеномных групп сцепления выявил значительные различия микробиома между пациентами с РА и здоровым контролем не только в фекальных, но также в слюнных и стоматологических образцах.Они продемонстрировали, что грамположительные бактерии обогащают микробиоту по сравнению с небольшим количеством грамотрицательных бактерий и, кроме того, что дисбиоз связан с маркерами воспаления и клинической активностью ревматоидного артрита. Кроме того, они также обнаружили изменения в окислительно-восстановительной среде, транспорте и метаболизме железа, серы и цинка в микробиоте пациентов с РА, что указывает на то, что измененный микробиом может играть важную роль в патогенезе РА. Примечательно, что измененный микробиом частично восстанавливался до нормы (микробиом здоровых людей) у пациентов, у которых наблюдалось клиническое улучшение после назначения базисных противоревматических препаратов.Примечательно, что P. copri у лиц, пораженных РА, показали тенденцию к увеличению относительной численности в первый год, что согласуется с сообщениями об их увеличении при раннем РА. Многие вида Prevotella были обогащены слюной пациентов с РА по сравнению с контрольной группой. Одним заметным исключением была Prevotella intermedia , которая была обогащена в контрольной группе. Однако в образцах зубного налета наблюдалась совершенно иная картина, и большинство Prevotella sp. присутствовали в более высоких пропорциях у здоровых испытуемых.

    Чен и др. [55] сообщили, что бактерии, принадлежащие к типу Actinobacteria , играют значительную роль в патогенезе ревматоидного артрита, Collinsella sp. и Eggerthella sp. предсказали его наличие, а дисбиоз в кишечном микробиоме частично восстанавливается после лечения базисными противоревматическими препаратами, как и в предыдущем исследовании. Потенциальная ассоциация P. copri , о которой сообщалось ранее, с новым началом нелеченного РА и DR4 не наблюдалась в этой когорте пациентов с РА (в отличие от предыдущих исследований, все пациенты в настоящем исследовании в настоящее время находились на схеме лечения).Они показали, что снижение микробного разнообразия кишечника у пациентов с РА связано с длительностью заболевания после поправки на различные препараты, используемые для лечения. Collinsella sp. может способствовать развитию ревматоидного артрита за счет молекулярной мимикрии, поскольку он представляет последовательности, общие с DRB10401. Роль ассоциированных с РА бактерий Collinsella sp. был подтвержден с использованием линии эпителиальных клеток человека и гуманизированной мышиной модели артрита. Collinsella sp.повышенная тяжесть заболевания на модели гуманизированных мышей. Одним из механизмов, с помощью которого Collinsella способствует патогенезу заболевания, является повышение проницаемости кишечника, о чем свидетельствует более низкая экспрессия белков плотных контактов. Кроме того, Collinsella влияет на продукцию эпителием IL-17A [55].

    Хотя исследования у пациентов с ревматоидным артритом показывают корреляцию Prevotella sp. в его патогенезе другие исследования предполагают, что его можно считать полезным видом бактерий, а не патогенным [74, 75].Коллекции культур в настоящее время включают около 40 различных видов Prevotella , большинство из которых являются пероральными изолятами, а три из них обнаруживаются в кишечнике ( P. copri , как правило, более многочисленны). Совершенно разные репертуары геномных генов штаммов внутри и между Prevotella sp. и между хозяевами, вероятно, лежат в основе некоторых различий, наблюдаемых в реакциях на уровне рода на диету и состояние здоровья у разных особей [75]. Недавнее всестороннее исследование, сравнивающее несколько видов бактерий, предполагает, что принадлежность к определенному типу не предсказывает иммунологические свойства, подчеркивая важность характеристики свойств на видовом уровне.Мариэтта и др. [76] оценили способность 2 видов Prevotella sp. для профилактики и лечения артрита у мышей HLA-DQ8. Было показано, что способность модулировать иммунный ответ различалась между штаммами Prevotella . Лечение P. histicola подавляло развитие артрита путем модулирования иммунного ответа (регуляция дендритных клеток и образование клеток Treg), что приводило к подавлению ответов Th27 и снижению воспалительных цитокинов (IL-2, IL-17 и некроза опухоли). фактор).Напротив, введение P. melaninogenica не показало значительного изменения уровней цитокинов, а также предотвращения развития артрита. Способность P. histicola модулировать была подтверждена с использованием мышиной модели DBA/1, демонстрируя, что у мышей, получавших P. histicola , развивался более легкий артрит по сравнению с контрольной группой. Понятно, что единственный штамм Prevotella sp. может действовать так, как это интерпретируется как полезное или вредное, в зависимости от контекста.Это может объяснить, почему Prevotella sp. распространен в здоровой микробиоте и предполагает, что только определенные штаммы могут проявлять патогенные свойства.

    У пациентов с впервые выявленным РА обилие Prevotella в кишечнике происходило за счет Bacteroides fragilis , организма, важного для функции Treg [18, 72]. Фактически, высокие уровни P. copri и подобных видов связаны с низким уровнем полезных микробов, которые, как считается, подавляют иммунную систему и метаболизируют витамины в формах, всасываемых в кровоток [17].При обсуждении возможных механизмов влияния диеты на ревматоидный артрит следует учитывать влияние кишечной флоры [77–79]. Диета, богатая белком и животными жирами, связана с присутствием Bacteroides sp. в то время как диета, богатая углеводами, связана с присутствием Prevotella sp. [80]. Исследования показали, что средиземноморская или веганская диета снижает воспалительную активность, повышает физическую активность и повышает жизненный тонус [19]. Тем не менее, некоторые другие исследования обнаруживают преимущества без достижения значительного улучшения составных показателей для измерения активности заболевания [81, 82].Тем не менее, в этих исследованиях не было установлено, действительно ли улучшение состояния при ревматоидном артрите было связано с изменением состава кишечной флоры.

    Пробиотики — это живые организмы, которые могут принести пользу здоровью хозяина. Пробиотики в основном оказывают свое благотворное влияние посредством следующих трех методов: антимикробного действия, повышения целостности слизистого барьера и иммуномодуляции [83]. Исследования [84–86], оценивающие взаимосвязь между приемом пробиотиков и уровнем активности РА, не дали убедительных результатов (таблица 3).Улучшения пробиотических вмешательств не были достаточно очевидными, чтобы продемонстрировать эффективность лечения пациентов с РА из-за ограниченного количества исследований. Необходимо провести более тщательно спланированные исследования, чтобы определить лучшие виды, которые облегчают ревматоидный артрит, и оптимизировать метод приема и дозы пробиотиков [83].

    2
    Автор (Год публикации) Дизайн Население и вмешательство

    Datakka et al.[89] Клинические испытания Группа Lactobacillus (). Группа плацебо () Не было статистически значимых различий в: CRP, СОЭ, IL-6, IL-10, IL-12 и HAQ
    Pineda et al. [86] Клиническое исследование 15 субъектов Lactobacillus rhamnosus GR-1 и Lactobacillus reuteri RC-14 вводили в течение 3 месяцев по сравнению с 14 субъектами в контрольной группе Пробиотики статистически не улучшали процент ответа ACR 20 (20 % против 7%, )
    Alipour et al.[84] Клиническое исследование 22 субъекта с Lactobacillus casei по сравнению с 24 субъектами с плацебо Статистически значимое снижение уровня СРБ, количества воспаленных и болезненных суставов и DAS-28
    Vagh . [85] Клиническое исследование 22 субъекта с Lactobacillus casei по сравнению с 24 субъектами с плацебо (мальтодекстрин) болезненность суставов и при DAS-28

    СРБ: С-реактивный белок; DAS28: показатель активности заболевания — 28; ИЛ: интерлейкин; СОЭ: скорость оседания эритроцитов; ACR: Американский колледж ревматологии.

    Наконец, доказательства того, что микробиота кишечника мотивирует развитие артрита, получены в экспериментальных моделях на мышах. У людей эта ассоциация основана на различиях между микробиомами в группах сравнения, которые не обязательно отражают ее причинно-следственную связь. Результаты, полученные на людях, позволяют предположить, что дисбактериоз является важным этиологическим фактором, способствующим прогрессированию ревматоидного артрита, или даже более того, что воспаление, вызванное некоторыми микроорганизмами, такими как P. copri , вероятно, может способствовать поддержанию артрита.Чтобы предсказать роль кишечной микробиоты в патогенезе ревматоидного артрита, по-прежнему необходимо точное понимание потенциала этого вида, его экологии и взаимодействия с другими микробами и/или хозяевами. Кроме того, хотя слизистая оболочка кишечника имеет, вероятно, самый высокий потенциал для взаимодействия хозяин-микроб, все слизистые оболочки имеют резидентную микробиоту и динамически реагируют на ее присутствие с помощью иммуномодуляции. Грамотрицательные бактерии могут вызывать инфекции в любой части тела; среди наиболее распространенных типов — оральный, стоматологический, плевропульмонарный, интраабдоминальный, генитальный слизистый, кожа и мягкие ткани.Другими словами, это не означает, что все пациенты с ревматоидным артритом должны иметь дисбиоз в одном месте.

    6. Микробиота как возможный механизм профилактики ревматоидного артрита

    Текущие исследовательские проекты сосредоточены на профилактике с помощью биологических препаратов, которые ингибируют образование антител или активируют Т-клетки [87]. Недавние открытия показали, что кишечный дисбактериоз является большим шагом вперед в нашем понимании ревматоидного артрита. Тем не менее, нет исследований, демонстрирующих антиген или антигены, запускающие аутоиммунный процесс.Логические признаки указывают на то, что дисбактериоз слизистых оболочек является привлекательным местом для выяснения путей аутоиммунитета, особенно механизмов, вызывающих потерю иммунной толерантности, и специфических механизмов, посредством которых человек переходит от доклинического заболевания к клиническому.

    Было показано, что микробиота кишечника играет роль в развитии ревматоидного артрита, хотя механизм этой ассоциации остается неясным. Понимание этих механизмов имеет решающее значение для повышения эффективности лечения и персонализированного ведения пациентов [67].Пластичность микробиома может позволить специфическое или систематическое манипулирование определенной кишечной микробиотой, связанной с заболеваниями хозяина [88], предполагая, что в будущем это манипулирование может изменить терапевтические стратегии у субъектов с ревматоидным артритом.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов в отношении публикации данной статьи.

    Благодарности

    Авторы благодарят Глорию Меркадо за ее полезные комментарии во время подготовки этой рукописи.

    Дисбиоз кишечника с обилием Streptococcus ассоциирован с пурпурой Шенлейна-Геноха (IgA-васкулит с нефритом) у взрослых | BMC Nephrology

  • Gardner-Medwin JM, Dolezalova P, Cummins C, Southwood TR. Заболеваемость пурпурой Шенлейна-Геноха, болезнью Кавасаки и редкими васкулитами у детей разного этнического происхождения. Ланцет. 2002;360(9341):1197–202. https://doi.org/10.1016/s0140-6736(02)11279-7.

    Артикул пабмед Google ученый

  • Н.Руперто, С. Озен, А. Писторио, П. Долезалова, П. Броган, Д. Кабрал, Р. Каттика, Р. Хубчандани, Д. Д. Ловелл, К. М. О’Нил, П. Куартье, А. Равелли, С. М. Юсан, Г. Филокамо, К.С. Магальяйш, Э. Унсал, С. Оливейра, К. Бракалья, А. Багга, В. Станевича, С. М. Манцони, П. Прациду, Л. Лепор, Г. Эспада, И. Коне-Паут, Ф. Зулиан, П. Бароне, З. Биркан, Р. Мальдонадо Мдель, Р. Руссо, И. Вилка, К. Туллус, Р. Чимаз, Г. Хорнефф, Дж. Антон, С. Гарай, С. Нильсен, Г. Барбано и A. martini : критерии EULAR/PRINTO/PRES для пурпуры Геноха-Шенлейна, узелкового полиартериита у детей, гранулематоза Вегенера у детей и артериита Такаясу у детей: Ankara 2008.Часть I: общая методология и клиническая характеристика. Энн Реум дис , 69 (5), 790-7 (2010). https://doi.org/10.1136/ard.2009.116624.

  • Элефтериу Д., Бату Э.Д., Озен С., Броган П.А. Васкулиты у детей. Трансплантация нефролового циферблата. 2015; 30 (Приложение 1): i94–103. https://doi.org/10.1093/ndt/gfu393.

    КАС Статья пабмед Google ученый

  • Мир С., Яваскан О., Мутлубас Ф., Ениай Б., Сонмез Ф.Клинические исходы у детей с нефритом Геноха-Шенлейна. Педиатр Нефрол. 2007;22(1):64–70. https://doi.org/10.1007/s00467-006-0278-0.

    Артикул пабмед Google ученый

  • Heineke MH, Ballering AV, Jamin A, Ben Mkaddem S, RC Monteiro и M. van Egmond: новое понимание патогенеза иммуноглобулинового васкулита (пурпура Геноха-Шенлейна). Аутоиммун Рев. 2017;16(12):1246–53. https://doi.org/10.1016/j.autrev.2017.10.009.

    КАС Статья пабмед Google ученый

  • Диас Дж.М., Гонсалес А.М., Алонсо Р.Б., Брунен Дж.М.Г., Реписо Г.А. Пищевой IgA-васкулит (пурпура Шенлейна-Геноха). Eur J Case Rep Intern Med. 2018;5(2):000774. https://doi.org/10.12890/2017_000774.

    Артикул пабмед ПабМед Центральный Google ученый

  • Lagier JC, Khelaifia S, Alou MT, Ndongo S, Dione N, Hugon P, et al.Культивирование ранее некультивируемых представителей микробиоты кишечника человека с помощью культуромики. Нат микробиол. 2016;1:16203. https://doi.org/10.1038/nmicrobiol.2016.203.

    КАС Статья пабмед Google ученый

  • Evenepoel P, Poesen R, Meijers B. Ось кишечник-почка. Педиатр Нефрол. 2017;32(11):2005–14. https://doi.org/10.1007/s00467-016-3527-x.

    Артикул пабмед Google ученый

  • Ширмер М., Смикенс С.П., Вламакис Х., Джагер М., Остинг М., Францоса Е.А. и др.Связывание микробиома кишечника человека с способностью вырабатывать воспалительные цитокины. Клетка. 2016;167(4):1125–1136.e8. https://doi.org/10.1016/j.cell.2016.10.020.

    КАС Статья пабмед ПабМед Центральный Google ученый

  • Planer JD, Peng Y, Kau AL, Blanton LV, Ndao IM, Tarr PI, et al. Развитие кишечной микробиоты и ответов IgA слизистой оболочки у близнецов и мышей-гнотобиотиков. Природа. 2016;534(7606):263–6. https://дои.орг/10.1038/природа17940.

    КАС Статья пабмед ПабМед Центральный Google ученый

  • С. Тао, Л. Ли, Л. Ли, Ю. Лю, К. Рен, М. Ши, Дж. Лю, Дж. Цзян, Х. Ма, З. Хуанг, З. Ся, Дж. Пан, Т. Вей, Ю. Ван, П. Ли, Т. Лан, С. Тан, С. Цзэн, С. Лей, Х. Тан и Л. Ма: понимание оси кишечник-почка при подтвержденной биопсией диабетической нефропатии , сахарный диабет 2 типа и здоровые контроли: анализ состава микробиоты кишечника, 56 (5), 581–592 (2019).https://doi.org/10.1007/s00592-019-01316-7.

  • Y. Li, X. Su, L. Zhang, Y. Liu, M. Shi, C. Lv, Y. Gao, D. Xu и Z. Wang: дисбиоз микробиома кишечника связан с ХБП5 и коррелирует с клиническими показателями заболевания: исследование случай-контроль, 17(1), 228 (2019). https://doi.org/10.1186/s12967-019-1969-1.

  • Zhang M, Sun K, Wu Y, Yang Y, Tso P, Wu Z. Взаимодействие между кишечной микробиотой и иммунным ответом хозяина при воспалительном заболевании кишечника.Фронт Иммунол. 2017;8:942. https://doi.org/10.3389/fimmu.2017.00942.

    КАС Статья пабмед ПабМед Центральный Google ученый

  • Xu KY, Xia GH, Lu JQ, Chen MX, Zhen X, Wang S и др. Нарушение функции почек и дисбиоз микробиоты кишечника способствуют повышению уровня триметиламина-N-оксида у пациентов с хроническим заболеванием почек. Научный доклад 2017; 7 (1): 1445. https://doi.org/10.1038/s41598-017-01387-y.

    КАС Статья пабмед ПабМед Центральный Google ученый

  • Johnson CC, Ownby DR.Бактериальная микробиота кишечника младенцев и риск детской астмы и аллергических заболеваний. Перевод рез. 2017;179:60–70. https://doi.org/10.1016/j.trsl.2016.06.010.

    Артикул пабмед Google ученый

  • Де Анджелис М., Монтемурно Э., Пикколо М., Ваннини Л., Лаурьеро Г., Маранцано В. и др. Микробиота и метаболом, связанные с иммуноглобулиновой нефропатией (IgAN). ПЛОС Один. 2014;9(6):e99006. https://doi.org/10.1371/журнал.поне.0099006.

    Артикул пабмед ПабМед Центральный Google ученый

  • Hu X, Du J, Xie Y, Huang Q, Xiao Y, Chen J и др. Характеристики фекальной микробиоты китайских пациентов с первичной IgA-нефропатией: перекрестное исследование. БМК Нефрол. 2020;21(1):97. https://doi.org/10.1186/s12882-020-01741-9.

    КАС Статья пабмед ПабМед Центральный Google ученый

  • Миллс Дж.А., Мишель Б.А., Блох Д.А., Калабрезе Л.Х., Хундер Г.Г., Аренд В.П. и др.Критерии 1990 года Американского колледжа ревматологии для классификации пурпуры Шенлейна-Геноха. Ревмирующий артрит. 1990;33(8):1114–21.

    КАС Статья Google ученый

  • Pillebout E, Thervet E, Hill G, Alberti C, Vanhille P, Nochy D. Пурпура Шенлейна-Геноха у взрослых: исход и прогностические факторы. J Am Soc Нефрол. 2002;13(5):1271–8. https://doi.org/10.1097/01.asn.0000013883.99976.22.

    Артикул пабмед Google ученый

  • Леви А.С., Стивенс Л.А., Шмид К.Х., Чжан Ю.Л., Кастро А.Ф. 3-й, Фельдман Х.И. и др.Новое уравнение для оценки скорости клубочковой фильтрации. Энн Интерн Мед. 2009;150(9):604–12. https://doi.org/10.7326/0003-4819-150-9-200

    0-00006.

    Артикул пабмед ПабМед Центральный Google ученый

  • Faul F, Erdfelder E, Lang AG, Buchner A. G*power 3: гибкая программа статистического анализа мощности для социальных, поведенческих и биомедицинских наук. Методы поведения Res. 2007;39(2):175–91. https://doi.org/10.3758/bf03193146.

    Артикул пабмед Google ученый

  • Wang J, Guo P, Gao Z, Zhou B, Ren L, Chen Y и др. Повышенный уровень билирубина и риск развития хронической болезни почек: метаанализ доза-ответ и систематический обзор когортных исследований. Инт Урол Нефрол. 2018;50(2):275–87. https://doi.org/10.1007/s11255-017-1675-y.

    КАС Статья пабмед Google ученый

  • Андраде-Оливейра В., Амано М.Т., Корреа-Коста М., Кастольди А., Фелизардо Р.Дж., де Алмейда Д.К. и др.Продукты Gut Bacteria предотвращают ОПП, вызванную ишемией-реперфузией. J Am Soc Нефрол. 2015; 26(8):1877–88. https://doi.org/10.1681/asn.2014030288.

    КАС Статья пабмед ПабМед Центральный Google ученый

  • Chen YH, Bai J, Wu D, Yu SF, Qiang XL, Bai H и др. Связь между фекальной микробиотой и генерализованным тревожным расстройством: тяжесть и ранний ответ на лечение. J Аффективное расстройство. 2019;259:56–66. https://дои.org/10.1016/j.jad.2019.08.014.

    КАС Статья пабмед Google ученый

  • Xiao C, Xiao P, Li X, Huang G, Li H, Chen Y. Стрептококк может усугублять воспалительное повреждение при хроническом нефрите посредством хемотаксиса клеток Th32. Am J Transl Res. 2019;11(12):7432–40.

    КАС пабмед ПабМед Центральный Google ученый

  • Zhu Y, He C, Li X, Cai Y, Hu J, Liao Y и др.Дисбактериоз кишечной микробиоты усугубляет течение острого панкреатита у пациентов и мышей. J Гастроэнтерол. 2019;54(4):347–58. https://doi.org/10.1007/s00535-018-1529-0.

    КАС Статья пабмед Google ученый

  • ZX Zhong, JX Tan, Y. Tang, L. Tan, GQ Pei и W. Qin: серповидные образования не являются прогностическим фактором при пурпуре Шенлейна-Геноха у взрослых, 19(4), 449–456 (2019). https://doi.org/10.1007/s10238-019-00567-6.

  • Ю. Г. З., Го Л., Донг Дж. Ф., Ши С. Ф., Лю Л. Дж., Ван Дж. В. и др. Стойкая гематурия и прогрессирование заболевания почек при IgA-нефропатии: когортное исследование. Am J почек Dis. 2020 г. https://doi.org/10.1053/j.ajkd.2019.11.008.

  • EA Bertola, GD Simonetti, R. Del Giorno, O. Giannini, EF Fossali, M. Meoli, MG Bianchetti and B. Terziroli Beretta-Piccoli: Внепочечные иммуноопосредованные расстройства, связанные с острым постстрептококковым гломерулонефритом: систематический обзор , 57(2), 294–302 (2019).https://doi.org/10.1007/s12016-019-08761-w.

  • Дитрих М.Л., Стил Р.В. Группа стрептококков. Pediatr Rev. 2018;39(8):379–91. https://doi.org/10.1542/pir.2017-0207.

    Артикул пабмед Google ученый

  • Коппо Р. Взаимодействие кишечника и почек при IgA-нефропатии. Семин Нефрол. 2018;38(5):504–12. https://doi.org/10.1016/j.semnephrol.2018.05.020.

    КАС Статья пабмед Google ученый

  • Берни Канани Р., Сангван Н., Стефка А.Т., Ночерино Р., Папаро Л., Айторо Р. и др.Смесь с добавлением Lactobacillus rhamnosus GG увеличивает количество бактериальных штаммов, продуцирующих бутират, у младенцев с пищевой аллергией. Исме Дж. 2016;10(3):742–50. https://doi.org/10.1038/ismej.2015.151.

    КАС Статья пабмед Google ученый

  • Pelucchi C, Chatenoud L, Turati F, Galeone C, Moja L, Bach JF, et al. Добавление пробиотиков во время беременности или в младенчестве для профилактики атопического дерматита: метаанализ. Эпидемиология.2012;23(3):402–14. https://doi.org/10.1097/EDE.0b013e31824d5da2.

    Артикул пабмед Google ученый

  • Tao S, Tao S, Cheng Y, Liu J, Ma L, Fu P. Влияние пробиотических добавок на прогрессирование хронического заболевания почек: метаанализ. Нефрология (Карлтон). 2019;24(11):1122–30. https://doi.org/10.1111/nep.13549.

    КАС Статья Google ученый

  • Chemouny JM, Gleeson PJ, Abbad L, Lauriero G, Boedec E, Le Roux K, et al.Модуляция микробиоты пероральными антибиотиками лечит иммуноглобулиновую нефропатию у гуманизированных мышей. Трансплантация нефролового циферблата. 2019;34(7):1135–44. https://doi.org/10.1093/ndt/gfy323.

    КАС Статья пабмед Google ученый

  • Дисбактериоз кишечника, барьерная дисфункция и бактериальная транслокация Объяснение системного воспаления, связанного с ХБП

    Резюме

    ХБП связана с системным воспалением, но основная причина неизвестна.Здесь мы исследовали участие кишечной микробиоты. Мы сообщаем, что у мышей с дефицитом коллагена типа 4 α 3 с прогрессирующей ХБП, связанной с синдромом Альпорта, наблюдается системное воспаление, включая повышенный уровень пентраксина-2 в плазме и активированных антиген-презентирующих клеток, CD4 и CD8 Т-клеток и Th27- или IFNγ. – продукция Т-клеток в селезенке, а также подавление регуляторных Т-клеток. Связанное с ХБП системное воспаление у этих мышей связано с дисбиозом кишечника протеобактериального цветения, транслокацией живых бактерий через кишечный барьер в печень и повышенным уровнем бактериального эндотоксина в сыворотке.Уремия не влияла на высвобождение секреторного IgA в просвет подвздошной кишки или субпопуляции лейкоцитов слизистой оболочки. Чтобы проверить причинно-следственную связь между дисбактериозом и системным воспалением при ХБП, мы ликвидировали факультативную анаэробную микробиоту антибиотиками. Эта эрадикация предотвратила бактериальную транслокацию, значительно снизила уровень эндотоксина в сыворотке и полностью восстановила все маркеры системного воспаления до уровня неуремического контроля. Таким образом, мы делаем вывод, что уремия связана с дисбактериозом кишечника, дисфункцией кишечного барьера и бактериальной транслокацией, которые запускают состояние персистирующего системного воспаления при ХБП.Уремический дисбактериоз и дисфункция кишечного барьера могут быть новыми терапевтическими мишенями для вмешательства, направленного на подавление системного воспаления, связанного с ХБП, и его последствий.

    ХБП связана с персистирующим системным воспалением, вызывающим эндотелиальную дисфункцию, атерогенез и сердечно-сосудистые заболевания, 1 , но основная причина системного воспаления, связанного с ХБП, до сих пор неясна. Считалось, что причиной этого явления являются связанные с диализом инфекции катетеров, загрязненная вода или небиосовместимые трубки и диализные фильтры.Однако уровни циркулирующего бактериального эндотоксина в сыворотке увеличиваются от стадии 2 к стадии 5, 2 , что предполагает наличие эндогенного источника бактериального эндотоксина. Здесь мы сосредоточимся на микробиоте организма как на потенциальном причинном триггере системного воспаления, связанного с ХБП.

    Микробиота представляет собой в 10 раз больше бактериальных клеток, чем клеток человека, находящихся на внешней и внутренней поверхностях тела. 3 Симбионты ограничивают рост патобионтов и дисбиоз. 4 Кишечные симбионты производят необходимые питательные вещества, такие как витамин К и компоненты, которые регулируют многочисленные метаболические процессы в организме. 5 Исследования на стерильных мышах показали, что микробиота формирует и обучает иммунную систему в раннем возрасте. 6 Однако эпителиальные барьеры должны удерживать микробиоту вне организма, чтобы избежать бактериальной транслокации, системного воспаления и смертельных инфекций. 7,8 Хорошо описано, что дисбиоз, дисфункция кишечного барьера и бактериальная транслокация вызывают и увековечивают воспаление при воспалительных заболеваниях кишечника, 9 портальной гипертензии, 7 или сердечной недостаточности. 10 Таким образом, мы предположили, что метаболические изменения во время уремии аналогичным образом способствуют кишечному дисбактериозу и бактериальной транслокации как триггеру персистирующего состояния системного воспаления, связанного с ХБП.

    Мы выбрали мышей с дефицитом коллагена 4 типа α 3 ( Col4a3 ) для проверки нашей гипотезы, потому что у этих мышей спонтанно развивается прогрессирующий гломерулосклероз и ХБП (нефропатия Альпорта) без каких-либо хирургических, токсических или диетических вмешательств, которые могли бы повлиять на микробиота за пределами метаболических изменений уремии (рис. 1, А и Б). 11 Уремия у 9-недельных мышей Col4a3- с дефицитом ассоциировалась с уровнями в сыворотке пентраксина-2/компонента амилоида Р, который является функциональным мышиным гомологом человеческого С-реактивного белка, который служит маркером системной воспаление у мышей (рис. 1C). Кроме того, мы проанализировали фенотипирование спленоцитов на 9-й неделе, поскольку селезенка удаляет передающиеся с кровью антигены и инициирует врожденный и адаптивный иммунный ответ против патогенов. Проточная цитометрия показала, что уремия у мышей с дефицитом Col4a3- была связана с увеличением количества активированных CD4 и CD8 T-лимфоцитов (маркер активации CD69) и IL-17- или IFN γ -продуцирующих CD4 T-клеток (рис. 1D).Напротив, количество регуляторных Т-клеток Foxp3+ было снижено по сравнению с контрольными мышами без уремии (рис. 1D). Кроме того, популяция активированных (CD86+) CD11c+ антигенпрезентирующих клеток была увеличена (рис. 1D), что указывает на общее состояние системной иммунной активации у мышей с дефицитом уремии Col4a3 .

    Рисунок 1.

    Системное воспаление у уремических мышей с дефицитом Col4a3. (A) Гломерулярная и тубулоинтерстициальная патология у 9-недельных мышей Col4a3 с дефицитом иллюстрируется периодическим окрашиванием кислотой-Шиффом.Репрезентативные изображения показаны с исходным увеличением в 400 раз. (B) ХБП иллюстрируется прогрессивным снижением СКФ, измеренным чрескожным клиренсом синистрина FITC у мышей в сознании. (C) Уровни пентраксина-2 (PTX2)/амилоида P в сыворотке (SAP) в сыворотке соответствуют человеческому PTX1/C-реактивному белку и указывают на системное воспаление в возрасте 9 недель. (D) Проточный цитометрический анализ лимфоцитов и миелоидных клеток в селезенке 9-недельных неуремических мышей дикого типа и уремических Col4a3 -дефицитных мышей показывает значительное увеличение количества активированных Т-клеток и CD11c+ миелоидных мононуклеарных фагоцитов.Данные представляют собой средние значения ± стандартная ошибка среднего по меньшей мере для пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; ** P <0,01 по сравнению с диким типом; *** P <0,001 по сравнению с диким типом.

    Предполагая, что системное воспаление при уремии связано с изменениями кишечной микробиоты, мы сначала количественно и качественно охарактеризовали кишечную микробиоту у мышей с дефицитом Col4a3 и мышей дикого типа. Хотя мы обнаружили среднее количество факультативных анаэробных бактерий 10 5 –10 6 КОЕ/г фекалий у мышей дикого типа в возрасте 3–9 недель, прогрессирующая ХБП у мышей с дефицитом Col4a3 была связана с увеличением факультативного количество анаэробных бактерий в пять-десять раз по сравнению с мышами дикого типа того же возраста (рис. 2А).Ампликонное секвенирование бактериальных генов 16S рРНК было проведено для характеристики состава фекальной микробиоты у 3- и 9-недельных уремических и неуремических мышей. α -Разнообразие, мера сложности микробиоты, было незначительно, но незначительно увеличено у 9-недельных мышей, что соответствует увеличению видового богатства с возрастом. Точно так же не было обнаружено существенной разницы между мышами дикого типа и мышами с дефицитом Col4a3 (дополнительные рисунки 1 и 2). β -Разнообразие, показатель сходства между различными микробными популяциями, определяли путем анализа невзвешенных и взвешенных матриц расстояний UniFrac.Невзвешенные расстояния UniFrac сравнивают микробные сообщества в филогенетическом контексте на основе наличия или отсутствия таксонов (принадлежность к сообществу), тогда как взвешенный UniFrac также включает информацию об относительной численности (структура сообщества). Значительные различия были определены только с помощью невзвешенного UniFrac между мышами дикого типа и мышами с дефицитом Col4a3 в возрасте 9 недель и между мышами дикого типа в возрасте 9 недель и мышами с дефицитом Col4a3 в возрасте 3 недель (дополнительная фигура 3).В частности, в возрасте 9 недель относительная численность Alcaligenaceae β -Proteobacteria (среднее ± стандартная ошибка среднего) составляла от 0,09% ± 0,03% до 0,94% ± 0,42% ( P >0,50), относительная численность Verrucomicrobiaceae (средняя ±SEM) составляла от 0,04%±0,01% до 7,90%±6,95% ( P >0,50), относительная численность Bacteroidetes-Bacteroidaceae (среднее ±SEM) составляла от 1,45%±0,72% до 10,65%±3,72% (P <0,50), а относительная численность Bacteroidetes-Porphyromonadaceae (среднее значение ± стандартная ошибка среднего) составляла 0,92% ± 0.От 25 % до 3,05 % ± 1,05 % ( P > 0,50) у уремических мышей с дефицитом Col4a3, тогда как Bacteroidetes-Bacteroirales снижался у уремических мышей (с 48,05 % ± 7,97 % до 24,57 % ± 10,46 %; P <0,001). (Рисунок 2Б). Дисбактериоз, связанный с уремией, не был связан с какими-либо изменениями подтипов иммунных клеток стенки тонкой кишки или высвобождением секреторного (s) IgA (таблица 1). Следовательно, мы делаем вывод, что прогрессирующая ХБП и сопровождающая ее уремия у мышей с дефицитом Col4a3 связаны с протеобактериальным цветением и дисбиозом.

    Рисунок 2.

    Уремия влияет на разнообразие микробиоты и барьерную функцию кишечника. (A) Количественный дисбиоз, измеряемый количеством КОЕ на грамм фекалий, наблюдается у мышей с дефицитом Col4a3 по сравнению с животными дикого типа. С увеличением возраста у мышей с дефицитом Col4a3 развился еще более значительный количественный дисбактериоз. (B) Относительное количество различных таксонов бактерий, обнаруженных в образцах фекалий. Изменения в составе микробиоты кишечника, которые могут быть связаны со старением, обнаруживаются у мышей в возрасте 3 и 9 недель в обеих линиях.Сравнение Col4a3 -дефицитных мышей и мышей дикого типа в возрасте 9 недель демонстрирует различия в порядках Bacteroidales, Burholderiales (семейство Alcaligenaceae), Enterobacteriales и Verrucomicrobiales. Подробная информация, включая статистику, приведена в дополнительной таблице 1. (C) Бактериальные колонии выросли из ткани печени мышей с дефицитом уремии Col4a3 , но не из неуремических мышей дикого типа. (D) Сыворотки мышей с уремией и без уремии были проанализированы с использованием анализа лизата амебоцитов limulus и показали значительно повышенные уровни бактериального эндотоксина.(E) Эксперименты ECIS демонстрируют значительное снижение средней устойчивости в одноклеточных слоях клеток Colon26 после обработки сывороткой мышей с дефицитом уремии Col4a3 (момент времени отмечен стрелками) по сравнению с клетками, обработанными сывороткой мышей дикого типа. . Данные представляют собой средние значения ± стандартная ошибка среднего по меньшей мере для пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; *** P <0,001 по сравнению с диким типом.

    Таблица 1.

    Проточная цитометрия лейкоцитов кишечника у 8,5-недельных мышей Col4a3 -дефицитных иммунная активация отмечена у уремических мышей.Фактически, культуры печени выявили заражение культивируемыми живыми бактериями у 60% всех уремических мышей с дефицитом Col4a3 (рис. 2С), что было связано с тенденцией к более активным макрофагам и дендритным клеткам в печени (таблица 2). Следовательно, мы перорально заражали уремических мышей комменсалом Escherichia coli , конститутивно экспрессирующим зеленый флуоресцентный белок (GFP), с помощью перорального зонда. Мы обнаружили GFP+ бактерии в 40% печени мышей с уремией, но не у мышей без уремии (не показано), что свидетельствует о перемещении даже живых бактерий из кишечного тракта.В соответствии с этими выводами, у уремических мышей с дефицитом Col4a3 наблюдались значительно повышенные уровни бактериального эндотоксина в сыворотке по сравнению с мышами дикого типа без уремии (рис. 2D). Тщательный анализ стенки кишечника с помощью периодического окрашивания кислотой-Шиффом, иммуноокрашивания ZO-1 и просвечивающей электронной микроскопии не выявил структурных изменений, таких как язвы или диффузные аномалии плотных контактов, у мышей дикого типа и мышей с дефицитом Col4a3 (дополнительный рисунок). 4). Однако, когда культивированные эпителиальные клетки толстой кишки подвергались воздействию сыворотки уремических мышей с дефицитом Col4a3 или неуремических мышей дикого типа, только уремическая сыворотка снижала трансэпителиальную резистентность как маркер трансэпителиальной проницаемости (рис. 2Е).

    Таблица 2.

    Проточная цитометрия лейкоцитов кишечника у мышей в возрасте 8,5 недель Col4a3 -дефицитных мышей с лечением антибиотиками и без него

    — дефицитные мыши с синергической пероральной комбинацией антибиотиков, которая уничтожала факультативную анаэробную кишечную микробиоту из кишечника и печени (рис. 3А). Истощение микробиоты значительно снизило уровни бактериального эндотоксина в сыворотке (рис. 3B) и уровни внутрипеченочной экспрессии мРНК пентраксина-2/сывороточного амилоида P и IL-6 (рис. 3C).Соответственно, проточная цитометрия спленоцитов показала менее активированные Т-клетки и восстановление регуляторных Т-клеток (рис. 3D). Не было обнаружено влияния на функцию почек или внутрипочечные профили лейкоцитов (данные не представлены). Таким образом, мы делаем вывод, что уремический дисбиоз и бактериальная транслокация вызывают системное воспаление, связанное с ХБП.

    Рисунок 3.

    Уремическое системное воспаление корректируется путем эрадикации микробиоты. Все пунктирные линии на B и C представляют значения контрольных животных дикого типа.(A) Репрезентативные фотографии показывают полное уничтожение грамотрицательной фекальной флоры после лечения антибиотиками. График дот-блоттинга иллюстрирует КОЕ культур фекалий в возрасте 7 недель. На графике представлены результаты для неселективных сред, поскольку был взят предел обнаружения (пунктирная линия) 10 КОЕ/г фекалий. (B) Уровни эндотоксина в сыворотке с лечением антибиотиками и без него у мышей с дефицитом Col4a3 . ( C ) Уровни экспрессии мРНК амилоида P и IL-6 в сыворотке крови в острой фазе с лечением антибиотиками и без него у мышей с дефицитом Col4a3 .(D) Проточная цитометрия суспензий клеток селезенки у уремических Col4a3 -дефицитных мышей с лечением антибиотиками и без него. Данные представляют собой средние значения ± стандартная ошибка среднего по меньшей мере для пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; ** P <0,01 по сравнению с диким типом.

    Бактериальный эндотоксин является важным стимулом для иммунной активации через Toll-подобный рецептор 4 и каспазу 11 при грамотрицательном сепсисе с почечной недостаточностью или без нее. 12,13 Различные стадии ХБП и системного воспаления, связанного с ХБП, связаны с прогрессирующим увеличением циркулирующего бактериального эндотоксина, CD14 и других биомаркеров системного воспаления. 2,14,15 Кроме того, мочевина, секретируемая уремическим организмом в просвет кишечника, способствует образованию уреазообразующих бактерий, которые уже наблюдались у людей и сходны с нашими результатами. 16,17 Некоторые типы уразообразующих бактерий также участвуют в производстве так называемых уремических токсинов, таких как индол или п-крезол, которые, как известно, способствуют системному воспалению. В принципе, причинно-следственная связь этой связи может быть двусторонней (, например, , воспаление, связанное с ХБП, может способствовать проникновению эндотоксина, или поступление уремического токсина/эндотоксина, связанного с ХБП, может способствовать воспалению).Наше исследование теперь подтверждает, что системная иммунная активация, связанная с ХБП, обратима при уничтожении микробиоты. Это означает, что именно микробиота отвечает за системное воспаление, связанное с ХБП.

    Системное введение антибиотиков влияет на микробиоту всего организма, и поэтому остается неясным, какая микробиота и из каких областей в наибольшей степени способствует воспалению, связанному с ХБП. Тем не менее, кишечник содержит, безусловно, наибольшее количество бактериальных клеток, и мы также показываем, используя меченый GFP E.coli , транслокация бактерий через кишечный барьер происходит при ХБП. У мышей с уремией даже живые бактерии достигали печени, вероятно, преодолев кишечный эпителиальный барьер и попадая в воротную вену. Как может происходить эта транслокация, не совсем ясно. Сообщалось, что ХБП, вызванная диетой, богатой аденином, у крыс связана с диффузной дезинтеграцией плотных контактов в эпителиальных клетках кишечника. 18-20 Поскольку Col4a3-дефицитные мыши со спонтанной CKD лишены этого явления, возможно, что такие изменения связаны с индуцированной кристаллами аденина эпителиальной цитотоксичностью, а не с уремией per se .Фактически кристаллы могут оказывать прямое цитотоксическое действие на эпителиальные клетки. 21 Тем не менее, мы и другие обнаружили, что уремическая (но не неуремическая) плазма увеличивает проницаемость монослоев кишечных эпителиальных клеток in vitro . 18 Таким образом, рабочая гипотеза заключается в том, что, по крайней мере, очаговая дисфункция кишечного барьера должна способствовать бактериальной транслокации, и, возможно, дисбактериоз кишечника выступает в качестве кофактора.

    Увеличение числа кишечных протеобактерий, связанное с ХБП, представляет собой переход к потенциально патогенным бактериям (патобионтам), что часто связано с широким спектром заболеваний. 22 Наши результаты согласуются с несколькими предыдущими исследованиями на людях с уремией, 16 уремических крысах, 16 и уремических мышах. 23 Дисбактериоз кишечника связан со сдвигом в секреторном профиле микробиоты, включая такие факторы, как метаболит фосфатидилхолина триметиламин N -оксид, который может непосредственно стимулировать прогрессирование ХБП и сердечно-сосудистых заболеваний. 24,25 Известно, что микробиота чувствительна к изменениям экосистемы, связанным с диетой или обменом веществ. 26,27 Метаболические изменения при уремии, включая метаболический ацидоз и азотемию, дают многочисленные объяснения сдвигов микробиоты. 26,27 Попытки коррекции уремического дисбактериоза с помощью пробиотических препаратов основаны на идее модулировать уремический дисбиоз целенаправленными вмешательствами. 28 Вместе мы пришли к выводу, что дисбактериоз кишечника, барьерная дисфункция и бактериальная транслокация являются причиной системного воспаления при ХБП и потенциально полностью обратимы.

    Краткие методы

    Исследования на животных

    Col4a3 однопометных мышей и мышей дикого типа с идентичным генетическим фоном Sv129 разводили в определенных свободных от патогенов условиях содержания, совместно содержали в одних и тех же клетках и генотипировали, как описано ранее. 29 В возрасте 6 недель группы мышей Col4a3 -дефицитных и мышей дикого типа были рандомизированы для перорального введения 25 мг/кг неомицина, 60 мг/кг ампициллина или 25 мг/кг метронидазола один раз в день. в течение 12 дней.Некоторым мышам штамм E. coli MG1655, несущий плазмиду pM979 для конститутивной экспрессии GFP, вводили через зонд на 13-й день. Все исследования на животных были одобрены местным правительственным комитетом по этике.

    СКФ и биоанализы

    СКФ измеряли у мышей, находящихся в сознании, с использованием чрескожной детекторной системы для определения кинетики клиренса FITC синистрина (Mannheim Pharma & Diagnostics GmbH), как описано. 31 Сердечная пункция выполнялась в стерильных условиях, и анализ лизата лимулюсных амебоцитов использовался для количественного определения уровней ЛПС в плазме (HIT302; Hycult Biotech, PB Uden, Нидерланды). Уровни амилоида P в сыворотке определяли с помощью коммерческого набора Mouse Pentraxin 2/SAP Quantikine ELISA Kit (R&D Systems, Миннеаполис, Миннесота).

    Количественная оценка и квалификация бактерий

    Количество КОЕ

    Свежие фекалии растворяли в 500 мкл л PBS, разбавляли и высевали в объеме 50 мкл л на чашки с агаром MacConkey в качестве селективной среды для грамположительных бактерий и LB. агаровые пластины как неселективная среда.Планшеты инкубировали в течение 1–2 сут при 37°С в аэробных условиях; 2–3 г ткани органа иссекали в стерильных условиях путем процеживания через стерильное сито с размером ячеек 70- мк мкм, тщательно промывали 500 мк мкл PBS и 100 мк л высевали на чашки с агаром MacConkey. Для количественного определения ампициллин-резистентной E. coli MG1655 pM979 использовали агар, содержащий ампициллин (100 мк г/мл). Все подсчеты КОЕ были рассчитаны на массу введенного образца стула или ткани при пределе обнаружения 10 КОЕ/г для фекалий и 60 КОЕ/г для печени.

    Выделение ДНК стула и секвенирование ампликона гена 16S рРНК

    Набор QIAamp DNA Stool Mini Kit (51504; Qiagen, Germantown, MD) использовали для выделения гДНК из свежесобранных образцов фекалий от обеих линий мышей. Вариабельные области гена 16S рРНК V3–V6 амплифицировали с помощью ПЦР с использованием фекальной гДНК. ПЦР состояла из двух последовательных стадий. Праймеры, направленные на ген 16S рРНК (курсив) и специфических праймеров, несущих адаптеры 5’M13 / RM13 (жирный шрифт) 338F-М13 ( GTAAACGACGGCCAGTG CTCCTACGGGWGGCAGCAGT) и 1044R-RM13 ( GGAAACAGCTATGACCATGA CTACGCGCTGACGACARCCATG) были использованы для амплификации область V3–V6 бактериального гена 16S рРНК.Одна реакция ПЦР содержала по 500 нМ каждого праймера (338F-M13 и 1044R-rM13), 2× DreamTaq PCR Master Mix и 50 нг матричной гДНК. Реакцию ПЦР проводили в двух повторностях с использованием термоциклера peqSTAR 2× Gradient Thermocycler (Peqlab Biotechnology). Условия ПЦР: 95°С в течение 10 минут, затем 20 циклов при 95°С в течение 30 секунд, 55°С в течение 30 секунд и 72°С в течение 45 секунд и конечная стадия элонгации при 72°С в течение 10 минут. Повторные реакции объединяли и загружали в 1% агарозный гель для подтверждения успешной ПЦР-амплификации.После очистки продуктов ПЦР с использованием геля NucleoSpin и набора для очистки ПЦР в соответствии с инструкциями производителя концентрацию и качество очищенных продуктов ПЦР оценивали с помощью Nanodrop (Peqlab Biotechnology). Чтобы штрих-кодировать каждый продукт ПЦР определенной последовательностью MID и добавить 454-специфичную метку Lib-L, вторую ПЦР проводили с использованием M13/rM13-специфичных праймеров, содержащих 454-специфичные праймеры Lib-L (подчеркнуты) A-M13 (CCATCTCATCCCTGCGTGTCTCCGACTCAG). /MIDsequence/ GTAAACGACGGCCAGG ) и B-rM13 ( CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGGAAACAGCTATGA CCATGA ).40 различных штрих-кодов MID размером 10 п.н., исправляющих ошибки, для мультиплексирования перечислены в таблице 3. ПЦР проводили с использованием 400 нМ каждого праймера (A-M13 и B-rM13). Ампликоны второй ПЦР объединяли и очищали осаждением этанолом. Очищенные продукты ПЦР помещали в 0,8% агарозный гель, вырезали полосы, соответствующие последовательностям гена 16S рРНК со штрих-кодом, и экстрагировали ДНК с использованием геля NucleoSpin и набора для очистки ПЦР. ДНК элюировали в ddH 2 O, далее очищали с использованием AMPure Beads (Beckman Coulter, Inc., Brea, CA) и, наконец, ресуспендировали в ddH 2 O. Концентрацию и качество очищенных последовательностей со штрих-кодом оценивали с использованием Nanodrop (Peqlab Biotechnology). Образцы хранили при -20°С. Секвенирование ампликона выполняли в Eurofins на платформе 454 GS FLX Titanium с одной стороны (Lib-L-A) в соответствии с процедурами, рекомендованными для 454 Roche (Roche, Базель, Швейцария).

    Таблица 3.

    Штрих-коды MID для мультиплексирования 454

    Биоинформатический анализ

    Данные были проанализированы, как описано недавно. 32 Вкратце, необработанные последовательности были предварительно обработаны с использованием FASTX-Toolkit и UCHIME. Последовательности, прошедшие фильтрацию качества (минимальное качество 20), были демультиплексированы и обрезаны для удаления коротких ридов (минимальная длина 100). Последовательности проверяли на наличие химер (UCHIME; стандартные параметры) с использованием справочной базы данных microbiomeutils (r20110519). Самостоятельно написанный сценарий создал файл сопоставления и файл fastA, которые использовались в качестве входных данных для Quantitative Insights in Microbial Ecology (QIIME).

    Обработка

    Последовательности анализировали с использованием пакета QIIME. Последовательности были отнесены к рабочим таксономическим единицам с 97% попарной идентичностью, а затем таксономически классифицированы с использованием классификатора RDP. На диаграммах показано относительное обилие таксонов на уровне типов в наборах данных (среднее значение ± стандартная ошибка среднего; n = 5). Репрезентативный набор последовательностей был выровнен с использованием PyNAST. Выравнивание использовалось для построения филогенетического дерева с помощью FastTree. Дерево использовалось для расчета расстояний UniFrac между образцами. 33 PERMANOVA 34 использовался для проверки статистической значимости группировок образцов на основе различных матриц расстояний UniFrac. Для измерений разнообразия α был выполнен анализ разрежения для расчетного количества видов в каждой пробе с использованием алгоритма наблюдаемых видов в QIIME.

    Оценка ткани

    Части почки, подвздошной кишки и толстой кишки фиксировали в 10% формалине в PBS и заливали в парафин; Срезы 4- мк м окрашивали периодической кислотой–реактивом Шиффа.Для ультраструктурного анализа образцы толстой кишки 8-недельных обработанных и необработанных мышей вырезали и фиксировали в 0,1 М буфере PBS (pH 7,4), дополненном 0,4% параформальдегидом и 2% глутаральдегидом. Полимеризацию (с использованием свежей смолы Epon) проводили при 60°С в течение 24 часов, как описано. 35 В качестве первичных антител для иммуноокрашивания использовали следующие антитела: козьи анти-ZO-1 и кроличьи антиокклюдиновые (ab1 и ab64482 соответственно; Abcam, Inc., Кембридж, Массачусетс).

    Количественная ОТ-ПЦР в реальном времени

    Тотальную РНК выделяли с использованием набора для выделения РНК (Life Technologies, Карлсбад, Калифорния) в соответствии с инструкциями производителя, а качество РНК оценивали с использованием агарозных гелей.После выделения РНК с помощью обратной транскрипции создавали кДНК (Superscript II; Invitrogen, Carlsbad, CA). Систему обнаружения зеленого красителя SYBR использовали для количественной ПЦР в реальном времени на Light Cycler 480 (Roche) с использованием 18s рРНК в качестве гена домашнего хозяйства. Использовали ген-специфические праймеры, обработанные с помощью ансамбля-BLAST, и праймера NCBI-BLAST (Metabion, Martinsried, Germany), как указано в таблице 4. Нематричные контроли, состоящие из всех использованных реагентов, были отрицательными в отношении генов-мишеней и «домашнего хозяйства». Для снижения риска ложноположительных точек пересечения использовался алгоритм высокой достоверности.Профили кривых плавления анализировали для каждого образца для обнаружения возможных неспецифических продуктов или димеров праймеров. В качестве гена домашнего хозяйства использовали 18s РНК.

    Таблица 4.

    Праймеры, используемые для количественной ОТ-ПЦР в режиме реального времени

    Выделение и проточная цитометрия органных лейкоцитов и стимулированных Т-клеток следующие антитела: анти-CD3

    ε (клон 145–2C11; Becton Dickinson, Сан-Диего, Калифорния), анти-CD4 (клон RM4–5; Becton Dickinson), анти-CD8 (клон 53–6.7; Becton Dickinson), анти-CD69 (клон h2.2F3; Becton Dickinson), анти-FOXP3 (421403; BioLegend, Сан-Диего, Калифорния), анти-CD11c (клон HL3; Becton Dickinson), анти-F4/80 (клон MCA ; AbD Serotec), анти-CD86 (клон GL1; Becton Dickinson) и анти–IL-17 (ebio17B7; Becton Dickinson). Внутриклеточное окрашивание на FoxP3 и IL-17 проводили с использованием набора Cytofix/Cytoperm (Becton Dickinson). Анализ стимуляции Т-клеток проводили на клетках селезенки (примерно 10 6 ) в 200 мкл мкл буфера PBS; Добавляли 50 нг/мл ацетата форболмиристата и 1 мкг/мл мкг/мл иномицина и инкубировали при 37°C в течение 4.5 часов до окрашивания.

    In Vitro Исследования

    Индуцированные уремической сывороткой изменения сопротивления и емкости бессмертных клеток толстой кишки-26 мышей (лот 400156–812; CLS, Эппельхайм, Германия) были проанализированы с использованием устройства для измерения импеданса субстрата электрических клеток (ECIS). (Прикладная биофизика Inc., Нью-Йорк, штат Нью-Йорк). Клетки культивировали в среде RPMI Glutamax (Life Sciences, Heidelberg, Germany) с добавлением 10% диализированного FCS (Life Sciences Heidelberg, Германия) перед посевом. Следовательно, 1.0×10 6 замороженных клеток (в 1,0 мл криосреды и 10% ДМСО в диализированной FCS) оттаивали и рекультивировали в указанных средах до слияния. Сначала для измерения ECIS лунки экспериментальной камеры предварительно покрывали на 10 минут цистеином. Во-вторых, еще одно покрытие с 0,01% коллагена (телячья кожа 1 типа) было нанесено на ночь при 4°C. Клетки из того же пассажа высевали с плотностью 600000 клеток на лунку в объеме 400 мкл л среды и инкубировали в течение ночи (37°С и 5% СО 2 ).Среду удаляли на следующий день и осторожно добавляли 360 мкл л свежей среды. Подготовленную камеру подключали к прибору ECIS (многоканальный режим) на 1 час без каких-либо манипуляций. Затем была проведена проверка частоты, а затем еще 1 час в многоканальном режиме. Для стимуляции были взяты скважины без изменений по сопротивлению. Сливающиеся монослои стимулировали 40 мкл мкл сыворотки мышей Sv129 дикого типа (АМК = 24 мг/дл) или мышей с дефицитом Col4a3 (АМК = 240 мг/дл).После стимуляции резистентность регистрировали в течение примерно 18 часов. Начальная точка временной шкалы (рис. 2Е) была установлена ​​на момент времени, когда был достигнут почти постоянный наклон кривых сопротивления.

    Статистический анализ

    Данные представлены как среднее ± стандартная ошибка среднего. Сравнение отдельных групп проводили с использованием тестов t или Манна-Уитни U . Нормальное распределение проверяли с помощью критерия Шапиро-Уилка. Несколько групп были проанализированы с помощью ANOVA с последующим пост-тестом Бонферрони.Считалось, что значение P <0,05 указывает на статистическую значимость. PERMANOVA на невзвешенных и взвешенных матрицах расстояний UniFrac выполнялась в QIIME.

    Благодарности

    Мы благодарим Dan Draganovic, Jana Mandelbaum и Mauel Diekl за квалифицированную техническую помощь.

    Этот проект был поддержан медицинским факультетом Мюнхенского университета. Части этого проекта были подготовлены в качестве докторской диссертации на медицинском факультете Мюнхенского университета М.С.К.

    • Copyright © 2016 Американского общества нефрологов

    Дисбактериоз кишечника | Потеря веса

    Если вы страдаете дисбактериозом кишечника, простой анализ крови даст нам данные, необходимые для оценки уровня проницаемости вашего пищеварительного тракта. Числовое значение будет присвоено для представления уровня дисбактериоза, и это число может быть переоценено, когда вы работаете над восстановлением желудочно-кишечного тракта.

    Кишечный дисбиоз — новый медицинский термин для обозначения дисбаланса кишечной флоры, концепция, впервые предложенная врачами-холистами и натуропатами.Но это не значит, что эта концепция нова; травники использовали эту идею с древних времен — Гиппократ обсуждал проблему кишечных токсинов еще в 400 г. до н.э. Думайте о мембранах, выстилающих тонкий и толстый кишечник, как о своем заднем дворе. В этой аналогии мембраны вашего кишечника представлены почвой, а бактерии «хорошего парня», населяющие ваш кишечный тракт, — травой. «Плохие парни» или неподходящие бактерии, дрожжи, черви или паразиты подобны росичке, которая может вторгнуться и захватить часть газона вашего кишечника.Всего учеными выявлено более 400 видов кишечной микрофлоры, число которых в средней кишечной среде исчисляется миллиардами и может измеряться фунтами. Хорошие парни производят полезные вещества, в том числе важные природные антибиотики и иммуностимулирующие химические вещества, а плохие парни могут производить канцерогены, органические амины и высокие уровни эндотоксинов (токсины, выделяемые в организм при гибели бактерий). Плохое пищеварение, неправильный выбор продуктов питания, воспаление, сырость, стресс и т. д.может привести к дисбалансу кишечной флоры. В зависимости от характера инфекции, проблемы могут варьироваться от легких до крайне изнурительных.

    [/two_ Third][one_ Third_last][/one_ Third_last]
    Проблемы с дисбактериозом чрезвычайно распространены, особенно среди женщин, и неспособность правильно диагностировать и лечить их может привести к большим страданиям и разочарованиям. Чрезмерное употребление антибиотиков является распространенной причиной, но более сильные штаммы «супербактерий», которые существуют в настоящее время, могут попасть в организм разными путями — из-за низкой кислотности желудка, зараженных продуктов, чрезмерного употребления сахара и т. д.Основными симптомами обычно являются тяга к сахару, углеводам и хлебу, газы и вздутие живота (в меньшей степени или отсутствуют, если проблема бактериальная, а не дрожжевая или грибковая), а также ряд неприятных длительных проблем, особенно усталость, боли в мышцах и «мозговой туман». Однако, в зависимости от организма, любой из этих общих симптомов может проявляться в большей или меньшей степени. Эта изменчивость, зависящая от назойливых «тварей», часто является причиной пропуска диагнозов. Также могут возникать депрессия и хроническая усталость, что приводит к неправильной диагностике и лечению.Часто язык бледный или синий из-за кислородного голодания, вызванного дисбактериозом. Некоторые из рассматриваемых организмов становятся более активными ночью, и в этом случае симптомы значительно ухудшаются после пробуждения.

    По моему опыту, невылеченный дисбактериоз может быть причинным фактором множества сложных болезненных состояний, которые необходимо лечить и устранять в первую очередь для достижения хороших результатов в лечении основного состояния. К ним относятся, помимо прочего, проблемы со щитовидной железой, воспаление глаз, хронические заболевания полости рта и носовых пазух (иногда с красным жжением языка), кислотный рефлюкс, хронический вагинальный дрожжевой грибок, инфекции мочевыводящих путей или предстательной железы, хроническая усталость, различные формы гормонального истощения, нарушение сна. , увеличение веса (из-за сильной тяги к сладкому), пищевая аллергия, аутоиммунные заболевания, хронические проблемы с пищеварением, такие как колит, СРК, запор и/или диарея, фибромиалгия, кожные заболевания, такие как экзема, акне, кожный зуд и крапивница, проблемы с печенью, головные боли (в том числе хронические), дисбаланс прогестерона и эстрогена и связанные с этим проблемы с гормонами, проблемы с астмой, изменения артериального давления, отрыжка, неприятный запах изо рта и инфекции полости рта, грибок ногтей на ногах, боли в суставах, снижение полового влечения, усталость после еды и многие другие.

    Как плохие парни заражают ваш кишечный газон

    Некоторые из наиболее распространенных «плохих парней» включают дрожжи (Candida albicans), Klebsiella, Proteus, H. pylori, Giardia, Pseudomonas, Citrobacter и Cryptosporidia и другие. Дисбактериоз часто возникает после длительных периодов слабого или нарушенного пищеварения. Когда пищеварение нарушено, уровень соляной кислоты, пепсина или пищеварительных ферментов поджелудочной железы низкий, и они не могут стерилизовать пищу, когда она попадает в организм. Как это часто бывает с пожилыми пациентами, это позволяет крабовому сорняку начать засевать ваш кишечник.

    Другие причины кишечного дисбиоза включают ослабленный иммунитет, изменения рН кишечника, инфекции и воздействие химических веществ. Тонкий кишечник обычно относительно свободен от чрезмерного бактериального роста, но плохие парни также могут колонизировать эту область. По мере усиления аномального брожения начинают проявляться такие симптомы, как газы, вздутие живота и диарея. Со временем, когда слизистый барьер разрушается, токсины попадают в кровоток, и могут появиться симптомы аллергии, потеря ясности ума, умеренная или сильная усталость, воспаление и мышечная боль.Это очень реальная и разочаровывающая проблема для пациентов, которую обычные врачи часто упускают из виду. В тяжелых случаях это может быть даже изнурительно. Например, как я уже говорил, это одна из скрытых причин синдрома хронической усталости.

    Чрезмерное использование антибиотиков может уничтожить популяцию бактерий «хороших парней», что создаст благоприятную среду для роста росички «плохих парней». Молочницу и подобные кишечные инфекции часто легко диагностировать, когда у пациентов выделяется необычно высокий уровень газов, что часто приводит к резкому растяжению желудка.Эти инфекции также могут привести к тому, что пациенты просыпаются ночью с чувством сильного жара, как если бы они испытывали длительные приливы. Тепло, выделяемое вредными организмами, также может воспламенять и сушить кишечник, вызывая запор.

    Хорошие парни дают отпор

    Бактерии хорошего парня, особенно Lactobacillus acidophilus, Bifidobacteria и Escherichia coli, обычно населяют толстую кишку. Эти виды бактерий использовались в качестве лекарств (в форме таблеток) с момента открытия их полезных свойств в 1908 году.Они традиционно содержатся в ферментированных продуктах, таких как йогурт и суп мисо, и исторически их хвалят за их многочисленные преимущества для здоровья.

    Лактобациллы и бифидобактерии прикрепляются к клеткам кишечного эпителия и способствуют равновесию кишечной флоры. Поскольку они положительно действуют, их называют пробиотиками (против жизни), а не антибиотиками (против жизни). Они помогают конъюгировать желчные кислоты и противодействовать другим бактериям, особенно вредным, которые могут привести к токсемии кишечника, предвестнику кожных заболеваний, рака, усталости и различных форм воспалений.Они также снижают заболеваемость кишечными инфекциями, диареей и инфекциями мочевыводящих путей (ИМП).

    [стиль разделителя=”1″ выравнивание=”центр” размер=”нормальный” вариант=”нормальный” размер=”1px” цвет=”#D30056″ прокруткатекст=””]Политика[/divider]
    Пожалуйста, предоставьте любезность позвоните, чтобы отменить по крайней мере за 24 часа. Встречи, отмененные менее чем за 24 часа, подлежат оплате за отмену. Все продажи являются окончательными по продуктам и услугам.

    Оплата в полном объеме производится в момент оказания услуг.

    определение, клинические последствия и предлагаемый протокол лечения (протокол Перротта для клинического ведения кишечного дисбактериоза, PID) для лечения и устранения стойкого или хронического дисбактериоза

    062

    https://www.peertechzpublications.com/journals/archives клинической гастроэнтерологии

    Образец цитирования: Perrotta G (2021) Дисбиоз кишечника: определение, клинические последствия и предлагаемый протокол лечения (Протокол Perrotta для клинического ведения

    Дисбиоз кишечника, PID) для лечения и разрешения персистирующих или хронических дисбактериоз.Arch Clin Gastroenterol 7(2): 056-063.

    DOI: https://dx.doi.org/10.17352/2455-2283.000100

    55. Perrotta G (2019)–Биполярное расстройство: определение, дифференциальный диагноз, клинические контексты и терапевтические подходы. J Neuroscience and Neurological

    Surgery 5. Ссылка: https://bit.ly/3hKPdqM

    56. Kim HN, Yun Y, Ryu S, Chang Y, Kwon MJ и др. (2018) Корреляция между микробиотой кишечника

    и личность у взрослых: перекрестное исследование.Мозг Бех Имм

    69: 374-485. Ссылка: https://bit.ly/2R7A3Dc

    57. Bauer ME, Teixeira AL (2018) Воспаление при психических расстройствах: что

    стоит на первом месте? Ann NY Acad Sci 1437: 57-67. Ссылка: https://bit.ly/34CUZVM

    58. Kennedy PJ, Murphy AB, Cryan JF, Ross PR, Dinan TG, et al. (2016) Микробиом

    в функции мозга и психическом здоровье. Trends Food Science & Technology 57:

    289-301. Ссылка: https://bit.ly/3iLg1YX

    59.Perrotta G (2020)Пограничное расстройство личности: определение, дифференциальный диагноз, клинический контекст и терапевтические подходы. Ann Psychiatry

    Treatm 4: 043-056. Ссылка: https://bit.ly/3hx2B1N

    60. Perrotta G (2020)Нарциссизм и психопатологические профили: определения,

    клинический контекст, нейробиологические аспекты и клиническое лечение. J Clin Cases

    Rep 4: 12-25. Ссылка: https://bit.ly/2X8wzzF

    61. Perrotta G (2021) Истерическое расстройство личности: определение, клинические профили, дифференциальный диагноз

    и терапевтическая основа.Arch Community Med

    Общественное здравоохранение 7: 001-005. Ссылка: https://bit.ly/3cuga0H

    62. Perrotta G (2021)Состояние сознания: от перцептивных изменений

    к диссоциативным формам. Определяющий, нейробиологический и клинический профили. J Neuro

    Neurol Sci Disord 7: 006-018. Ссылка: https://bit.ly/2P9JVvf

    63. Perrotta G (2021) Избегающее расстройство личности: определение, клинические и

    нейробиологические профили, дифференциальный диагноз и терапевтическая основа.J

    Neuro Neurol Sci Disord 7: 001-005. Ссылка: https://bit.ly/3p5S9SP

    64. Settani CR, Ianiro G, Bibbò S, Cammarota G, Gasbarrini A (2021) Кишечная микробиота

    изменение и модуляция при психических расстройствах: современные данные о фекальной

    микробиоте трансплантация. Prog Neuropsychopharmacol Biol Psychiatry 109:

    110258. Ссылка: https://bit.ly/3fWwzfn

    65. Perrotta G (2021) Психологические и иммунобиологические последствия

    Covid-19: возможная корреляция с предыдущими пандемиями и наводит на мысль

    терапевтическая гипотеза реконвалесцентной плазмы.Глоб Дж. Клин Вирол 6: 007-011.

    Ссылка: https://bit.ly/3fWi8b7

    66. Scaldaferri F, Ianiro G, Privitera G, Lopetuso LR, Vetrone LM, et al. (2020)

    Захватывающее путешествие SARS-CoV-2 в кишечник: от патогенеза

    до будущих клинических последствий. Воспаление кишечника Dis 26: 1306-1314. Ссылка:

    https://bit.ly/3p5rQMy

    67. Феррейра С., Виана С.Д., Рейс Ф. (2020) Является ли дисбактериоз кишечной микробиоты предиктором

    повышенной восприимчивости к неблагоприятному исходу у пациентов с Covid-19? Обновление.

    Микроорганизмы 9: 53. Ссылка: https://bit.ly/3x5yPr1

    68. Perrotta G (2021) Пандемия Covid-19: все возможные эффективные решения

    искоренить проблему. Поперечный анализ клинического, социально-экономического,

    политического и психологического профилей. Arch Community Med Public Health 7: 099-

    110. Ссылка: https://bit.ly/3BxkNSI

    69. Iebba V (2018) Il microbiota. Un nuovo mondo inesplorato. Кароччи Эд, Рома.

    70. Оттман Н., Смидт Х., де Вос В.М., Белзер С. (2012) Функция нашей микробиоты:

    кто там и что они делают?.Front Cell Infect Microbiol 2: 104. Ссылка:

    https://bit.ly/2WjWojk

    71. Meng X, Zhang G, Cao H, Yu D, Fang X и др. (2020)Дисбактериоз кишечника и

    кишечных заболеваний: механизм и лечение. J Appl Microbiol 129: 787-805.

    Ссылка: https://bit.ly/3y5pdOz

    72. Saffouri GB, Shields-Cutler RR, Chen J, Yang Y, Lekatz HR, et al. (2019)

    Микробный дисбактериоз тонкой кишки лежит в основе симптомов, связанных

    с функциональными желудочно-кишечными расстройствами.Nat Commun 10: 2012. Ссылка:

    https://go.nature.com/2VggRFi

    73. Candido TLN, Bressan J, Alfenas RCG (2018)Дисбиоз и метаболический

    эндотоксемия, вызванная диетой с высоким содержанием жиров. Нутр Хосп 35: 1432-1440. Ссылка:

    https://bit.ly/3kTGRAO

    74. Ghibbar R, Dieleman AL (2019) Микробиота кишечника при глютеновой болезни и пробиотики

    . Питательные вещества 11: 2375. Ссылка: https://bit.ly/3kUXSKV

    75. Seon-Kyun K, Guevarra RB, Kim YT, Kwon J, Kim H, et al.(2019) Роль пробиотиков

    в заболеваниях, связанных с микробиомом кишечника человека. J Microbiol

    Biotechnol 29: 1335-1340. Ссылка: https://bit.ly/2VdIlG

    76. Тохо Р., Суарес А., Клементе М.Г., де лос Рейес-Гавилан К.Г., Марголлес

    А и др. (2014) Кишечная микробиота в норме и при болезнях: роль

    бифидобактерий в гомеостазе кишечника. World J Gastroenterol 20: 15163-76. Ссылка:

    https://bit.ly/3zD8K4a

    77. Tsai YL, Lin TL, Chang CJ, Wu TR, Lai WF, et al.(2019) Пробиотики, пребиотики

    и облегчение заболеваний. J Biomed Sci 26: 3. Ссылка: https://bit.ly/3BF1qH8

    78. Costantini L, Molinari R, Farinon B, Merendino N (2017) Влияние

    омега-3 жирных кислот на микробиоту кишечника. Int J Mol Sci 18: 2645. Ссылка:

    https://bit.ly/3i1A5Y4

    79. Gagliardi A, Totino V, Cacciotti F, Iebba V, Neroni B, et al. (2018) Восстановление

    экосистемы кишечной микробиоты. Int J Environ Res Public Health 15: 1679.Ссылка:

    Ссылка: https://bit.ly/2V5yM1b

    80. Liu J, Liu X, Xiong XQ, Yang T, Cui T et al. (2017) Влияние добавок витамина А

    на микробиоту кишечника у детей с расстройствами аутистического спектра

    — пилотное исследование. BMC Microbiol 17: 204. Ссылка: https://bit.ly/3y4UwZz

    81. Cantorna MT, Snyder L, Arora J (2019) Витамин A и витамин D

    регулируют микробную сложность, барьерную функцию и слизистую оболочку. иммунные ответы на

    обеспечивают кишечный гомеостаз.Crit Rev Biochem Mol Biol 54: 184-192. Ссылка:

    https://bit.ly/3iSR3aq

    82. Sirisinha S (2015) Плейотропная роль витамина А в регуляции иммунитета

    слизистых оболочек. Asian Pac J Allergy Immunol 33: 71-89. Ссылка: https://bit.ly/36ZK89B

    83. Li Y, Luo ZY, Hu YY, Bi YW, Yang JM и др. (2020)Кишечная микробиота регулирует

    аутоподобное поведение, опосредуя гомеостаз витамина B 6 у мышей

    с дефицитом EphB6. Микробиом 8: 120. Ссылка: https://bit.ly/3i2RDTu

    84. LeBlanc JG, Milani C, de Giori GS, Sesma F, van Sinderen D, et al. (2013)

    Бактерии как поставщики витаминов своему хозяину: перспектива кишечной микробиоты. Curr

    Опин Биотехнолог 24: 160-168. Ссылка: https://bit.ly/3eUt9tV

    85. Jiang S, Zhu Q, Mai M, Yang W, Du G (2020) Витамин B и витамин D как

    модуляторов микробиоты кишечника у людей с избыточным весом. Int J Food Sci Nutr 71:

    1001-1009. Ссылка: https://bit.ly/3x9ubIt

    86.Ратайчак А.Е., Шимчак-Томчак А., Скшипчак-Зелиньска М., Рихтер А.М.,

    Завада А. и др. (2020) Дефицит витамина С и риск остеопороза

    у пациентов с воспалительным заболеванием кишечника. Питательные вещества 12: 2263. Ссылка:

    https://bit.ly/3rAdo0e

    87. Ikeda S, Takahashi S, Suzuki N, Hanzawa F, Horio F, et al (2020) Gut

    Микробиота не участвует в Индукция экспрессии белков острой фазы

    , вызванная дефицитом витамина С.J Nutr Sci Vitaminol (Токио) 66: 19-23. Ссылка:

    https://bit.ly/2WppZYN

    88. Sassi F, Tamone C, D’Amelio P (2018) Витамин D: питательное вещество, гормон и иммуномодулятор

    . Питательные вещества 10: 1656. Ссылка: https://bit.ly/2UPW63h

    89. Риччио П., Россано Р. (2018) Диета, микробиота кишечника и витамины D + A при множественном склерозе

    . Нейротерапия 15: 75-91. Ссылка: https://bit.ly/3y5pIIr

    90. Choi Y, Lee S, Kim S, Lee J, Ha J и др. (2020) Потребление витамина Е (α-токоферол)

    влияет на состав микробиоты кишечника.Int J Food Sci Nutr 71:

    221-225. Ссылка: https://bit.ly/372SsFQ

    91. Shabbir U, Rubab M, Daliri EB, Chelliah R, Javed A, et al (2021) Куркумин,

    Кверцетин, катехины и метаболические заболевания: роль кишечника Микробиота.

    Питательные вещества 13: 206. Ссылка: https://bit.ly/2VczWYC

    Как дисбиоз может повлиять на здоровье вашего кишечника

    Жизнь в гармонии касается не только вашего внешнего окружения, но и вашего внутреннего сообщества. Ваша кишечная флора может быть как в балансе, так и в дисбалансе — последнее из них мы называем дисбиозом.Поддержание счастливого микробиома имеет решающее значение для того, насколько счастливым вы себя чувствуете. Узнайте, что вызывает дисбактериоз, и что вы можете сделать, чтобы проверить и вылечить его.

    В вашем кишечнике больше микробов, чем клеток в вашем теле, поэтому очень важно поддерживать баланс между «полезными» и вредными бактериями. Когда это равновесие нарушается, это может привести к дисбактериозу и вызвать ряд негативных последствий для здоровья. Узнайте все о дисбактериозе, о том, как распознать его симптомы и что вы можете сделать для его лечения и предотвращения.

    Что означает дисбактериоз и как он может повлиять на кишечник?

    Дисбактериоз — это медицинский термин, обозначающий микробный дисбаланс в организме или на его поверхности, который может отрицательно сказаться на здоровье 1 .

    Это изменение происходит с микробиомом, представляющим собой совокупность всех микроорганизмов, живущих на теле человека или внутри него. Однако чаще сообщается о дисбактериозе в желудочно-кишечном тракте – желудке и кишечнике. Более того, разнообразие, баланс и симбиотические взаимодействия между этими микроорганизмами имеют решающее значение для хорошего здоровья.

    Например, наличие большего количества одних микробов и недостаточного количества других или отсутствие разнообразия среди различных типов микроорганизмов, составляющих микробиом, может привести к дисбактериозу.

    Дисбактериоз — это медицинский термин, обозначающий микробный дисбаланс в организме или на нем, который может негативно сказаться на здоровье 1 .

    Несколько факторов могут нарушить этот тонкий баланс между количеством и разнообразием полезных микробов в организме. Это может быть вызвано определенными состояниями, заболеваниями, неправильным питанием, паразитами, стрессом или даже некоторыми лекарствами, такими как антибиотики 2 .Дисбактериоз тесно связан с синдромом раздраженного кишечника (СРК) и SIBO (избыточный бактериальный рост в тонкой кишке), однако неизвестно, является ли он причиной или следствием. К сожалению, дисбактериоз кишечника имеет расплывчатые симптомы, которые часто упускают из виду и не диагностируют, несмотря на его важность, поскольку несбалансированный кишечник может серьезно повлиять на вашу повседневную жизнь.

    Дисбактериоз связан с несколькими состояниями

    Установлено, что дисбактериоз играет роль в ряде проблем со здоровьем.Однако не совсем понятно, что это за роль. Предполагается, что тонкий баланс бактерий в кишечнике может влиять на иммунитет, напрямую влияя на здоровье слизистой оболочки кишечника. Здоровая оболочка кишечника обладает некоторой проницаемостью, позволяя питательным веществам проходить через кишечник, сохраняя при этом барьерную функцию, отфильтровывая вредные вещества от попадания в организм (и, возможно, вызывая воспаление). Действительно, дисбиоз был связан со следующими заболеваниями: 3-5

      • воспалительные заболевания кишечника (IBD)
      • синдром раздраженного кишечника (IBS)
      • Тип II диабет
      • Ожирение
      • Селиакальная болезнь

      Что вызывает Дисбактериоз?

      Действуют несколько внешних факторов.

      Диета

      Изменения в диете, такие как увеличение количества обработанных пищевых продуктов, сахара, насыщенных жиров и животных белков, могут привести к дисбактериозу. Типичная западная диета с высоким содержанием насыщенных жиров, животного белка и сахара чаще коррелирует с дисбактериозом 6 .

      Образ жизни

      Малоподвижный образ жизни без физических упражнений, а также курение, употребление алкоголя и высокий уровень стресса повышают риск развития дисбактериоза 5 .

      Использование антибиотиков

      Антибиотики могут убивать многие полезные кишечные бактерии, впоследствии вызывая дисбаланс микробиома кишечника 2 . Злоупотребление антибиотиками также может привести к разрастанию условно-патогенных бактерий и грибков и вызвать инфекции кожи, половых органов и желудочно-кишечного тракта.

      Паразиты

      Паразиты, вирусы и грибки также могут вызывать нарушения в нашей микробиоте 7 . Они часто вызваны загрязненной водой и пищей, а также заболеваниями, передающимися половым путем.Наиболее распространенным паразитарным заболеванием является разрастание Candida, что приводит к инфекции. Обычно это происходит с вагинальной флорой, когда нарушается уровень наших старых добрых друзей-бактерий Lactobacillus . Некоторые факторы риска заражения паразитарной инфекцией включают отсутствие санитарных условий и чистой воды, купание в озерах и наличие домашних животных, которые часто остаются на улице.

      В зависимости от паразита симптомы могут сильно различаться. Некоторые могут быть видимыми изменениями и симптомами в области гениталий в случаях паразитов, передающихся половым путем, другие могут варьироваться от диареи, внезапной потери веса, тошноты, обезвоживания, гриппоподобных симптомов, крайней усталости, болей в животе и лихорадки 8 .

      Избыточный бактериальный рост в тонкой кишке (SIBO)

      SIBO — это состояние, при котором в тонкой кишке содержится избыточное количество бактерий, ответственных за всасывание питательных веществ 9 . Это проблематично, поскольку вместо этого эти микроорганизмы должны жить в толстой кишке, где находится микробиом. Когда пища недостаточно хорошо продвигается по тонкому кишечнику, это может привести к росту бактерий. Если полезные бактерии, которые помогают вам переваривать пищу, не могут угнаться за «плохими» бактериями, это может привести к быстрому размножению вредных бактерий и привести к СИБР.

      Неинвазивные дыхательные тесты широко используются для выявления SIBO, а именно дыхательные тесты на глюкозу и лактулозу, которые проверяют содержание водорода и метана соответственно 10 . вводящий в заблуждение результат 11 . Тем не менее, существует количественный тест, известный как посев аспирата из тощей кишки, который до сих пор считается золотым стандартом диагностики этого состояния 12 .

      Симптомами СИБР в основном являются боль в животе, утомляемость, вздутие живота, диарея и запор. Однако многие другие состояния могут вызывать эти симптомы. Если у вас есть SIBO, и он ухудшается, ваш тонкий кишечник не сможет поглощать достаточное количество питательных веществ. Это, в свою очередь, может привести к дополнительным симптомам, таким как анемия и потеря веса.

      Как проверить на дисбактериоз?

      Как и при СРК, на самом деле не существует теста или специального диагностического инструмента для дисбактериоза. Обычно врач оценивает вашу историю болезни, проводит физические осмотры и тесты, чтобы исключить другие сопутствующие состояния в зависимости от ваших симптомов и того, как вы реагируете на определенные виды лечения.

      Некоторые тесты включают визуализирующие и эндоскопические тесты (например, колоноскопия, компьютерная томография), лабораторные тесты, такие как непереносимость лактозы и глютена, дыхательные тесты (обычно используемые для проверки на SIBO) и тесты кала.

      Могу ли я проверить дисбактериоз с помощью GUTXY?

      Наши отчеты о состоянии здоровья не диагностируют состояния здоровья, в том числе дисбактериоз, и не заменяют консультацию врача. Наши тесты предназначены для тех, кто хочет больше узнать о своем теле и здоровье своего кишечника.

      Однако некоторые поставщики медицинских услуг используют тесты микробиома в дополнение к стандартным инструментам диагностики.С помощью наших тестовых наборов вы можете получить общее представление о состоянии своего микробиома. Используя технологию секвенирования, наша команда составляет подробный аналитический отчет о разнообразии, богатстве и балансе между различными микробами в вашем кишечнике. Кроме того, если вы выберете нашу программу RESET, вы сможете получить индивидуальный план диеты, адаптированный к вашему собственному уникальному микробиому, специально предназначенный для облегчения вашего желудка, а также множество других советов.

      К сожалению, исследования кишечника все еще находятся на очень ранней стадии, и тесты микробиома (пока) не признаны в качестве инструмента диагностики.Поэтому, прежде чем вносить какие-либо серьезные изменения в образ жизни, вы всегда должны сначала проконсультироваться со специалистом в области здравоохранения! Мы даже предлагаем свои личные консультации по микробиому. Свяжитесь с нами, если хотите узнать больше.

      Лечение дисбактериоза

      Большая часть лечения будет зависеть от тяжести ваших симптомов и того, насколько хорошо вы на них реагируете. В современной медицинской практике диагностика и лечение назначаются по сравнению с населением в целом, и ваши собственные уникальные особенности, такие как ваш микробиом, скорее всего, игнорируются.

      Однако исследователи прогнозируют, что в ближайшем будущем врачи будут анализировать ваш микробиом и назначать лечение в соответствии с особенностями вашего кишечника в качестве формы персонализированной медицины 13 .

      Между тем, вы можете контролировать, что вы едите. Переход на здоровую диету в сочетании с активным образом жизни и отказом от продуктов, которые вызывают у вас раздражение, — это, как правило, способ начать.

      Изменение диеты и образа жизни

      Диета может оказать сильное влияние на кишечную флору.Вот несколько вещей, которые вы можете попробовать:

      • Избегайте собственных уникальных триггеров. Ведите пищевой дневник и отслеживайте свои симптомы. Вместе со специалистом по питанию вы сможете выяснить, как лучше составить свой рацион.
      • Уменьшить потребление FODMAPS. Недавнее исследование диеты с низким содержанием FODMAP указывает на улучшение симптомов по крайней мере у 50% пациентов с СРК 14 .
      • Избегайте SAD-диет. Диеты западного типа связаны с меньшим разнообразием микробиома 6 .В этой диете продукты, которых следует избегать, включают в основном молочные продукты, обработанное мясо, белый хлеб, насыщенные жиры и рафинированный сахар.
      • Избегайте употребления алкоголя и курения.
      • Попробуйте техники осознанности.

      Пробиотики

      «Пробиотическая терапия была предпринята попытка изменить проявление заболевания путем благоприятного изменения бактериального состава, иммунного статуса и воспаления 4 ».

      Вы, наверное, слышали о пробиотиках — живых бактериях и дрожжах, которые приносят многочисленные преимущества для здоровья, улучшая состав кишечного микробиома.
      Появляются данные, свидетельствующие о том, что добавление пробиотиков может облегчить симптомы, связанные с дисбактериозом и СРК 15 . Однако до сих пор неясно, какая конкретная комбинация штаммов является наиболее эффективной, отчасти потому, что ваш микробиом уникален.

      Трансплантация фекальной микробиоты (ТФМ)

      В последнее время большое внимание уделяется трансплантации фекальной микробиоты (ТФМ). ТФМ – введение раствора фекалий здорового донора в толстую кишку реципиента с целью восстановления несбалансированного микробного состава16.Этот подход оказался успешным при лечении рецидивирующей инфекции Clostridium difficile 17 , однако необходимы дополнительные доказательства, чтобы доказать его общую долгосрочную эффективность и безопасность, чтобы этот процесс стал стандартизированным лечением дисбактериоза.

      Лекарства

      Использование некоторых антибиотиков все еще нуждается в дополнительном подтверждении, хотя сообщалось об обнадеживающих результатах применения рифаксимина 16 , антибиотика широкого спектра действия, мало влияющего на кишечную флору.

      Заключительные соображения

      Равновесие и разнообразие между различными микробами в вашем кишечнике имеют решающее значение для здорового образа жизни. Дисбактериоз может быть временным дисбалансом и может быть корнем или следствием заболевания кишечника. Поэтому важно прислушиваться к своей интуиции, чтобы как можно скорее вмешаться и избежать серьезных осложнений. Также имейте в виду, что очень важно принимать антибиотики только под наблюдением врача.

    Добавить комментарий

    Ваш адрес email не будет опубликован.