Двухсторонний фронтит: ᐈ Что такое фронтит? ~ 【Симптомы и лечение】

Содержание

причины, симптомы, методы диагностики и лечения фронтита. Острая и хроническая формы фронтита

Фронтит – это разновидность синусита (воспаления слизистой оболочки околоносовых пазух), а именно — воспаление слизистой оболочки лобной пазухи.

Лобных пазух у нас две. Они располагаются в толще лобной кости над глазницами, сзади надбровных дуг. Пазухи отделены друг от друга костной перегородкой, которая часто отклоняется в ту или иную сторону от средней линии, поэтому лобные пазухи, как правило, несимметричны. Нижняя стенка лобной пазухи является верхней стенкой глазницы, а задняя стенка отделяет пазуху от лобных долей головного мозга. Лобные пазухи связаны с носовой полостью лобно-носовым каналом, который проходит через передние отделы решетчатого лабиринта. Поэтому фронтит редко развивается как изолированное заболевание, а чаще сочетается с этмоидитом (воспалением слизистой оболочки решетчатого лабиринта).

Лобные пазухи при рождении отсутствуют, формируясь, как правило, лишь к 7-8 годам. Именно с этого возраста становится возможным развитие фронтита.

Фронтит обычно протекает тяжелее других синуситов. Различают односторонний и двусторонний фронтит, в зависимости от того, воспалена ли только одна или обе пазухи.

Причины фронтита

Обычно фронтит развивается на фоне сильного насморка (острого или хронического). Насморк может быть вызван проникновением инфекции (грипп, ОРВИ), а может иметь аллергическую природу (аллергический ринит). Воспаление в носовой полости приводит к отеку слизистой оболочки. При этом отеки перекрывают соустья пазух, в результате чего нормальный отток выделений слизистой из пазух нарушается. Также к нарушению оттока слизи из пазух приводит искривление носовой перегородки (как врожденное, так и приобретенное, например, в результате травмы). У детей этому могут способствовать также и аденоиды (разрастания ткани носоглоточной миндалины).

Если дренаж лобной пазухи нарушен, при проникновении в пазуху инфекции в ней развивается локальный воспалительный процесс. Количество выделяемого секрета резко увеличивается. Отекает слизистая самой пазухи, что ещё больше затрудняет естественную эвакуацию слизи из пазухи.

Инфекция в лобную пазуху обычно попадает из носоглотки. Если в организме существует очаг хронической стафилококковой инфекции, то инфекция с током крови может быть перенесена и оттуда. Существенное значение имеет и уровень иммунитета: ослабленный иммунитет повышает вероятность развития фронтита. В этом случае каждый сильный насморк может грозить подобным осложнением.


Симптомы фронтита

Различают острую и хроническую форму заболевания.

Острый фронтит причиняет больному серьёзное беспокойство. Если лечение фронтита осуществлялось недолжным образом, заболевание может перейти в хроническую форму. Симптоматика хронического фронтита более сглажена.

Симптомы острого фронтита

При остром фронтите характерны следующие симптомы:

  • боль в области лба. Обычно резкие боли начинаются в 10-12 часов утра и постепенно стихают к 15-16 часам дня.  Это связано с переменой положения. Боль возникает с некоторой задержкой как реакция на переход в положение стоя после ночного сна.
  • Затруднение носового дыхания, выделения из носа слизистого или гнойного характера.
  • Может подниматься температура – до 38-39°C.
  • Иногда наблюдается припухлость и отечность лба и верхнего века на стороне поражённой пазухи.
  • В тяжелых случаях могут быть боль в глазах, слезотечение, светобоязнь.

Симптомы хронического фронтита

При хроническом фронтите могут наблюдаться следующие симптомы:

  • боль. Вне периода обострения боль при хроническом фронтите не отличается интенсивностью. Характерной является тупая давящая боль в области лба на стороне пораженной пазухи. Боль усиливается к вечеру, после физического напряжения, а также при длительном наклоне головы. Однако отсутствие выраженной боли ещё не означает полного выздоровления, боль может отсутствовать, если нет препятствий для оттока выделений из пазухи, однако очаг воспаления в пазухе при этом может сохраняться;
  • выделения из носа. Обычно патологическое содержимое из лобовой пазухи отхаркивается в виде мокроты утром, при переходе больного в вертикальное положение;
  • затруднение носового дыхания. В некоторых случаях отмечается снижение обоняния.

Методы диагностики фронтита

Диагностика хронического фронтита и контроль состояния лобных пазух осуществляется с помощью инструментальных методов, – прежде всего, рентгенографии околоносовых пазух, а в тех случаях, когда использование рентгеновского излучение нежелательно, с помощью УЗ-диагностики.

Рентгенография носовых пазух

УЗИ лобных пазух

Ультразвуковое исследование лобных пазух может быть осуществлено с помощью Синускана – прибора ЛОР экспресс-диагностики прямо на приёме врача.

Чтобы точно продиагностировать заболевание, запишитесь на прием к специалистам сети «Семейный доктор».

Методы лечения фронтита

При фронтите в случае неблагоприятного течения болезни возможны серьёзные осложнения. Это обусловлено расположением лобных пазух. Если не обеспечить правильного лечения фронтита, воспаление может перейти на костную стенку пазухи, а впоследствии – к воспалению тканей глазницы, менингиту или вызвать образование свища, – в зависимости от того, какая из стенок будет поражена – нижняя, задняя или передняя.

Своевременное обращение к врачу позволит избежать перехода заболевания в хроническую форму и исключить возможность развития осложнений.

Лечение фронтита – задача по-своему непростая. Необходимо добиться полного устранения воспаления в лобной пазухе. При прекращении болей в области лба можно подумать, что болезнь побеждена, однако важно быть уверенным, что воспаление действительно прекратилось. Иначе при первом похолодании боли вернуться снова. Поэтому лечение фронтита должен осуществлять врач, – с применением инструментальных методов диагностики.

Консультация специалиста

При появлении симптомов фронтита Вы можете обратиться к врачу-отоларингологу в любую из поликлиник «Семейного доктора». Врачи АО «Семейный доктор» диагностируют заболевание и назначат наиболее эффективное лечение.

Курс лечения фронтита может включать в себя в себя применение препаратов сосудосуживающего действия, антибиотиков, тепловые процедуры, физиотерапию, санацию пазух с помощью синус-катетера ЯМИК (катетер очищает пазухи за счет создаваемой разницы давления).

Не занимайтесь самолечением. Обратитесь к нашим специалистам, которые правильно поставят диагноз и назначат лечение.

Фото и видео галерея

Оцените, насколько был полезен материал

Спасибо за оценку

 

Похожие заболевания

Все заболевания

Симптомы и лечение фронтита в домашних условиях у взрослых и детей

Фронтит – часто встречающееся заболевание среди взрослых и детей, связанное с воспалением лобных пазух носа. Болезнь сопровождается высокой температурой, затрудненным дыханием и слизистыми выделениями из носа. При отсутствии адекватного лечения возможны осложнения.

Виды фронтита

При первых симптомах фронтита требуется выявить форму заболевания, классификация осуществляется на основе локализации, характера течения или этиологии.

В зависимости от локализации, фронтит может быть двусторонний или только в одной из пазух носа.

Это заболевание по характеру своего течения может быть острым или хроническим. Более того, фронтит может быть продуктивный (с развитием полипов и кистоз), а также экссудативный (в основе находится развитие катарального процесса или гноения).

Болезнь может быть спровоцирована на основе следующих факторов:

  • В виде осложнения аллергической реакции или на фоне размножения бактерий;
  • В результате получения травмы или попадания вируса в дыхательные пути;
  • Как результат развития грибковой инфекции или же реакции на применение определенных медикаментов.

Причины появления фронтита

Прежде, чем начинать лечение фронтита в домашних условиях, нужно уточнить причину заболевания. Заболевание у взрослых и детей может появиться в результате:

  • Переохлаждения организма или попадания мелких предметов в дыхательные пути, что часто случается с детьми;
  • Развития инфекции в организме, где возбудителем могут быть бактерии и вирусы;
  • Искривления носовой перегородки или же на фоне появления и развития полипов и аденоидов.

Симптомы фронтита у взрослых

Лечение фронтита в домашних условиях требует обращения внимания на симптоматику. К признакам развития заболевания в острой форме необходимо отнести:

  • Высокую температуру тела и затрудненное дыхание;
  • Болевые ощущения в области лба и висков;
  • Мокроту при откашливании по утрам;
  • Появление выделений из носа прозрачного цвета с неприятным запахом.

При развитии болезни в хронической форме к указанным выше признакам могут добавиться:

  • Сильные головные боли и головокружение;
  • Отеки в области лба и утрата обоняния;
  • Высокая температура и светобоязнь.

Осложнения фронтита

Как лечить фронтит дома – частый вопрос, которым задаются взрослые. Действительно, данное заболевание требует лечения по причине рисков, связанных с осложнениями. Лечение заболевания должно осуществляться комплексно до полного исчезновения его признаков.

Наиболее частым осложнением при фронтите является менингит, абсцесс века, сепсис, остеомиелит и другие патологии. Сложным может быть течение заболевания у лиц со сниженным иммунитетом или при наличии иных хронических заболеваний.

Профилактика и лечение фронтита в домашних условиях медицинскими аппаратами «Солнышко»

Общие меры профилактики фронтита можно свести к следующим правилам:

  • Своевременно и в соответствии с рекомендациями врача проходить курсы лечения инфекционных и вирусных заболеваний;
  • Принимать меры для укрепления иммунитета, используя для этого витаминотерапию, закаливание, поддержание здорового образа жизни;
  • Одеваться по сезону для предупреждения переохлаждения организма.

Теперь остановимся на том, как лечить фронтит. Взрослым и детям будет эффективно использовать в курсе лечения медицинский аппарат «Солнышко». Их производством и выпуском занимается одноименная компания. Основным направлением деятельности компании является выпуск облучателей, приборов и аппаратов, применяемых в физиотерапии.

Конкретно для лечения фронтита подходят следующие аппараты в линейке производителя:

  • ОУФв-02 – ультрафиолетовый облучатель для лечения заболеваний верхних дыхательных путей, вирусных и бактериальных инфекций полости рта и носоглотки. В комплекте представлены защитные очки и биодозиметр. Прибор питается от сети и поставляется с инструкцией;
  • ОУФД-01 – ультрафиолетовый облучатель для лечения заболеваний верхних дыхательных путей, бактериальных и вирусных заболеваний органов дыхания у детей, включая гнойные и воспалительные процессы на коже;
  • ОУФ-10-2 – ультрафиолетовый кварцевый облучатель. Подходит для лечения местных и внутриполостных гнойных, вирусных, бактериальных и других заболеваний.

Профилактика фронтита также может включать в себя применение медицинских аппаратов «Солнышко». К преимуществам использования в лечении фронтита облучателей «Солнышко» необходимо отнести полное соответствие требованиям безопасности, что подтверждается пройденной сертификацией, возможностью использования в домашних условиях на основе инструкции, а также поставку в комплекте с аппаратами средств для защиты органов зрения.

От гайморита до фронтита. К чему приводит недолеченный насморк | Право | Общество

Врачей-отоларингологов столь легкомысленное отношение к риниту возмущает. Многие из тех, кто на «банальные сопли» махнул рукой, потом частенько оказываются на больничной койке с довольно серьезными заболеваниями, среди которых:

Гайморит  – острое воспаление слизистой оболочки верхнечелюстной либо гайморовой пазухи носа, в результате которого развивается отек, препятствующий оттоку скопившейся в пазухе слизи, приобретающей гнойный характер.

Симптомы: Первый симптом заболевания – боль, возникающая при наклоне головы в области надбровья или верхней челюсти и густые, прозрачные выделения из носа. Затем боли усиливаются, переходя в мучительные, хронические мигрени, развивается отек мягких тканей лица в районе пораженной пазухи, повышается температура тела, а выделения из носа становятся мутными и зеленоватыми.

Диагностика: Установить точный диагноз может только врач на основе осмотра, рентгеновского снимка, компьютерной томографии или же диагностического прокола пазух носа.

Лечение: Катаральный гайморит лечат, как правило, антибиотиками. Для уменьшения отека слизистой носа используют сосудосуживающие капли и антигистаминные лекарства. Если болезнь перешла в гнойную форму, самое надежное средство – это прокол пазухи и промывание ее растворами антисептиков с последующим введением антибиотиков. Дополнительно применяются физиопроцедуры: УВЧ, УФО, лазеротерапия.

Фронтит  – воспаление слизистой оболочки лобной пазухи, которое может перейти в риногенный менингит, когда в воспалительный процесс вовлекаются мозговые оболочки.

Симптомы: Как правило, в остром периоде заболевший чувствует боль в районе лба, которая становится сильнее при надавливании либо при постукивании. Больные жалуются на слезотечение, проблемы с носовым дыханием, сильные (сначала серозные, а потом серозно-гнойные) выделения из носа.

Диагностика: Врач-отоларинголог ставит диагноз «фронтит» на основании инструментального и рентгенологического исследования с подтверждением лабораторных данных (микробиологическое исследование выделений из носа).

Лечение: Похоже на лечение прочих воспалений пазух носа. Обычно сочетают медикаментозные препараты (анальгетики и антибиотики) и отсасывание гноя и воспаленной слизи с помощью пункции («прокола») или с применением синус-катетера ЯМИК, который создает управляемое (то положительное, то отрицательное) давление, помогающее откачивать гной из пазухи и удалять его шприцем. Иногда к лечению подключают микроволновую или УВЧ-терапию.

Этмоидит  – острое или хроническое воспаление слизистой оболочки одной из придаточных пазух носа – ячеек решетчатой кости, чреватое разрушением части костных стенок решетчатого лабиринта с прорывом гноя в глазницу или в полость черепа.

Симптомы: Головная боль, боль в области корня носа и переносицы, затруднение носового дыхания, снижение обоняния или его отсутствие, повышение температуры тела, обильные серозные выделения из носа.

Диагностика: Диагностика острого этмоидита основывается на клинических признаках и данных рентгенологического исследования.

Лечение: В первые дни болезни обеспечивают отток отделяемого с помощью введения в полость носа сосудосуживающих средств, способствующих уменьшению отека слизистой оболочки, назначают обезболивающие средства, антибиотики, а спустя несколько дней при улучшении состояния – физиотерапевтические процедуры.

Оперативное лечение острого этмоидита (вскрытие ячеек решетчатого лабиринта) применяют лишь в случаях крайне тяжелого состояния больного.

Смотрите также:

Фронтит — причины, симптомы и лечение — Медкомпас

Фронтит – это воспалительный процесс, локализующийся в лобной пазухе, которая является придаточной пазухой носа. Воспалительный процесс при данном заболевании развивается в слизистой оболочке, которая выстилает пазуху. 

Симптомы болезни

Симптомы заболевания зависят от характера фронтита – острая и хроническая формы имеют свои особенности.

Основным симптомом острого фронтита являются боли в области лба, которые усиливаются при механическом воздействии на лобную кость. Также заболевание сопровождается головной болью, светобоязнью и слезотечением, болью в глазах. Также пациентов беспокоят обильные выделения из носа, затрудняющие носовое дыхание. Со временем выделения могут приобретать гнойный характер. Также данный процесс может сопровождаться подъемом температуры тела.

Причины болезни

Чаще всего фронтиты развиваются при бактериальной или вирусной инфекции, которая проникает в пазуху вследствие длительно текущего насморка. Синуситы наиболее часто являются осложнением ОРВИ. Также к фронтиту могут приводить травмы носа или околоносовых пазух. 

Диагностика

Для уточнения диагноза фронтит необходимо обратиться к отоларингологу. В начале осмотра врач тщательно расспрашивает о симптомах заболевания, об их развитии. Затем осматривается нос с помощью специальных инструментов.

Для подтверждения диагноза необходимо провести рентгенографию околоносовых пазух. Рентгенологическая картина достаточно специфична: при фронтите определяется скопление в лобной пазухе жидкости или гноя в виде горизонтального уровня.

При хронизации процесса иногда выполняют компьютерную томографию пазух, с целью исключения полипозного процесса в пазухе. 

Осложнения

Чаще всего из осложнений встречаются те, которые связаны с распространением инфекционного процесса на близлежащие области – флегмона глазницы, абсцесс века. Но иногда развиваются и такие грозные осложнения как менингит или абсцесс мозга. 

Лечение болезни

Фронтит поддается консервативному лечению, но требует госпитализации в стационар для наблюдения ЛОР-врачом.

Чтобы уменьшить отек слизистой оболочки и облегчить носовое дыхание назначают сосудосуживающие капли. Обратите внимание, что их нельзя применять более 5-7 дней, так как возможно развитие привыкания.

При острой форме фронтита с повышением температуры, целесообразно назначение антибактериальной терапии, которая подбирается врачом индивидуально.

Из немедикаментозных методов наиболее эффективным является промывание носа при помощи метода перемещения. Для таких промываний лучше использовать растворы с противовоспалительным и антибактериальным свойствами.

Возможно и хирургическое лечение данной патологии – пункция лобной пазухи. Показаниями к данному методу лечения является:

  • Определение на рентгенограмме наличия в пазухе гноя
  • Нарушение оттока из пазухи естественными путями (проявляется сильными головными болями)
  • Отсутствие эффективности от консервативного лечения.

Также при лечении фронтита эффективны такие физиопроцедуры как фонофорез, СВЧ, УВЧ и лазерные лучи, эндоназальный электрофорез. 

Синусит, гайморит, фронтит, этмоидит, сфеноидит. ЯМИК — лечение без прокола

Лечение гайморита, фронтита, этмоидита и сфеноидита без прокола (синус катетер ЯМИК) проводится в клинике «Здоровье 365 г. Екатеринбурга. Синуситы, включая гайморит, занимают первое место среди осложнений, которые дает обычная простуда.

 

Синусит это острое или хроническое воспаление одной или нескольких придаточных пазух носа. При синусите пазухи, прилежащие к носовым ходам воспаляются и отекают. Это приводит к затруднению отхождения слизи, и она накапливается внутри пазухи, создавая благоприятную почву для воспалительного процесса.

 

По месту локализации синуситы подразделяют на:

 

  • Гайморит- воспаление верхнечелюстной придаточной пазухи
  • Фронтит- воспаление лобной придаточной пазухи
  • Этмоидит- воспаление ячеек решётчатой кости
  • Сфеноидит- воспаление клиновидной пазухи

 

Синус катетер ЯМИК или «пункция»?

 

Если стандартная консервативная терапия не дает результата, наши доктора идут на решение проблемы, используя синус-

катетер ЯМИК или «пункцию», то есть прокол носовых пазух.

 

Прокол носовых пазух достаточно неприятен, но иногда необходим. Альтернативой пункции, при лечении гайморита и прочих синуситов, является лечение синус катетером  ЯМИК.

 

Принцип лечения с помощью синус катетера ЯМИК заключается в периодическом создании то отрицательного, то положительного давления в носовом ходу. Чередование отрицательного и положительного давления приводит к откачиванию и эвакуации гнойных накоплений и вследствие этого восстановление дренажной функции носовых каналов. Кроме того, синус-катетер ЯМИК, после очищения полости носа от патологического секрета, дает возможность вводить лекарственные препараты, обладающие лечебным и обеззараживающим эффектами. ЯМИК катетер используется в клинике Здоровье 365 для лечения синуситов у взрослых и у детей, начиная с пятилетнего возраста.

 

Основное преимущество синус катетера ЯМИК это лечение гайморита и других синуситов без прокола, т.е. без боли и без травматизации оболочек полости носа.

 

Применение синус катетера значительно сокращает время на лечение синуситов. Обычно, для получения стойкого эффекта необходимо три — пять процедур. Данный метод используется как на поликлиническом приеме, так и при стационарном лечении.

Лечение синусита по традиционным китайским методикам

Синусит — воспалительное заболевание околоносовых пазух: гайморовой (гайморит), лобной (фронтит), лабиринта решетчатой кости (этмоидит), клиновидной (сфеноидит). Заболевание может затрагивать пазухи лишь на одной стороне (односторонний синусит) или с обеих сторон (двусторонний), а также возможно вовлечение в патологический процесс сразу нескольких пазух.

Читать полностью

Синусит

Причины заболевания

Основная причина возникновения синусита любой локализации — проникновение инфекции из очага в придаточные пазухи. Нередко синусит становится осложнением не пролеченного насморка, гриппа, кори; инфекция может током крови проникать из кариозного зуба, очага воспаления при ангине.

Китайская медицина в качестве причины развития синусита, в первую очередь, рассматривает нарушени е энергетического равновесия на уровне меридиана легких, что влечет за собой воспаление и отек слизистой оболочки, снижение иммунитета. Отечность слизистой также приводит к формированию застоя слизи, нарушения дыхания, обеспечивает условия, благоприятные для развития инфекции.

Острый синусит

Для острой формы заболевания характерно внезапное возникновение на фоне уже существующей простуды, насморка или другого инфекционно-воспалительного процесса. Пациент ощущает недомогание, общую слабость, головную боль, иногда — повышение температуры тела и озноб. В это время возникает ощущение боли и напряжения в пораженной пазухе, нарушение обоняния, а иногда — слуха на стороне патологического процесса, cслезотечение и светобоязнь. Попытки надавить на область проекции пазухи сопровождаются болезненностью, реже возникает отечность тканей лица.

Хронический синусит

Хронический синусит нередко становится следствием запущенного или некачественно пролеченного острого заболевания. При этом симптоматика может быть выражена несколько слабее, чем при остром заболевании, однако требует ничуть не менее пристального внимания. Так, в зависимости от того, какая пазуха поражена хроническим воспалением, у пациента может отмечаться насморк (выделения обильные) или наоборот, повышенная сухость слизистых, головная боль, снижение работоспособности, быстрая утомляемость, из носа или рта может появиться неприятный запах. Реже возникает отечность лица в общем или отдельных его частей.

Верхнечелюстной синусит

Наиболее известное название верхнечелюстного синусита — гайморит. Общими симптомами этого заболевания являются напряжение и боль на стороне поражения, ухудшение носового дыхания и обоняния, выделения из носа слизистого или гнойного характера, слезотечение и светобоязнь. Боль может быть не только сконцентрирована в области пазухи, но и распространяться в области лба и висков. К общим симптомам гайморита относят ухудшение самочувствия, слабость, повышение температуры тела, озноб. Попытки даже легкого нажатия на область гайморовых пазух (у крыльев носа, на переносице и зоны роста бровей) — болезненны. В ряде случаев щека и скулы на стороне воспаления отекшие.

Полипозный синусит

Для этой формы заболевания характерно разрастание в полости носа тканей эпителия и их перерождение в полипозную ткань. При этом основная проблема состоит в том, что разрастающийся полип существенно затрудняет носовое дыхание. Пациент предъявляет жалобы на заложенность носа, снижение обоняния, нередко — болезненность и ощущение инородного тела в полости носа. Присоединение инфекции вместе с нарушенным оттоком содержимого полости носа сопровождается гнойными выделениями. К общим симптомам, беспокоящим пациента, можно отнести головную боль, ухудшение общего самочувствия, нарушение сна и работоспособности. Сегодня для этой формы заболевания европейская медицина предлагает только хирургическое лечение с последующей антибактериальной терапией. К сожалению, это далеко не всегда можно считать залогом полного выздоровления: без восстановления иммунной защиты, без устранения причины заболевание зачастую снова и снова возвращается.

Лечение синусита

Традиционными методами лечения синуситов являются прием антибиотиков и противовоспалительных препаратов, проколы пазух с последующим дренажем полости и удалением гнойного содержимого. Это весьма болезненные и далеко не всегда успешные методы. Многие пациенты хорошо знают, что за первым проколом может последовать второй и третий. В то же время китайская медицина имеет достаточно мощный опыт лечения синуситов без привлечения хирургических методик. В клинике китайской медицины «ТАО» врачи каждому пациенту составляют индивидуальную схему комплексного лечения, учитывающую форму заболевания, степень его развития, общий статус пациента. Для этих целей применяются фитотерапия, иглоукалывание, прогревание полынными сигарами, массаж. Грамотно подобранный комплекс позволяет не просто восстановить энергетический баланс, устранить воспаление и гной без проколов, но и стимулировать естественные факторы иммунной защиты организма, чтобы избавить больного от повторного возникновения синусита и целого комплекса других недугов.

Лечение сальпингоофорита в клинике запись, консультации в Москве, м. Ховрино

Сальпингоофоритом называют гинекологическое заболевание. Воспалительный процесс в яичниках и маточных трубах. Это довольно частое женское заболевание, поражающее органы малого таза. 

Различаются несколько видов заболевания: специфическое и не специфическое. Первое провоцируется занесенными возбудителями, чаще всего переданными половым путем. Второе вызывается микроорганизмами.

При заболевании хронический сальпингоофорит лечение назначается, исходя из характера болезни (острый или хронический) и локализации (односторонний либо двухсторонний).

Гинеколог окажет медицинскую помощь при многих заболеваниях. Полный курс обследования, консультация, анализы. Приходите по адресу: ул. Зеленоградская, д. 39, к. 1, запись по телефону +7 (495) 922-09-09 и  +7 (985) 922-09-09

Хронический сальпингоофорит лечение: что важно помнить

Симптоматика болезни бывает местной или общей. Это означает, что одни проявлениям болезни могут протекать незаметно, а другие – связываться с незначительными заболеваниями. Поэтому при обнаружении следующих симптомов нужно незамедлительно обратиться к врачу. В медицинском центре «М-Вита» работают профессионалы с большим опытом диагностики и лечения данного заболевания. Современное оборудование, собственная лаборатория и профессионализм сотрудников поможет своевременно выявить и излечить недуг.

Местные симптомы болезни:

  • сильная боль в паху;
  • появление слизистых, серозных или гнойных белей;
  • сбои в менструальном цикле;

 

Общие признаки:

  • проявления воспалительных симптомов;
  • заболевания пищеварительной и мочевыделительной систем.

Если рецидивы происходят часто, то сальпингоофорит становится полисистемным: сосудистая, эндокринная и другие системы организма также подвергаются заболеванию.

При данном заболевании хронический сальпингоофорит лечение является целенаправленным и системным. Помимо терапевтических манипуляций и процедур, порой назначается физиотерапия. Максимальную пользу в качестве реабилитационной процедуры приносит санаторное или курортное лечение.

 

Стоимость лечения

Стоимость лечения можно назвать только после проведения всех необходимых исследований, анализов.

Ценовая политика нашего медицинского центра демократична. Мы стремимся помочь каждому пациенту. Наши услуги стоят недорого, при этом их качество остается на высоком уровне. Обращаясь в клинику «М-Вита» г. Москва, можете быть уверены за свое здоровье и его восстановление!

Чтобы записаться на прием к врачу, позвоните нам по указанному телефону или оставьте заявку на обратный звонок. Мы свяжемся с вами менее чем за 30 минут.

Мы находимся в САО, район Ховрино и Дегунино, вблизи метро «Речной Вокзал» и «Петровско-Разумовская».

(3/4 X3 ярда) Walker 1522 прозрачные двусторонние рулонные ленты в рулоне Клейкая опора для мужской системы волос Замена парика / наращивание волос / парик / фронтальная застежка для волос Кружево Для мужчин Система волос Сменный парик / Наращивание волос / Парик / Фронтальная застежка для волос Кружева Ritzkart Продавцы Выберите поставщика

выбратьRitzkart

Валюта

Выберите валюту Индийская рупияДоллар СШАТайский бат

Цена: ₹ 999.00 999,00

«1522 Clear Tape» Walker Двусторонняя рулонная лента Клейкая опора для мужской системы волос Сменный парик / Наращивание волос / Парик / Фронтальная застежка для волос (3/4×3 ярда)

  • 1522 Clear — наша самая популярная лента для повседневной носки.Он известен своей мягкостью на коже.
  • Это инертная лента, поэтому ничто не может вызвать кожную реакцию, что делает эту ленту отличным гипоаллергенным вариантом.
  • Обычно клея хватает на 2-4 недели.
  • Гипоаллергенный для чувствительной кожи
  • Легко наносится и удаляется с кожи.

.

Код продукта: 1522прозрачная лента3/4×3ярда

Описание

1522 Clear — наша самая популярная лента для повседневной носки.Он известен своей мягкостью на коже. Это инертная лента, поэтому ничто не может вызвать кожную реакцию, что делает эту ленту отличным гипоаллергенным вариантом. Эта лента оставляет очень мало следов, что делает ее популярной для повседневного использования. Подложка и подложка белые, но сама лента прозрачная. Не идеально подходит для меш-юнитов, потому что имеет некоторый блеск.

Лента в рулоне 1522 — 3 ярда. Иногда ее называют просто «прозрачной». Это самая распространенная лента, которая идеально подходит для повседневного ношения причесок, накладок и париков. Она менее липкая, чем все другие ленты для замены волос, но все же очень надежна и идеальна для повседневного ношения.Подложка и подложка белые, но сама лента прозрачная. Также известен своей гипоаллергенностью. Ленты для ежедневного ношения (1-7 дней) популярны из-за их повседневного использования. Отлично подходит для клиентов, которые снимают свое устройство ежедневно или каждые несколько дней. Они кажутся менее липкими или липкими, чем другие ленты. Легко очищается любым средством для удаления клея.

Магазин находится в режиме просмотра

Посмотреть полную версию сайта


Необходимо для работы веб-сайта

Поставщик аналитического программного обеспечения

Отмена Сохранить настройки

«Кружевная передняя опора» Walker Двусторонние рулонные ленты Наклейки Клей для мужской системы волос Сменный парик Наращивание волос Пучки париков Плетение волос Закрытие Кружево спереди (12 ярдов и 3/4 дюйма)

Клейкие ленты можно использовать для замены волос, наращивания волос, париков и других изделий для волос.Помимо клея, мы также продаем изделия из человеческих волос. Если у вас есть интерес, свяжитесь с нами.

Стоимость доставки

  • MeekDepot.com.com предлагает БЕСПЛАТНУЮ ДОСТАВКУ ВСЕХ заказов по всей территории США.
  • Посылки отправляются с понедельника по пятницу.
  • Никаких дополнительных комиссий и сборов.

Сроки доставки

Обычное время обработки заказа составляет 24 часа (рабочие дни), но может варьироваться в зависимости от наличия заказанной продукции.Этот период не включает время доставки, которое зависит от вашего географического положения.

Расчетное время доставки:
БЕСПЛАТНАЯ эконом-доставка: 5–8 рабочих дней
Способ доставки зависит от того, что отправляется.

Отслеживание
Все заказы отправляются с номером отслеживания. Как только ваш заказ покинет наш склад, вам будет отправлено электронное письмо с подтверждением и номером отслеживания. Вы сможете отслеживать свою посылку в любое время.

Поврежденная посылка
Если ваша посылка была доставлена ​​в почтовом ящике, обратите внимание, что мы не несем ответственности за любой ущерб, который может возникнуть (последствия экстремальных температур, кражи и т. д.).).

Если у вас есть какие-либо вопросы относительно доставки или вы хотите узнать о статусе заказа, пожалуйста, свяжитесь с нами или напишите нам по адресу [email protected]

Вы можете вернуть большинство новых, невскрытых товаров в течение 30 дней с момента доставки для получения полного возмещения.

Чтобы иметь право на возврат, ваш товар должен быть неиспользованным и находиться в том же состоянии, в котором вы его получили. Он также должен быть в оригинальной упаковке.

Некоторые виды товаров не подлежат возврату.Скоропортящиеся товары, такие как продукты питания, цветы, газеты или журналы, возврату не подлежат. Мы также не принимаем товары интимного или санитарного назначения, опасные материалы, легковоспламеняющиеся жидкости или газы.

Дополнительные невозвратные товары:

  • Подарочные карты
  • Загружаемые программные продукты
  • Некоторые товары для здоровья и личной гигиены

Чтобы завершить ваш возврат, нам требуется номер для отслеживания, который показывает товары, которые вы уже вернули нам.

В некоторых ситуациях предоставляется только частичное возмещение (если применимо)

  • Книга с очевидными следами использования
  • Компакт-диск, DVD, кассета VHS, программное обеспечение, видеоигра, кассета или виниловая пластинка, которые были открыты
  • Любой элемент не в своем первоначальном состоянии, поврежден или отсутствует по причинам, не связанным с нашей ошибкой
  • Любой товар, возвращенный более чем через 30 дней после доставки

Товары, возвращенные нам в результате нашей ошибки, получат полный возврат средств, за некоторые возвраты может взиматься плата за пополнение запасов в размере 7% от общей стоимости товара. Пожалуйста, свяжитесь с сотрудником службы поддержки клиентов, чтобы узнать, подлежит ли ваш возврат .Возвраты, которые прибыли вовремя и соответствуют описанию, облагаются комиссией за пополнение запасов.

Товары, возвращенные нам, которые не были результатом нашей ошибки, в том числе товары, возвращенные нам из-за недействительного или неполного адреса, будут возвращены по первоначальной цене товара за вычетом наших стандартных сборов за пополнение запасов.

Если товар возвращается к нам по любой из следующих причин, к общей сумме возмещения будет применена комиссия за пополнение запасов в размере 15%, и вас попросят оплатить обратную доставку:

  • Предмет(ы) больше не нужны или не нужны.
  • Товар(ы) возвращен нам из-за неверного или неполного адреса.
  • Элементы возвращены нам, которые не были результатом нашей ошибки.

Вы должны рассчитывать на возмещение в течение четырех недель после передачи посылки обратному отправителю, однако во многих случаях вы получите возмещение быстрее. Этот период времени включает в себя время доставки вашего возврата от грузоотправителя (от 5 до 10 рабочих дней), время, необходимое нам для обработки вашего возврата после его получения (от 3 до 5 рабочих дней), и время, которое требуется ваш банк для обработки нашего запроса на возврат средств (от 5 до 10 рабочих дней).

Если вам необходимо вернуть товар, свяжитесь с нами, указав номер вашего заказа и сведения о продукте, который вы хотите вернуть. Мы быстро ответим и предоставим инструкции о том, как вернуть товары из вашего заказа.

Стоимость доставки

Мы оплатим стоимость обратной доставки, если возврат является результатом нашей ошибки (вы получили неправильный или дефектный товар и т. д.). В других случаях вы будете нести ответственность за оплату ваших собственных расходов по доставке для возврата вашего товара.Стоимость доставки не возвращается. Если вы получите возмещение, стоимость обратной доставки будет вычтена из вашего возмещения.

В зависимости от того, где вы живете, время, которое может потребоваться для того, чтобы ваш обмениваемый товар был доставлен к вам, может различаться.

Если вы отправляете товар стоимостью более 75 долларов США, вам следует рассмотреть возможность использования службы доставки с возможностью отслеживания или приобретения страховки доставки. Мы не гарантируем, что получим ваш возвращенный товар.

парик фронта шнурка — лента или клей клей?

Парики на шнуровке долгое время были тщательно охраняемым секретом в Голливуде.В настоящее время все больше и больше женщин в Америке начинают использовать парики с кружевом спереди.

Вы должны попрактиковаться и использовать правильный клей при укладке парика с кружевом спереди. И, к счастью, вы можете найти множество клеев для наклеивания кружевных париков. Клеи можно разделить на две основные категории: ленточные клеи и клейкие клеи.

https://www.sishair.com/product-category/wigs/lace-front-wigs/

Клейкие ленты

Клеящие ленты

содержат двухстороннюю липкую ленту с обеих сторон.Одна липкая сторона прикреплена к вашей коже, а другая липкая часть прикреплена к шнурку.

Клей-клей

Нанесите клей-клей. Дайте им постоять, пока они не станут липкими. Вы должны установить контактный клей перед тем, как прикрепить кружевной парик к коже головы.

Лента или клей?

Какой клей лучше всего подходит для приклеивания париков с кружевом? У каждого типа есть свои плюсы и минусы. У каждого типа есть свои особенности использования. Фактически, в отличие от обычных клеев, клеи, используемые для кружевных париков, представляют собой клеи контактного типа.Они содержат ингредиенты, которые должны правильно работать при контакте с кожей человека.

Клеи как на водной основе, так и на основе растворителя являются растворимыми типами клеев. Первый менее травматичен для кожи и не вызывает аллергических реакций. Последний содержит более агрессивные для кожи соединения, но может держаться дольше.

Вы можете сделать ручную пробу, чтобы предотвратить любую аллергическую реакцию на клей для кружевных париков, особенно на клей.

  • Нанесите небольшую каплю клея на внутреннюю сторону предплечья, возле линии роста волос или даже на шею.
  • Оставьте сохнуть примерно на полчаса.
  • Удалите его.

Если в течение 24 часов место, покрытое клеем, становится красным и зудит, это может быть признаком аллергии на него. В этом случае не следует использовать клеи. Теперь вы можете использовать клейкую ленту.

Вам понадобится больше, чем просто приемник клея или лента для правильного наклеивания парика на шнуровке. Чтобы предотвратить износ и даже продукты, которые помогут вам эффективно удалить клей с парика и кожи, вы можете купить различные клейкие наборы, которые включают клей, защитные средства для кожи головы, блок изнашивания, кондиционеры для обработайте волосы на кружевном парике.

Похожие сообщения
Где купить аксессуары для волос онлайн

Как наносить дорожки для волос для плетения

Наращивание волос многоразового использования

Как сделать плетение волос естественным

Quick Weave с натуральным афроволосом

Как подстричь китайскую челку в домашних условиях

Все, что вам нужно знать о париках на шнуровке

Как сделать накладные волосы из перьев
Как наклеить парик на шнуровке с помощью клея или липкой ленты

Французский Испанский Португальский (Бразилия) Голландский Итальянский Немецкий

Анализ кинематики пользователя электросамоката после столкновения с внедорожником

Abstract

В статье представлены результаты анализа кинематики пользователя электросамоката после столкновения с транспортным средством.Доля электросамокатов (е-самокатов) в городском трафике в последние годы растет. Количество дорожно-транспортных происшествий с участием электросамокатов также увеличивается. Однако ситуация с безопасностью пользователей электросамокатов недостаточно изучена с точки зрения кинематики и исходов травм. В статье представлена ​​важность этой проблемы на основе углубленного анализа литературы о типах аварий, связанных с электронными скутерами, процентах травм и использовании шлемов. Впоследствии были разработаны и смоделированы четыре сценария аварии с использованием двух числовых кодов: LS-DYNA для обработки кода конечных элементов (FE) (модель автомобиля и скутера) и MADYMO для кода нескольких тел (фиктивная модель).Сценарий 1 — боковое столкновение капота, которое имитирует аварию, когда скутер врезается в переднюю часть автомобиля. Вторая и третья симуляции представляют собой боковое столкновение с центральной стойкой, которое было разделено на два положения манекена: присед и вертикальное положение. Четвертая симуляция — лобовой удар. Для каждого сценария представлены последующие кадры, описывающие движение манекена. Проанализирована и обсуждена кинематика послеудара для различных сценариев. Приведены графики линейного ускорения головы манекена и его величины для анализируемых сценариев.Поскольку исследование посвящено повышению безопасности пассажиров на данном виде транспорта, были обозначены возможные направления дальнейших исследований.

Образец цитирования: Ptak M, Fernandes FAO, Dymek M, Welter C, Brodziński K, Chybowski L (2022) Анализ кинематики пользователя электрического скутера после столкновения с внедорожником. ПЛОС ОДИН 17(1): е0262682. https://doi.org/10.1371/journal.pone.0262682

Редактор: Цюань Юань, Университет Цинхуа, КИТАЙ

Получено: 30 мая 2021 г.; Принято: 30 декабря 2021 г .; Опубликовано: 21 января 2022 г.

Авторское право: © 2022 Ptak et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные содержатся в документе и в файлах вспомогательной информации, которые включены через ZENODO по адресу: https://doi.org/10.5281/zenodo.5172021.

Финансирование: Благодарности Публикация подготовлена ​​в рамках проекта LIDER/8/0051/L-8/16/NCBR/2017, финансируемого Национальным центром исследований и разработок, Польша и грантами №.1/S/KPBMiM/21 и 1/S/KPBMiM/22 финансируются Министерством науки и высшего образования Польши (MEiN). Финансирование APC было покрыто Грантом №. 1/S/KPBMiM/22 началось в Морском университете Щецина, Польша.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Заторы на дорогах — это общемировая проблема, вызывающая самые разные проблемы — от стрессового вождения до увеличения выбросов CO 2 и ухудшения качества воздуха.Микромобильность быстро растет в городских дорожных сетях, от автомобилей с приводом от человека до электромобилей. Использование электромобилей, таких как стоячие самокаты, растет быстрыми темпами, особенно после введения общих услуг электронных самокатов. Только в 2018 году было зарегистрировано 38,5 млн поездок с использованием службы совместного использования стоячих электрических самокатов (SES) [1]. Этот вид транспорта, по-видимому, был практичным решением для пассажиров, путешествующих на короткие расстояния, поскольку он не только устойчив, но и удобен.

Хотя электромобильность оказывает положительное влияние за счет уменьшения заторов на дорогах и вредных выбросов, у нее есть и недостатки. Обратной стороной увеличения количества портативных электронных транспортных средств является увеличение травм и смертельных случаев среди пользователей, как показано на рис. 1. Принимая во внимание SES, Trivedi et al. [2] сообщили о травмах головы как о наиболее частых травмах, за которыми следуют переломы, ссадины и рваные раны кожи. Также сообщалось, что менее 5% гонщиков SES носили шлем [1] из 249 пациентов с травмами, попавших в аварии SES в период с 1 сентября 2017 г. по 31 августа 2018 г. в Калифорнии.В другом исследовании в Окленде введение общего SES также коррелирует с большим количеством серьезных связанных травм [3], сообщая о 64 пациентах в период с 15 августа 2018 г. по 15 декабря 2018 г. Из 64 травм очевидна тяжесть: 27 конечностей переломы, 3 вывиха, перелом позвоночника, 12 пациентов с сотрясением мозга, 1 экстрадуральное кровотечение и 9 переломов лица или черепа [3]. Кроме того, сообщалось о множественных повреждениях мягких тканей, при этом 40% пациентов нуждались в госпитализации и проведении визуализации, а 25 % пациентов.4% требуют оперативного вмешательства [3].

В другом исследовании, проведенном в Дании, где было зарегистрировано 468 травм, связанных с самокатом, Blomberg et al. [5] пришли к выводу, что текущие правила использования могут не предотвратить ненужные аварии и обеспечить безопасность дорожного движения и жизнь пожилых людей. Использование шлема также обсуждалось Blomberg et al. [5], как и в других предыдущих исследованиях [2, 3, 6]. Бломберг и др. [5] указывают на то, что возникает совершенно иная картина травм. Взрослые, ездящие на более быстрых скутерах, получают высокие энергетические нагрузки с 20.5% гонщиков получают травмы головы. В результате Бломберг и соавт. [5] рекомендуют использование шлема.

Аналогичные выводы были сделаны Kobayashi et al. [7], сообщая об увеличении случаев травм, связанных с авариями на СЭС. Более чем у половины пациентов (51% из 103 пациентов) имелись серьезные повреждения, включая внутричерепное кровоизлияние и переломы, требующие хирургического вмешательства. Кроме того, Кобаяши и соавт. [7] сообщили о распространенном употреблении алкоголя и незаконных веществ, а также о редком использовании шлемов, подчеркнув необходимость более широкого использования шлемов и препятствуя вождению в состоянии алкогольного опьянения среди пользователей электрических скутеров.В таблице 1 представлен краткий обзор четырех опубликованных в литературе исследований, в которых сообщалось о количестве травмированных гонщиков, среднем возрасте, количестве травм лица и головы, количестве черепно-мозговых травм (ЧМТ), количестве гонщиков в шлеме и причина аварии.

Недавно Toofany et al. [10] проанализировали современную литературу, посвященную последствиям травм в результате дорожно-транспортных происшествий с участием СЭС. Было подчеркнуто, что голова, верхние и нижние конечности особенно уязвимы при падениях или столкновениях СЭС, в то время как травмы грудной клетки и живота встречаются реже.В том же исследовании Toofany et al. [10] подчеркнули низкий уровень использования шлемов среди пользователей SES.

Около 80 % аварий с участием автомобилей связаны с гибелью велосипедистов или водителей SES, и более 80 % этих смертей являются результатом столкновений с более тяжелыми транспортными средствами [11]. Триведи и др. [2] сообщили о падениях и столкновениях как о наиболее частых механизмах травм с участием водителей СЭС. В литературе, насколько нам известно, нет исследований, посвященных реконструкции или моделированию аварий с участием СЭС.Это находится в прямом противоречии с другими уязвимыми пользователями дорог (VRU) [12, 13]. Это неожиданно, поскольку недавние исследования сообщают о вызывающем тревогу количестве травм среди водителей скутеров, включая черепно-мозговые травмы. Тем не менее, Сюй и соавт. [14] оценили риск травм головы четырех типов VRU во время автомобильных аварий; пешеходы, велосипеды и самобалансирующиеся электрические самокаты (одноколесные и двухколесные). Это было достигнуто с помощью программного обеспечения MADYMO, которое было распространенной программой численного моделирования, используемой для изучения безопасности при столкновении во время аварий в предыдущих работах.Сюй и др. [14] Мотивация основывалась на том факте, что электрические самобалансирующиеся самокаты широко использовались пассажирами пригородной зоны. Необходимо было изучить безопасность этого вида транспорта, как и ранее для других ВРУ [12, 13, 15–17].

Сценарии аварий с самокатами уже исследовались некоторыми исследовательскими группами [10, 18]. Компания fka совместно с Институтом автомобильного машиностроения (ika) Рейнско-Вестфальского технического университета Ахена представила серию тестов с возможными сценариями столкновения транспортных средств и скутеров.На рис. 2 представлен боковой краш-тест продолжительностью 150 мс (с интервалами 25 мс) при скорости удара SES 24,8 км/ч.

Несмотря на то, что было предпринято несколько попыток реконструировать дорожно-транспортные происшествия с участием СЭС, как показано на рис. 2, существует потребность в более глубоких исследованиях и изучении сценариев потенциальных травм с участием водителей СЭС. В литературе численные модели обычно используются для изучения дорожно-транспортных происшествий с участием микротранспортных средств (транспортных средств, относящихся к области микромобильности, таких как велосипеды).Однако, насколько известно авторам, это первая зарегистрированная модель SES, а также ее использование для моделирования дорожно-транспортных происшествий. Это исследование позволяет определить риск нескольких конфигураций аварии, что может дать представление о рисках, связанных с положением водителя, скоростью столкновения, затронутыми поверхностями/конструкциями и другими переменными в дорожно-транспортном происшествии с участием пользователя SES.

Таким образом, это исследование направлено на оценку безопасности пользователей СЭС. Целью настоящего исследования является моделирование дорожно-транспортных происшествий с участием СЭС, определение вероятных сценариев воздействия и, таким образом, получение данных для разработки рекомендаций по будущему регулированию и защитному снаряжению.Во-первых, путем реверс-инжиниринга была разработана численная модель СЭС. Затем эта модель использовалась для имитации четырех различных сценариев автомобильных аварий: лобового удара, бокового удара о капот и удара о среднюю стойку в двух разных положениях пользователя.

Материалы и методы

Данные анализируемого самоката и численный подход

В исследовании используется численная модель популярного электроскутера фирмы Lime, полученная методом реверс-инжиниринга [19, 20].Трехмерная геометрическая модель была разработана с помощью лазерного сканера Leica P20. Затем отсканированный SES был экспортирован в формат стереолитографии (STL), что позволило нам приступить к цифровой обработке с использованием автоматизированного проектирования (CAD). Геометрия была разделена на 3 части разной толщины, названные: основная труба, пластины и остальные. Характеристики материала были проверены с помощью портативного рентгеновского спектрометра Bruker. Скутер был проверен в 4-х разных областях для получения материалов для изготовления.Результаты спектроскопического исследования показали, что основным материалом корпуса является алюминиевый сплав (Алюминий 6061). Масса основана на весе нескольких самокатов и оценивается в 14 кг. Толщину деталей измеряли ультразвуковым толщиномером.

Транспортным средством, использованным в этом исследовании, была конечно-элементная модель Toyota RAV4, разработанная Национальным центром анализа аварий FHWA/NHTSA при Университете Джорджа Вашингтона. Модель прошла успешную валидацию [21].

Полная настройка модели включает в себя два числовых кода — LS-DYNA для обработки кода конечных элементов (FE) (модель автомобиля и скутера) и MADYMO для многотельного кода (фиктивная модель) — рис. 3. Комбинация обоих кодов через интерфейс во время моделирование позволило автору воспользоваться преимуществами, главным образом точностью и биодостоверностью человеческой модели, которые недоступны в автономном подходе [22, 23]. Связывание кода LS-DYNA с MADYMO, называемое соединением, является надежной практикой для решения проблем моделирования в области анализа аварий, особенно с учетом вовлеченных уязвимых участников дорожного движения.Манекен Hybrid III в мужской версии 50 th процентилей является широко используемым манекеном MADYMO в области оценки автомобильных устройств безопасности [24, 25], и он также использовался для представленного набора симуляций. Модель-манекен представляет собой эллипсоидную модель пешехода, разработанную TNO Automotive. Эта модель является одной из наиболее часто используемых моделей пешеходов с несколькими телами для реконструкции ДТП уязвимых участников дорожного движения [26–28]. Взаимодействие между экземплярами MB и частями скутера и манекена по сравнению с экземплярами FE и частями транспортного средства было установлено с помощью муфты и подэлементов контактов и ограничителей как в MADYMO, так и в Коды LS-DYNA.Манекен проверяется для каждого сегмента модели, такого как большеберцовая кость, бедренная кость, таз, грудная клетка, плечо, а также для полной модели [29, 30]. Недостатком является то, что валидация проводится только при ударе транспортного средства, а не при контакте с землей [31–34]. Тем не менее, это исследование сосредоточено только на контакте пешехода с транспортным средством, а не на контакте пешехода с землей после удара. Таким образом, это подходящая и действующая модель для использования в этом исследовании.

Модель материала, использованная в LS-DYNA для численной модели самоката, представлена ​​в таблице 2.Численные компоненты, их физические свойства и применяемый численный подход для исследования представлены в таблице 3.

Описание сценариев

Электросамокаты

, несмотря на их многочисленные достоинства, такие как простота передвижения, экологичность и экономичность, имеют и немало недостатков. Один из них – вопросы безопасности. Теоретически самокаты должны быть прочными и безопасными, хотя человек играет значительную роль в обеспечении безопасности. В этом исследовании были проанализированы четыре различных установки моделирования (рис. 4).Первый анализ (сценарий а)) представляет собой боковое столкновение капота, которое имитирует аварию, когда скутер въезжает в переднюю часть транспортного средства. Ожидается, что этот случай будет иметь самую непредсказуемую кинематику.

Вторая и третья симуляции представляют собой боковое столкновение с центральной стойкой, так как средняя стойка является одной из самых жестких боковых частей автомобиля. Такая авария может иметь огромные последствия. Столкновение со средней стойкой было дополнительно разделено на два фиктивных положения: вверх-вправо (сценарий b)) и приседание (сценарий c)).Приседание означает, что колени манекена слегка согнуты, тогда как вертикальное положение означает, что нога полностью выпрямлена. Это было исследовано, поскольку рост пользователя оказывает значительное влияние на кинематику — он может быть определяющим фактором, определяющим, ударит ли водитель о среднюю стойку или капот автомобиля. Положение приседа имитирует случай, представленный в экспериментальных исследованиях, изображенных на рис. 2.

Четвертая симуляция (сценарий d)) — лобовой удар. Ожидается, что этот случай будет наиболее опасным с точки зрения травм водителей скутеров из-за высоких скоростей и, следовательно, потенциального замедления.

При ударе о среднюю стойку и боковую часть капота скорость скутера составляет 25 км/ч, тогда как при лобовом столкновении скорость автомобиля составляет 21,6 км/ч. Автомобиль оставался неподвижным во всех сценариях с контактом шин с землей и накачанными шинами. Предполагаемая скорость столкновения 25 км/ч для боковых ударов отражает максимально допустимую крейсерскую скорость для электрических скутеров в большинстве европейских стран. В отличие от боковых ударов, когда транспортное средство может выехать с перекрестка или переулка, при лобовом ударе мы приняли тормозное действие пользователя самоката – таким образом, скорость удара была снижена до 21.6 км/ч (6 м/с).

Согласно литературным исследованиям и обзорам городских аварий, столкновения с транспортными средствами, наряду с падениями, являются двумя основными типами аварий с участием электронных скутеров. Представленные сценарии представляют собой попытку представить некоторые из наиболее вероятных случаев с участием автомобиля, поскольку, как сообщается, столкновения электронных скутеров с транспортными средствами происходят в основном на магистралях/улицах и перекрестках [35]. Из всех аварий с электронными скутерами, о которых сообщалось в [36], 54% произошли на перекрестке с автомобилем, движущимся прямо или поворачивающим направо, и водителем на электронном скутере, выходящим на пешеходный переход справа.Кроме того, оба сценария b) и c) основаны на краш-тестах, представленных компанией fka совместно с Институтом автомобильной инженерии (ika) Рейнско-Вестфальского технического университета в Аахене (рис. 2).

Результаты и обсуждение

В представленных сценариях мы сосредоточились на кинематике пользователя самоката (водителя) и отследили центр тяжести головы и манекена (отмечены в момент времени 0, т.е. контакт пользователя с транспортным средством) ( ЦГ). Отслеживаемые ЦТ головы и манекена (в исходном положении) изображены черными кривыми на следующих рисунках 5–8.Относительное смещение пользователя выражается в [мм] и относится к моменту времени 0 симуляции.

Сценарий а) — Боковой удар капота

В сценарии с боковым капотом крайне важно исследовать поведение рук. Первый контакт пользователя с транспортным средством происходит на высоте центра тяжести манекена. Кроме того, правое предплечье и локоть ударяются о лобовое стекло и защищают голову от тяжелых травм. Контакт с манекеном руки уменьшает импульс силы и, таким образом, замедляет движение головы. Как и в последующих случаях, точка контакта между самокатом и транспортным средством действует как точка вращения, вызывая вращение манекена.Электросамокат ведет себя как жесткий компонент кузова и не оказывает существенного влияния на кинематику пользователя после удара.

Сценарий b) — удар о среднюю стойку, вертикальное положение манекена

В численном моделировании центральной стойки – вертикальное положение, основной контакт происходит между центральной стойкой и туловищем манекена с ногами. Поскольку туловище и ноги имеют почти нулевые компоненты скорости, т.е. скорость выравнивается с неподвижным транспортным средством — система голова-шея является основной частью с относительно высокой кинетической энергией и, таким образом, резко поворачивается в сторону транспортного средства.Манекен 50 -го -го процентиля выше автомобиля, что приводит к ситуации, когда голова соприкасается с крышей – прямого контакта между головой и центральной стойкой нет. Это существенно влияет на замедление головы, поскольку крыша автомобиля не такая жесткая, как средняя стойка.

Сценарий c) — удар о центральную стойку, положение манекена на корточках

В сценарии в) пользователь самоката находится в положении приседа, и кинематика головы радикально отличается от представленной выше вертикальной позиции (сценарий б).Основной удар приходится между головой и верхней частью средней стойки. Это приводит к противоположной ситуации, как в случае б), так как теперь нет постоянной точки вращения головы на автомобиле. После первого контакта голова начинает скользить к крыше — такое поведение также наблюдается в экспериментальном краш-тесте FKA (рис. 2). Поведение ноги и туловища похоже на вертикальное положение — оно ударяется о боковые двери автомобиля, и нижняя часть тела мгновенно останавливается. Тем не менее, в обоих манекенах вероятность травмы головы очень высока, поскольку у пользователя минимальные шансы использовать руки для защиты головы от прямого черепного удара.

Сценарий d) — лобовое столкновение

Контакт во фронтальной установке инициируется самокатом в переднюю часть автомобиля. Пользователь сохраняет кинетическую энергию и проецируется вперед. При контакте с рулевой тягой самокат толкается пользователем и падает на капот. Эта точка контакта между самокатом и транспортным средством действует как временная ось вращения манекена. Таким образом, манекен вращается вокруг этой оси до тех пор, пока не упрется в середину капота. Во время моделирования видно, что первый контакт между манекеном и шляпой инициируется руками.Анализ ускорения ЦТ головы показывает, что этот контакт уменьшает кинетическую энергию, что приводит к меньшей инерции головы, если и когда голова непосредственно соприкасается с капотом. На самом деле, эта ситуация может очень точно имитировать реальность, поскольку пользователь, скорее всего, защитит голову непроизвольным рефлексом.

Сравнительный анализ сценариев

По результатам моделирования наиболее опасными авариями с травмами головы являются оба столкновения со средней стойкой, при этом наиболее опасным среди изученных случаев является приседание.Главный фактор заключается в том, что при столкновении с центральной стойкой голова почти сразу касается автомобиля без предварительного маневра рукой, что частично поглощает кинематическую энергию манекена. Это прямо контрастирует с боковым капотом и лобовым столкновением, где контакт с рукой вызывает предварительное замедление. Рука действует как щит для головы и, таким образом, поглощает энергию, которая может быть преобразована при ударе головы о транспортное средство. Эти наблюдения коррелируют с историей ускорения, измеренной в ЦТ головы, и показаны на рис. 9.

На рис. 9 представлены данные об ускорении головы пользователя SES для всех проанализированных сценариев — для построения графика использовался фильтр CFC1000. Наибольшее ускорение 777 м/с 2 наблюдается для сценария удара B-столбца (приседания) через 69,5 мс после удара. Последовательно максимальные значения ускорения наблюдаются для средней стойки (вертикальной): 703 м/с 2 и 138 мс после удара; лобовое: 500 м/с 2 и 230 мс после удара, и, наконец, капотное: 296 м/с 2 и 168 мс после удара.

В каждой представленной ситуации в зависимости от сценария от 2 до 15 мс после максимального значения ускорения наблюдается второй пик ускорения в пределах от 42% до 66% значения максимального ускорения, наблюдаемого для данного сценария. Авторы подчеркивают, что в исследованиях сообщается о низком уровне использования шлемов среди пользователей электрических самокатов, что, возможно, делает водителей более уязвимыми к травмам головы [10, 37, 38].

Выводы

Данная исследовательская работа была направлена ​​на изучение кинематики пользователя СЭС и анализ ускорений головы при столкновении с СЭС.Электрические самокаты могут сделать пользователей уязвимыми для травм различной степени тяжести. Насколько известно авторам, в литературе нет исследований, посвященных моделированию дорожно-транспортных происшествий с участием СЭС. В настоящее время существует несколько опасений и сомнений относительно безопасности SES, а также возможных правил, которые могут быть введены для повышения безопасности самокатов. Это исследование было направлено на то, чтобы дать некоторое представление о безопасности гонщиков SES и соответствующих аспектах для будущего регулирования.

Всего в этом исследовании было представлено 4 случая столкновения скутера с транспортным средством. Изученные случаи подразумевают, что безопасность пользователей СЭС должна стать актуальной темой в обществе в связи с ростом популярности СЭС. Кроме того, результаты доказывают, что столкновение электрического скутера с центральной стойкой автомобиля более опасно, чем столкновение с капотом. Хотя боковой капот или лобовое столкновение приводят к длительному нахождению пользователя в воздухе, это позволяет использовать непроизвольные рефлексы для защиты головы.Кроме того, руль скутера действует как точка поворота для водителя и может быть причиной увеличения ускорения головы. Однако, несмотря на введение кусочно-линейной пластической модели материала самоката, самокат ведет себя как жесткая корпусная конструкция с пренебрежимо малыми пластическими деформациями при представленных ударах. Таким образом, использование многотельной модели самоката может заменить более сложную и трудоемкую конечно-элементную модель конструкции.

В будущих исследованиях кинематика головы манекена может быть применена к реальной модели головы для изучения напряжения и напряжения мозга или внутричерепного давления.Это исследование может сильно повлиять на правила, касающиеся обязательного защитного снаряжения для водителя SES и официального статуса транспортного средства.

Кроме того, благодаря сбору данных об авариях в ближайшем будущем может стать возможным воссоздание реальных аварий с участием электронных скутеров. Ян и др. [35] собрали обширные сообщения СМИ и создали набор данных об авариях, включая ключевые элементы аварий, такие как демографические данные гонщиков, тип аварии и место ее расположения. В более позднем исследовании Ma et al.[39] разработали мобильную сенсорную систему для сбора данных для количественной оценки суррогатных показателей безопасности с точки зрения испытанных вибраций, изменений скорости и близости к окружающим объектам. По сравнению с ездой на велосипеде, при езде на электронном скутере были связаны более сильные вибрации, независимо от типа дорожного покрытия, что может коррелировать с несколькими случаями падений, о которых сообщалось в литературе.

Каталожные номера

  1. 1. NACTO (2018) Общая микромобильность в США.С.: 2018.
  2. 2. Триведи Т.К., Лю С., Антонио АЛМ и др. (2019) Травмы, связанные с использованием электрического скутера стоя. Открытие JAMA Netw 2:e187381. пмид:30681711
  3. 3. Мэйхью Л.Дж., Бергин С. (2019)Влияние травм от электронного скутера на визуализацию отделения неотложной помощи. J Med Imaging Radiat Oncol 63:461–466. пмид:30972936
  4. 4. Фарли К.Х., Айзпуру М., Уилсон Дж.М. и др. (2020) Расчетная частота травм, связанных с электросамокатами, в США с 2014 по 2019 год.Сеть JAMA открыта 3:e2014500. пмид:32865571
  5. 5. Blomberg SNF, Rosenkrantz OCM, Lippert F, Collatz Christensen H (2019) Травмы от электросамокатов в Копенгагене: ретроспективное когортное исследование. BMJ Open 9:33988. пмид:31871261
  6. 6. Каплан С., Вавацулас К., Прато К.Г. (2014)Отягчающие и смягчающие факторы, связанные с тяжестью травм велосипедистов в Дании. J Рез. по безопасности 50:75–82. пмид:25142363
  7. 7. Кобаяши Л.М., Уильямс Э., Браун К.В., et al (2019) Электронная эпидемия электронных скутеров. Trauma Surg Acute Care Открытие 4:337. пмид:31565677
  8. 8. Störmann P, Klug A, Nau C, et al (2020) Характеристики и характер травм при авариях, связанных с электросамокатами — перспективный двухцентровый отчет из Германии. J Clin Med 9:1569. пмид:32455862
  9. 9. Общественное здравоохранение Остина (2019 г.) Исследование травм, связанных с электрическим скутером без док-станции. Остин.
  10. 10. Туофани М., Мохсениан С., Шум Л.К. и др. (2021) Типы травм и обстоятельства, связанные со столкновениями с электросамокатами: предварительный обзор.Inj Предыдущая травмаprev-2020-044085. пмид:33707220
  11. 11. ОЭСР/МФТ (2020) Безопасная микромобильность. Отчет Совета корпоративного партнерства.
  12. 12. Фернандес ФАО, Алвес де Соуза Р.Дж., Птак М. (2018) Применение численных методов для реконструкции аварий и криминалистического анализа. 59–98.
  13. 13. Птак М., Вильгельм Дж., Савицки М. (2019) Анализ безопасности детей, перевозимых на велосипедном сиденье во время дорожно-транспортных происшествий. Int J Аварийность 0: 1–16.
  14. 14. Сюй Дж., Шан С., Ю. Г. и др. (2016) Безопасны ли электрические самобалансирующиеся скутеры при дорожно-транспортных происшествиях? Несчастный анал Пред. 87: 102–116. пмид:26656151
  15. 15. Картер Э.Л., Нил-Стерджесс К.Э. (2009) MADYMO Реконструкция столкновения автомобиля и велосипедиста в реальном мире. Int J Аварийность 14: 379–390.
  16. 16. Симмс К.К., Вуд Д.П. (2006)Влияние положения и движения пешехода до столкновения на кинематику и травмы от контакта транспортного средства с землей.Int J Аварийность 11: 345–355.
  17. 17. Peng Y, Chen Y, Yang J и др. (2012) Исследование воздействия травм головы на пешеходов и велосипедистов при столкновениях легковых автомобилей на основе данных об авариях и моделирования. Саф Наука 50: 1749–1759.
  18. 18. FKA (2019) Краш-тест самоката.
  19. 19. Кубичек Дж., Хадасик Б. (2020) Сегментация рынка электрических скутеров в Польше. Эконометрика 24:50–65.
  20. 20. Птак М., Червинска Д., Вильгельм Дж. и др. (2019) Удар головой о капот с использованием конечно-элементной модели головы.
  21. 21. Национальная администрация безопасности дорожного движения (НАБДД) (2015 г.) Факты о безопасности дорожного движения: 2015 г. Отчет Департамента США 1–9. ТОЧКА ГС 812 409
  22. 22. Ptak M (2019) Метод оценки и повышения безопасности уязвимых участников дорожного движения при ударной нагрузке. Прикладная наука 9.
  23. 23. Вильгельм Дж. (2020) Биомеханика травм у детей, перевозимых на велосипеде, во время дорожно-транспортных происшествий и применение пробкового материала для защиты головы ребенка. Вроцлавский университет науки и технологий.
  24. 24. Птак М., Вильгельм Дж., Савицкий М., Русинский Э. (2019) Безопасность детей на различных велосипедных сиденьях во время удара транспортного средства. Транспорт 34.
  25. 25. Симмс С., Вуд Д. (2009) Воздействие пешеходов и велосипедистов. Springer Нидерланды, Дордрехт.
  26. 26. TNO (2013) Руководство по моделям человеческого тела MADYMO, том 7.5.
  27. 27. Птак М., Вильгельм Дж., Климас О., Релик Г. (2019) Численное моделирование удара мотоцикла о дорожное ограждение. Спрингер Нат Свитц 1–9.
  28. 28. Гао В., Бай З., Ли Х. и др. (2020) Исследование травм головы велосипедистов на основе реконструкции дорожно-транспортного происшествия от электрического велосипеда. Прев. 21:563–568. пмид:33052728
  29. 29. Исикава Х. (1993) Модель воздействия для реконструкции аварии — нормальные и тангенциальные коэффициенты восстановления.
  30. 30. Кайзер Дж., Кавальеро С., Боннуа Дж. и др. (1993) Реакция коленного сустава на боковой удар: влияние изгибающего момента. SAE Int 1993–13–00:105–116.
  31. 31. Шанг С., Массон С., Пи М. и др. (2020) Оценка модели пешехода с несколькими телами по сравнению с PMHS во время контакта с землей. Иркоби 89–92.
  32. 32. Han Y, Li Q, Qian Y и др. (2018) Сравнение кинематики приземления пешеходов и велосипедистов при столкновении с землей, определенное на основе видеозаписей столкновения транспортных средств. Инт Дж Вех Саф 10:212.
  33. 33. Цзоу Т., Шан С., Симмс С. (2019) Потенциальные преимущества контролируемого торможения транспортных средств для снижения травм пешеходов при контакте с землей.Accid Anal Prev 129: 94–107. пмид:31132748
  34. 34. Шанг С., Массон С., Ллари М. и др. (2021) Прогностическая способность эллипсоидной пешеходной модели MADYMO для кинематики контакта пешеходов с землей и оценки травм. Несчастный анал Предыдущая 149:105803. пмид:33186825
  35. 35. Yang H, Ma Q, Wang Z и др. (2020) Безопасность микромобильности: анализ сбоев электронных скутеров по сообщениям горнодобывающих компаний. Несчастный анал Предыдущая 143:105608. пмид:32480017
  36. 36. Шах Н.Р., Арьял С., Вен И., Черри Ч.Р. (2021) Сравнение автомобильных аварий с участием электросамокатов и велосипедов с использованием стандартизированной типологии аварий.J Рез. по безопасности 77:217–228. пмид:34092312
  37. 37. Chybowski L, Przetakiewicz W (2020) Оценка вероятности травмы головы на заданном уровне сокращенной шкалы травм с помощью критерия функции травмы головы. Syst Saf Hum — Tech Facil — Environ 2: 91–99.
  38. 38. Качиньски П., Птак М., Фернандес ФАО и др. (2019) Разработка и испытания усовершенствованных сэндвичей из пробкового композита для энергопоглощающих конструкций. Материалы (Базель) 12. pmid:30818808
  39. 39.Ма К., Ян Х., Мэйхью А. и др. (2021) Безопасность электронного скутера: анализ рисков при езде на основе данных мобильных датчиков. Случайный анал Предыдущая 151:105954. пмид:33360874

5 типов воска для бикини, определение (и как подготовиться к одному)

Без волос, полностью голые: это полный бразильский воск для бикини, иногда называемый голливудским воском. Выбор этого типа воска означает, что вы «удалите волосы со всей области влагалища, включая губы, половые губы, два пальца за пределами линии трусиков и между ягодицами», — говорит Гилсон.

Вам может быть интересно: больно ли делать бразильскую эпиляцию воском? Они заработали репутацию не для слабонервных — и, честно говоря, бразильский не предполагает нанесение воска на некоторые из самых чувствительных частей вашего тела. Но пока это делает опытный профессионал, это, вероятно, будет менее болезненным, чем вы боитесь, говорит Ариана Кристин Дим, владелица Waxing With Ari. «Я слышала, как многие клиенты встают после бразильца и говорят: «Это было не так плохо, как я думала!» — говорит она.Итак, если вы чувствуете себя наиболее комфортно без волос в любом месте, этот стиль, вероятно, для вас. (Все еще нервничаете из-за болезненных ощущений при первой процедуре эпиляции воском? Ниже мы дадим несколько советов о том, как предотвратить боль при эпиляции!)

Что делать перед эпиляцией бикини

1. Убедитесь, что у вас достаточно волос удалять.

Самая распространенная ошибка, которую люди допускают при заказе восковой эпиляции бикини, заключается в том, что между бритьем или эпиляцией недостаточно времени, говорит Нанди Вагнер, ведущий косметолог Bliss Soho в Нью-Йорке.Если ваши волосы недостаточно длинные, вы не только не получите желаемых результатов гладкости, но и когда вам придется снова и снова наносить воск на одну и ту же область, вы, скорее всего, испытаете раздражение. Вагнер говорит, что в идеале волосы должны быть толщиной в четверть дюйма для восковой эпиляции (или примерно столько, сколько вы можете ущипнуть кончиками пальцев).

2. Отшелушивание.

Отращивая лобок перед эпиляцией, не забудьте отшелушивать зону бикини, когда находитесь в душе — в идеале примерно два или три раза в неделю.«Несколько песчаный скраб для тела поможет избавиться от мертвых клеток вокруг пор кожи и волосяных фолликулов, обеспечив более легкий выход», — сказал Гилсон. И после душа не забудьте хорошо увлажнить кожу. Мягкая кожа облегчит эпиляцию!

3. Откажитесь от кремов с ретиноидами.

Ретиноиды, которые часто назначают при угревой сыпи на теле, не следует использовать при уходе за кожей перед нанесением воска. «Избегайте кремов и продуктов с ретинолом примерно за два-пять дней до восковой эпиляции, так как ваша кожа становится тоньше, чувствительнее и подвержена травмам», — говорит доктор.Говорит Джессика Шеперд, доктор медицинских наук, магистр делового администрирования, FACOG, гинеколог и главный медицинский директор Verywell Health.

4. Запланируйте восковую эпиляцию на время, когда у вас нет менструации.

Как правило, лучше всего делать восковую депиляцию зоны бикини «по крайней мере за несколько дней до или после менструации, потому что чем ближе вы приближаетесь к настоящему периоду, тем более чувствительным становится ваше тело», — Шобха Туммала, основатель Shobha Waxing Studio, говорит. «Кроме того, с точки зрения гигиены лучше отказаться от лечения во время менструации.Фактически, это наша политика здесь, в Шобхе».

5. Перед визитом вымойтесь.

Это может показаться очевидным, но чистота имеет значение, особенно когда речь идет о ваших собственных шансах заражения! «Купайтесь, как если бы вы шли к акушеру-гинекологу, — говорит Туммала. — Чистота приветствуется, но, пожалуйста, не пользуйтесь лосьоном. Вы добьетесь лучших результатов, если ваша кожа будет менее жирной.»

6. Носите правильное нижнее белье.

Перед тем, как отправиться на прием, убедитесь, что вы надели дышащее хлопковое белье.Это «оптимально для — буквально — плавного восстановления», — говорит Рэйчел Файл, лицензированный косметолог и основатель Beauty Ritual Skincare. Она добавила, что некоторые салоны восковой эпиляции предоставят вам одноразовые хлопчатобумажные трусики перед сеансом восковой эпиляции, но лучше на это не рассчитывать.

7. Пейте воду и принимайте обезболивающие.

Это тот же совет, который вы получите перед сеансом массажа: обеспечение обезвоживания поможет уменьшить боль и дискомфорт.Вам также, вероятно, следует пропустить Starbucks по пути. «Избегайте кофеина перед приемом, так как он является стимулятором и может сделать вас более чувствительным», — говорит Инглес. Она также рекомендует принять аспирин или ибупрофен за 30 минут до процедуры — вы можете быть особенно рады этому, если вам предстоит более обширная депиляция!

Что делать после депиляции воском

1. Через несколько часов после депиляции бикини протрите кожу мягкой натуральной салфеткой.

Мягкая салфетка с натуральными ингредиентами или нежной формулой очистит кожу после депиляции и поможет избежать раздражения. «Алоэ — отличный ингредиент, который вам нужен в составе салфеток, и вы не должны отшелушивать его в течение как минимум 24 часов после этого», — говорит доктор Шеперд.

2. При необходимости попробуйте местное лечение.

Раздражение после депиляции является обычным явлением, но это не значит, что вы не можете остановить его. После удаления волос Хибба Капил, основатель Hibba NYC, рекомендует положить холодный компресс на эту область и нанести немного крема с 1% кортизона вокруг области бикини, чтобы уменьшить отек, раздражение и покраснение.

3. Знайте, каких действий вам следует избегать.

В отличие от бритья, вам, возможно, придется изменить свой образ жизни на несколько дней после эпиляции воском. «Наши поры остаются открытыми от 24 до 48 часов после эпиляции», — говорит Капил. «По этой причине рекомендуется избегать всего, что может вызвать пот, трение или жар». Она рекомендует воздержаться от тренировок, секса, принятия горячих ванн или душа в течение как минимум двух дней после удаления волос. Эти действия могут предотвратить закрытие пор и повысить риск заражения — две вещи, которые вам не нужны.

4. Выбирайте гель для душа с умом.

Рекомендуется заменить обычное средство для душа на более щадящее средство, когда вы моете вощеные чувствительные участки. «Ищите чистящие средства со сбалансированным pH и натуральными ингредиентами, такими как кокосовое масло и витамин Е», — говорит Вагнер. «Сульфаты, агрессивные моющие средства и сильные ароматизаторы могут раздражать эту область, и их следует избегать любой ценой».

5. В первые день или два после восковой эпиляции носите свободную одежду.

Хлопок снова станет вашим другом. «Дышащее хлопковое белье и свободная одежда лучше всего подходят для того, чтобы ваша кожа дышала после эпиляции», — говорит Вега. «Если ваша одежда тесная и вы потеете, вы можете быть более восприимчивы к прыщам и вросшим волосам».

6. Немного осторожности поможет остановить вросшие волосы.

Лучший способ борьбы с надоедливыми прыщами — это предотвратить их появление. Капил говорит, что успокойте свои поры и держите неровности в страхе, нанеся немного детского масла на линию бикини в первую ночь перед сном.Затем, через 48 часов после нанесения воска, отшелушивайте область люфой и небольшим количеством мыла. Если вы в конечном итоге получите вросший волос вдоль линии бикини, не ковыряйтесь в нем — пусть он заживает естественным путем. «Если они огромные, мазь с 3% перекисью бензоила может творить чудеса», — говорит она. «Как только кожа выглядит высушенной, волосы выпадают автоматически или с небольшим отшелушиванием». Но помните: не пытайтесь форсировать это; Вы не хотите шрамов!

7. Пропустить пляж (пока).

Заказывать депиляцию в последнюю минуту перед отъездом на весенние каникулы или в отпуск, даже если вы планируете просто поваляться у бассейна, — категорически нет-нет.Вагнер рекомендует планировать встречу как минимум за два дня до , когда вы будете в купальном костюме. Вы избавитесь от пушистости, и к тому времени утихнет любое раздражение или воспаление.

TDP-43 репрессирует включение скрытого экзона в ген FTD-ALS UNC13A

Все материалы, использованные в этом исследовании, доступны по запросу.

Анализ выравнивания и сплайсинга RNA-seq

Подробный конвейер v2.0.1 для выравнивания RNA-seq и анализа сплайсинга доступен на https://github.com/emc2cube/Bioinformatics/sh_RNAseq.sh. Файлы FASTQ были загружены из базы данных Gene Expression Omnibus (GEO) (GSE126543). Адаптеры в файлах FASTQ были удалены с помощью trimmomatic (0,39) (ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). Качество полученных файлов оценивали с помощью FastQC (v0.11.9). Прочтения RNA-seq были сопоставлены с человеком (hg38) с использованием STAR v2.7.3a в соответствии со стандартными опциями ENCODE, количество прочтений было сгенерировано с использованием RSEM v1.3.1, а анализ дифференциальной экспрессии был выполнен в R v4.0.2 с использованием пакета DESeq2 v1.28.1 40 .

Анализ сплайсинга

MAJIQ

События альтернативного сплайсинга были проанализированы с использованием MAJIQ (2.2) и VOILA 13 . Вкратце, MAJIQ использовал уникально картированные чтения, охватывающие соединение, со следующими параметрами: «majiq build -c config–min-intronic-cov 1–simplify» для построения графов сплайсинга для транскриптов с использованием аннотации транскриптома UCSC (выпуск 82) дополнен обнаруженными de novo соединениями.Здесь de novo относится к соединениям, которых не было в аннотации транскриптома UCSC, но было достаточно доказательств в данных RNA-seq (-min-intronic-cov 1). Отличительные вариации локального сплайсинга (LSV) были идентифицированы на графиках сплайсинга генов, а квантификатор MAJIQ «majiq psi» оценивал долю каждого соединения в каждом LSV, обозначенную как процент сплайсинга в (PSI или Ψ ), в каждой РНК-последовательности. образец. Изменения PSI каждого соединения (ΔPSI или Δ Ψ ) между двумя состояниями (TDP-43-положительные ядра нейронов по сравнению с TDP-43-отрицательными ядрами нейронов) рассчитывали с помощью команды «majiq deltapsi».Графики сплайсинга генов и апостериорные распределения PSI и ΔPSI визуализировали с помощью VOILA.

LeafCutter

LeafCutter доступен как коммит 249fc26 на https://github.com/davidaknowles/leafcutter. Используя считывания RNA-seq, выровненные, как описано ранее, считывания, охватывающие соединения экзон-экзон, и карта с минимум 6 нуклеотидами в каждом экзоне были извлечены из файлов выравнивания (bam) с использованием filter_cs.py с настройками по умолчанию. Кластеризация интронов была выполнена с использованием настроек по умолчанию в leafcutter_cluster.ру. Дифференциальное удаление интронов между двумя состояниями (TDP-43-положительные ядра нейронов по сравнению с TDP-43-отрицательными ядрами нейронов) рассчитывали с использованием leafcutter_ds.R.

График Сашими

Плотность секвенирования РНК вдоль экзонов наносили на график с использованием функции sashimi_plot, включенной в пакет MISO (мистификация 0.5.4). На графике сашими интроны уменьшены в 15 раз, а экзоны уменьшены в 5 раз. Плотность прочтений РНК-секвенций по экзонам масштабируется по количеству картированных прочтений в образце и измеряется в единицах RPKM.Небольшие изменения были внесены в plot_gene.py и plot_settings.py в каталоге sashimi_plot пакета MISO, чтобы выделить график плотности РНК-сек. Модифицированный каталог sashimi_plot доступен по адресу (https://github.com/rosaxma/TDP-43-UNC13A-2021).

Культура клеток

Клетки SH-SY5Y (ATCC) выращивали в среде DMEM/F12 с добавлением Glutamax (Thermo Scientific), 10% фетальной бычьей сыворотки и 10% пенициллина-стрептомицина при 37 °C, 5% CO 2 . Для обработки кшРНК клетки высевали на 0-й день, трансдуцировали кшРНК на 2-й день с последующим обновлением среды на 3-й день и собирали для считывания (RT-qPCR и иммуноблотинг) на 6-й день.Нокаутные клетки HEK 293T TDP-43 и родительские клетки HEK 293T были получены, как описано 36 . Клетки культивировали в среде DMEM (Gibco 10564011) с добавлением 10% эмбриональной бычьей сыворотки, 1% пенициллина-стрептомицина, 2  мМ l-глютамина (Gemini Biosciences) и 1× раствора заменимых аминокислот MEM (Gibco) при 37°С. C, 5% CO 2 .

Поддержание и дифференцировка иПС-клеток в иПСК-МН

Линии иПС-клеток были получены из общедоступных биобанков (GM25256-Corriell Institute; NDS00262, NDS00209-NINDS) и поддерживались в среде mTeSR1 (StemCell Technologies) на матригеле (Corning).iPS-клетки подкармливали ежедневно и делили каждые 4–7 дней с помощью ReLeSR (StemCell Technologies) в соответствии с инструкциями производителя. Дифференцировку iPS-клеток в двигательные нейроны проводили, как описано ранее 41 . Вкратце, iPS-клетки диссоциировали и помещали в колбы со сверхнизкой адгезией (Corning) для формирования 3D-сфероидов в среде, содержащей DMEMF12/Neurobasal (Thermo Fisher), добавку N2 (Thermo Fisher) и добавку B-27, не содержащую ксено (Thermo Fisher). Фишер). Небольшие молекулы добавляли для индукции формирования паттерна нейронов-предшественников сфероидов (LDN193189, SB-431542, Chir99021) с последующей индукцией моторных нейронов (с ретиноевой кислотой, агонистом Smo и DAPT).Через 14 дней сфероиды нейронов диссоциировали с помощью папаина и ДНКазы (Worthington Biochemical) и высевали на планшеты, покрытые поли-d-лизином/ламинином, в нейробазальной среде (Thermo Fisher), содержащей нейротрофические факторы (BDNF, GDNF и CNTF; R&D Systems). Для вирусной трансдукции культуры нейронов инкубировали в течение 18 часов со средой, содержащей частицы лентивируса для shScramble или shTDP-43. Эффективность заражения более 90% оценивали по экспрессии RFP. Нейрональные культуры анализировали на РНК и белок через 7 дней после трансдукции.Клонирование кшРНК

, упаковка лентивирусов и клеточная трансдукция для обнаружения сплайс-варианта

UNC13A Последовательности кшРНК

были взяты из Broad GPP Portal (TDP-43: AGATCTTAAGACTGGTCATTC, кодировка: GATATCGCTTCTACTAGTAAG). Для клонирования были синтезированы комплементарные олигонуклеотиды для создания выступающих частей из 4 нуклеотидов, отожжены и лигированы в pRSITCH (Tet-индуцируемый U6) или pRSI16 (конститутивный U6) (Cellecta). Лигирование трансформировали в химически компетентные клетки Stbl3 (Thermo Scientific) и выращивали при 30 °C.Крупномасштабное создание плазмид проводили с использованием колонок Maxiprep (Promega), причем очищенную плазмиду использовали в качестве исходных данных для упаковки лентивирусов с помощью упаковочных плазмид второго поколения psPAX2 и pMD2.G (Cellecta), трансдуцированных липофектамином 2000 (Invitrogen) в клетках Lenti-X 293T ( Такара). Вирусный супернатант собирали через 48 и 72 ч после трансфекции и концентрировали с использованием концентратора Lenti-X (Takara). Титр вируса устанавливали путем серийного разведения в соответствующих клеточных линиях и считывания процентного содержания клеток BFP+ с помощью проточной цитометрии, при этом разведение достигало минимум 80% клеток BFP+, отобранных для экспериментов.

Иммуноблоттинг

Клетки SH-SY5Y и иПСК-МН трансфицировали и обрабатывали, как указано выше, перед лизисом. Клетки лизировали в охлажденном льдом буфере RIPA (Sigma-Aldrich R0278) с добавлением смеси ингибиторов протеазы (Thermo Fisher 78429) и ингибитора фосфатазы (Thermo Fisher 78426). После осаждения лизатов на максимальной скорости на настольной центрифуге в течение 15 мин при 4°С были проведены анализы на бицинхониновую кислоту (Invitrogen 23225) для определения концентрации белка. 60 мкг (SH-SY5Y) и 30 мкг (иПСК-МН) белка каждого образца денатурировали в течение 10 минут при 70 °C в буфере для образцов LDS (Invitrogen NP0008), содержащем 2.5% 2-меркаптоэтанол (Sigma-Aldrich). Эти образцы загружали в гели 4-12% Bis-Tris (Thermo Fisher NP0335BOX) для гель-электрофореза, затем переносили на нитроцеллюлозные мембраны 0,45 мкм (Bio-Rad 162-0115) при 100 В в течение 2 ч методом влажного переноса ( Электрофоретическая ячейка Bio-Rad Mini Trans-Blot 170-3930). Мембраны блокировали в блокирующем буфере Odyssey (LiCOr 927-40010) в течение 1 часа, затем инкубировали в течение ночи при комнатной температуре в блокирующем буфере, содержащем антитела против UNC13A (1:500, Proteintech 55053-1-AP), TDP-43 (1:1000, Abnova H00023435-M01) или GAPDH (1:1000, Cell Signaling Technologies 5174S).Затем мембраны инкубировали в блокирующем буфере, содержащем конъюгированный с пероксидазой хрена (HRP) антимышиный IgG (H+L) (1:2000, Fisher 62-6520) или конъюгированный с пероксидазой хрена антикроличий IgG (H+L) (1:2000, Fisher 62-6520) 2000, Life Technologies 31462) за 1 час. Набор ECL Prime (Invitrogen) использовали для разработки блотов, которые визуализировали с помощью системы ChemiDox XRS+ (Bio-Rad). Интенсивность полос количественно определяли с использованием Фиджи, а затем нормализовали к соответствующим контролям.

Экстракция РНК, синтез кДНК и ОТ-кПЦР или ОТ-ПЦР для выявления сплайс-варианта

UNC13A в иПСК-МН

Тотальную РНК экстрагировали с использованием набора RNeasy Micro kit (Qiagen) в соответствии с инструкциями производителя, лизат пропускали через QIAshredder колонка (Qiagen) для максимального выхода.РНК количественно определяли с помощью Nanodrop (Thermo Scientific), при этом 75 нг использовали для синтеза кДНК с помощью SuperScript IV VILO Master Mix (Thermo Scientific). Количественную ПЦР проводили с 6 нг кДНК в реакционной смеси объемом 20 мкл с использованием PowerTrack SYBR Green Master Mix (Thermo Scientific) со считыванием на QuantStudio 6 Flex с использованием стандартных параметров циклирования (95°C в течение 2 мин, 40 циклов при 95°C в течение 15 с и 60°С в течение 60 с), с последующей стандартной диссоциацией (95°С в течение 15° с при 1,6°С с 90 277 -1 90 278 , 60°С в течение 60° с при 1.6 °C с −1 , 95 °C в течение 15  с при 0,075°C с −1 ). ΔΔ C t рассчитывали с помощью гена «домашнего хозяйства» RPLP0 в качестве контроля и релевантного shScramble в качестве эталона; измерено C t значения больше 40 были установлены на 40 для визуализации. См. дополнительную таблицу 6 для праймеров.

ПЦР проводили с вводом 15 нг кДНК в 100 мкл реакции с использованием мастер-микса NEBNext Ultra II Q5 (New England Biolabs) со следующими параметрами циклирования: начальная денатурация: 98 °C в течение 30 с; 40 циклов: 98 °С 10 с, 64 °С 30 с, 72 °С 20 с; окончательное удлинение: 72 °C в течение 2 мин.Полученные продукты визуализировали на 1,5% геле ТАЭ. См. дополнительную таблицу 6 для праймеров.

Нейроны, полученные из иПС-клеток человека, для обнаружения

вариантов сплайсинга UNC13A

кДНК была доступна в CRISPRi-i 3 Нейронные иПС-клетки (i 3 N), полученные из нашей предыдущей публикации 43 подавляется примерно до 50%. RT-qPCR проводили с использованием SYBR GreenER qPCR SuperMix (Invitrogen). Образцы анализировали в трех повторностях, а реакции RT-qPCR проводили на системе ПЦР в реальном времени QuantStudio 7 Flex (Applied Biosystems).Относительное количественное определение определяли с использованием метода ∆∆ C t и нормализовали к эндогенным контролям RPLP0 и GAPDH . Мы нормализовали относительные уровни транскриптов для UNC13A дикого типа к уровням нейронов, обработанных контрольной sgRNA (среднее значение равно 1). См. дополнительную таблицу 6 для праймеров.

Культура клеток для проверки дополнительных событий сплайсинга в нейронах, полученных из иПС-клеток

Мы использовали систему индуцированных нейронов (ИН), ранее созданную для быстрой дифференцировки иПС-клеток человека в функциональные нейроны коры 42 .Вкратце, iPS-клетки (без мутации заболевания) культивировали в условиях без фидера на матригеле (Fisher Scientific CB-40230) с использованием среды mTeSR1 (Stemcell Technologies 85850). Клетки трансдуцировали с помощью системы индукции Tet-On, которая обеспечивает экспрессию фактора транскрипции NGN2. Клетки диссоциировали на 3-й день дифференцировки и повторно высевали на планшеты для тканевых культур, покрытые матригелем, в нейробазальную среду (Thermo Fisher), содержащую нейротрофические факторы, BDNF и GDNF (R&D Systems) с трансдукцией вируса для shScramble или shTDP-43.РНК и белок экстрагировали через 7 дней после трансдукции.

Клонирование кшРНК, упаковка лентивирусов и клеточная трансдукция для проверки дополнительных событий сплайсинга Rev, pMD2.G) и трансдуцировали липофектамином 3000 (Invitrogen) в клетки HEK 293T, культивированные в стандартных условиях (DMEM, 10% FBS, пенициллин-стрептомицин).Вирусный супернатант собирали через 48 и 72 ч после трансфекции и концентрировали 1:100 с использованием концентратора Lenti-X (Takara).

Экстракция РНК, синтез кДНК и ОТ-кПЦР для проверки дополнительных событий сплайсинга

Тотальную РНК экстрагировали с помощью набора RNeasy Micro (Qiagen) и подвергали обратной транскрипции в кДНК с использованием наборов для обратной транскрипции кДНК высокой емкости (Invitrogen). Количественную ПЦР проводили с 2 нг кДНК в реакционной смеси объемом 10 мкл с использованием PowerTrack SYBR Green Master Mix (Thermo Scientific) со считыванием на QuantStudio 6 Flex с использованием стандартных параметров цикла.ΔΔ C t рассчитывали с использованием RPLP0 или GAPDH в качестве контролей гена-хозяина и соответствующих условий трансдукции shScramble в качестве эталона; измерено C t значения больше 40 были установлены на 40 для визуализации. См. дополнительную таблицу 6 для праймеров, используемых для обнаружения неправильно сплайсированных транскриптов и нормальных транскриптов сплайсинга, а также праймеров, используемых для внутреннего контроля.

Ампликонное секвенирование вариантов сплайсинга

Варианты сплайсинга в иПСК-МН были установлены с помощью ПЦР-амплификации от экзона 19 UNC13A до экзона 21 (UNC13A_19_21 FWD 5’–3’= CAACCTGGACAAGCGAACTG, UNC13A_19_21 AGCTCGACTG, UNC13A_19_21 AGCTATCGTAG 5G’-3′).Полученные продукты очищали с помощью колонок Wizard SV Gel и PCR Clean-Up (Promega) и подвергали NGS (Amplicon EZ, Genewiz). Адаптеры в файлах FASTQ были удалены с помощью trimmomatic (0,39) (ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). Затем качество полученных файлов оценивали с помощью FastQC (v0.11.9). Затем считывания секвенирования были сопоставлены с человеком (hg38) с использованием STAR v2.7.3a, следуя стандартным параметрам ENCODE. Затем уникально сопоставленные чтения были отфильтрованы для использования команды «samtools view -b -q 255».Затем был создан график сашими с использованием функции графика сашими в IGV (2.8.0) с минимальным покрытием соединений, установленным на 20. с FTLD-TDP и когнитивно нормальными контрольными людьми были получены из Mayo Clinic Florida Brain Bank. Диагноз был независимо установлен обученными неврологами и невропатологами при неврологических и патологических исследованиях соответственно.Письменное информированное согласие было дано всеми участниками или уполномоченными членами семьи, и все протоколы были одобрены Наблюдательным советом учреждения клиники Майо и Комитетом по этике. Комплементарная ДНК (кДНК), полученная из 500 нг РНК (RIN ≥ 7,0) из медиальной лобной коры, была доступна в предыдущем исследовании, а также совпадала с данными pTDP-43 из тех же образцов 43 . Следуя стандартным протоколам, RT-qPCR проводили с использованием SYBR GreenER qPCR SuperMix (Invitrogen) для всех образцов в трех повторностях.Реакции RT-qPCR проводили в системе ПЦР в реальном времени QuantStudio 7 Flex (Applied Biosystems). Относительное количественное определение определяли с использованием метода ∆∆ C t и нормализовали к эндогенным контролям RPLP0 и GAPDH . Мы нормализовали относительные уровни транскриптов к уровням здорового контроля (среднее значение равно 1). См. дополнительную таблицу 6 для праймеров.

Количественная оценка сплайс-вариантов

UNC13A в объемном секвенировании РНК

Данные секвенирования РНК, полученные когортой NYGC ALS Consortium, были загружены из базы данных NCBI Gene Expression Omnibus (GEO) (GSE137810, GSE124439, GSE1166522 и GSE1).Мы использовали 1658 доступных и прошедших контроль качества образцов, классифицированных как 11 . После предварительной обработки и сопоставления прочтений с человеческими (hg38), как описано ранее, мы оценили экспрессию полноразмерного UNC13A с использованием RSEM (v1.3.2). Дубликаты PCR были удалены с помощью MarkDuplicates из Picard Tools (2.23.0) с помощью команды «MarkDuplicates REMOVE_DUPLICATES=true CREATE_INDEX=true». Затем мы отфильтровали уникально сопоставленные чтения, используя команду «samtools view -b -q 255». Прочтения, которые охватывают соединение экзон 19-экзон 20, соединение экзон 20-CE, соединение CE-экзон 21 или соединение экзон 20-экзон 21, количественно определяли с использованием Bedtools (2.27.1) с помощью команды «bedtools intersect -split». Из-за относительно низкого уровня экспрессии UNC13A в посмертных тканях и гетерогенности тканей возможно, что не все ткани имеют достаточно обнаруживаемый UNC13A , чтобы мы могли обнаружить варианты сплайсинга. Поскольку UNC13A содержит более 40 экзонов, а покрытия РНК-секвенциями транскриптов мРНК часто неравномерно распределены 44 , мы рассмотрели считывания, охватывающие соединение экзон 19–экзон 20, которое включено как в канонический вариант изоформы, так и в вариант вариант сплайсинга, и существует сильная корреляция (Pearson’s r  = 0.99) между количеством прочтений, картированных на стыке экзон 19-экзон 20 и стыке экзон 20-экзон 21. Мы наблюдали, что образцы, которые имеют по крайней мере 2 чтения, охватывающих либо соединение экзон 20-CE, либо соединение CE-экзон 21, имеют по крайней мере либо UNC13A TPM = 1,55, либо 20 прочтений, охватывающих соединение экзон 19-экзон 20. Поэтому мы выбрали 1151 образец, который имел TPM ≥ 1,55 или не менее 20 прочтений, сопоставленных с соединением экзон 19–экзон 20, в качестве образцов, подходящих для анализа вариантов сплайсинга UNC13A .

Гибридизация in situ

UNC13A Анализ КЭ в посмертных образцах мозга
Пациенты и диагностическая нейропатологическая оценка

Посмертные образцы мозговой ткани, использованные для этого исследования, были получены из банка нейродегенеративных заболеваний Калифорнийского университета в Сан-Франциско (UCSF) (дополнительная таблица) 4). В дополнительной таблице 4 представлены демографические, клинические и невропатологические данные. Согласие на донорство мозга было получено от субъектов или их заместителей, принимающих решения, в соответствии с Хельсинкской декларацией и в соответствии с процедурой, одобренной Комитетом UCSF по исследованиям человека.Свежий мозг нарезали на пластины коронарной кости толщиной 1 см и чередующиеся срезы фиксировали в 10% нейтральном забуференном формалине на 72 часа. Блоки медиального лобного полюса вырезали из фиксированных коронарных плит, подвергали криозащите в градуированных растворах сахарозы, замораживали и разрезали на срезы толщиной 50 мкм, как описано ранее 45 . Клинический и нейропатологический диагноз был выполнен, как описано ранее 45 . Субъектов отбирали на основе клинической и нейропатологической оценки.Отобранные пациенты имели первичный клинический диагноз поведенческого варианта лобно-височной деменции (bvFTD) с боковым амиотрофическим склерозом или без него или болезнью двигательных нейронов и невропатологический диагноз FTLD-TDP, тип B. Мы исключили субъектов, если у них была известная мутация, вызывающая заболевание, посмертный интервал ≥ 24 часов, болезнь Альцгеймера, невропатологические изменения> низкие, фаза амилоида Тала > 2, стадия нейрофибриллярного клубка по Брааку > 4, плотность нейритных бляшек по CERAD> редкая и болезнь с тельцами Леви> преобладает в стволе мозга 45 .

Гибридизация in situ и иммунофлуоресценция

Для обнаружения одиночных молекул РНК использовали набор BaseScope Red Assay (ACDBIO, США). Для окрашивания использовали один фиксированный замороженный срез ткани толщиной 50 мкм от каждого субъекта. При необходимости эксперименты проводили в условиях отсутствия РНКазы. Использовали зонды, нацеленные на интересующий транскрипт, UNC13A , специфичные либо к мРНК (соединение экзон 20–экзон 21), либо к скрытому экзону, содержащему сплайс-мишень (экзон 20–соединение скрытого экзона).Также были включены положительные ( Homo Sapiens PPIB) и отрицательные ( Escherichia coli DapB) контрольные пробы. Гибридизацию in situ проводили в соответствии со спецификациями поставщиков набора для анализа BaseScope Red. Вкратце, срезы замороженных тканей промывали в PBS и помещали в камеру для выращивания со светодиодами (HTG Supply, LED-6B240) на 48 часов при 4 °C для подавления аутофлуоресценции тканей. Срезы быстро промывали в PBS и блокировали на активность эндогенной пероксидазы. Срезы переносили на предметные стекла и сушили в течение ночи.Предметные стекла подвергали целевому поиску и обработке протеазой, а затем переходили к ISH. Зонды выявляли с помощью TSA Plus-Cy3 (Akoya Biosciences) и подвергали иммунофлуоресцентному окрашиванию антителами к TDP-43 (кроличьи поликлональные, Proteintech, RRID: AB_615042, разведение 1:4000, каталожный (кат.) № 10782-2- AP) и NeuN (поликлональная морская свинка, Synaptic Systems, разведение 1:500; каталожный номер 266004) и контрастно окрашены DAPI (Life Technologies) для ядер.

Получение и анализ изображений

Z -изображения стопки были получены с помощью конфокального микроскопа Leica SP8 с масляным иммерсионным объективом 63x (1.4 НП). Для зондов РНК параметры захвата изображения были установлены во время первоначального сбора данных на основе сигнала PPIB и DAPB и оставались постоянными для зондов UNC13A и субъектов. Настройки захвата изображений TDP-43 и NeuN были изменены на основе различий в интенсивности окрашивания между случаями. Для каждого случая было получено 6 неперекрывающихся изображений Z в слоях коры 2–3. Пункты РНК для загадочного экзона UNC13A были количественно определены с использованием плагина «анализировать частицы» в ImageJ.Вкратце, все изображения были скорректированы по яркости с использованием аналогичных параметров и преобразованы в проекции максимальной интенсивности Z , изображения были скорректированы для автопорога (интермоды) и подсчитаны точки (размер: 6-бесконечность, округлость: 0–1). ).

Анализ неравновесного сцепления

Повторно откалиброванные файлы VCF 297 пациентов с БАС европейского происхождения, сгенерированные GATK HaplotypeCallers, были загружены с сайта Answer ALS в июле 2020 г. (https://www.answerals.org). VCFtools (0.1.16) использовали для фильтрации сайтов, находящихся в интронах 20–21.Отфильтрованные файлы VCF были объединены с помощью BCFtools (1.8). Поскольку существуют сайты, содержащие более 2 аллелей, мы проверили независимость генотипа с помощью статистики хи-квадрат с помощью команды «vcftools–geno-chisq–min-аллели 2–макс-аллели 8». Мы нашли две дополнительные SNP, RS56041637 ( P <0.0001 с RS12608932, P <0,0001 с RS12973192), и RS62121687 ( P <0,0001 с RS1608932, P <0,0001 с RS12973192), которые находятся в неравновешении связи обе.Однако, поскольку rs62121687 был включен в GWAS и имеет значение P 35 , равное 0,0186585, мы исключили его из дальнейшего анализа.

Определение генотипа SNP rs12608932 и rs12973192 в посмертном мозге человека

Геномную ДНК (гДНК) экстрагировали из лобной коры человека с использованием набора Wizard Genomic DNA Purification Kit (Promega) в соответствии с инструкциями производителя. Анализы генотипирования TaqMan SNP проводили на 20 нг гДНК на анализ с использованием коммерческой предварительной смеси, состоящей из пары праймеров и меченных VIC или FAM зондов, специфичных для каждого SNP (кат.нет. 4351379, идентификатор анализа 43881386_10 для rs12608932 и 11514504_10 для rs12973192, Thermo Fisher Scientific), и запустить в системе ПЦР в реальном времени QuantStudio 7 Flex (Applied Biosystems) в соответствии с инструкциями производителя. Программы ПЦР: 60°С в течение 30 с, 95°С в течение 10 мин, 40 циклов 95°С в течение 15 с и 60°С (rs12973192) или 62,5°С в течение 1 мин (rs12608932) и 60°С. на 30 с.

Репортерный анализ сплайсинга

Минигенные конструкции были разработаны in silico, синтезированы с помощью GenScript и субклонированы в вектор с контролем сплайсинга GFP.Нокаутные клетки HEK 293T TDP-43 и исходные клетки HEK 293T высевали в стандартные планшеты для тканевых культур P12 (при 1,6 × 10 5 клеток на лунку), оставляли прикрепляться в течение ночи и трансфицировали указанными репортерными конструкциями сплайсинга (400 нг на лунку) с использованием реагента для трансфекции Lipofectamine 3000 (Invitrogen). Каждый репортер содержал один из модулей сплайсинга (показан на рис. 4d), который экспрессируется с двунаправленного промотора. Через 24 часа после трансфекции из этих клеток выделяли РНК с использованием мини-набора PureLink RNA (Life Technologies) в соответствии с протоколом производителя с обработкой на колонке ДНКазой PureLink (Invitrogen).РНК подвергали обратной транскрипции в кДНК с использованием набора для обратной транскрипции кДНК высокой емкости (Invitrogen) в соответствии с инструкциями производителей. ПЦР проводили с использованием OneTaq 2X Master Mix со стандартным буфером (NEB) со следующими параметрами циклирования: денатурация: 94°C в течение 30 с; 30 циклов: 94 °С 20 с, 54 °С 30 с, 68 °С 30 с; окончательное удлинение: 68 ° C в течение 5 минут на термоциклере Mastercycler Pro (Eppendorf) для ПЦР. Продукты ПЦР разделяли электрофорезом на 1.5% гель TAE и визуализированная система ChemiDox XRS+ (Bio-Rad). См. дополнительную таблицу 6 для праймеров.

Анализ для оценки влияния вариантов rs12973192, rs12608932 и rs56041637 на сплайсинг субклонировали в вектор с контролем сплайсинга GFP. Нокаутные клетки HEK 293T TDP-43 и исходные клетки HEK 293T высевали в стандартные планшеты для тканевых культур P12 (при 5 × 10

5 клеток на лунку), оставляли прикрепляться в течение ночи и трансфицировали указанными репортерными конструкциями сплайсинга (400 нг на лунку). хорошо) с использованием реагента для трансфекции Lipofectamine 3000 (Invitrogen).Через 24 часа после трансфекции из этих клеток выделяли РНК с использованием набора PureLink RNA Mini Kit (Life Technologies) в соответствии с протоколом производителя с обработкой PureLink ДНКазой на колонке. РНК подвергали обратной транскрипции в кДНК с использованием набора для обратной транскрипции кДНК высокой емкости (Invitrogen) в соответствии с инструкциями производителей. Сигнал скрытого экзона UNC13A измеряли с использованием пары праймеров, которые обнаруживают соединение CE и экзона mCherry непосредственно ниже по течению.Сплайсинг eGFP измеряли с помощью пары праймеров, обнаруживающих соединение первого и второго экзонов eGFP. Пару праймеров, которые были картированы во втором экзоне eGFP, использовали для измерения эффективности трансфекции репортерной конструкции сплайсинга и использовали в качестве нормализатора. ΔΔ C t рассчитывали, используя уровень сигнала скрытого экзона или сплайсинг eGFP в нокаутных клетках HEK 293T TDP-43, экспрессирующих референтный репортер, несущий эталонный гаплотип, в качестве эталона.См. дополнительную таблицу 6 для праймеров.

Спасение сплайсинга UNC13A с использованием конструкций со сверхэкспрессией TDP-43 лунка), оставляли прилипать на ночь и трансфицировали репортерной конструкцией сплайсинга, несущей эталонный гаплотип (400 нг на лунку; рис. 4e) и указанными конструкциями сверхэкспрессии TDP-43 (600 нг на лунку) с использованием реагента для трансфекции Lipofectamine 3000 (Invitrogen). .Через 24 часа после трансфекции из этих клеток выделяли РНК с использованием набора PureLink RNA Mini Kit (Life Technologies) в соответствии с протоколом производителя с обработкой PureLink ДНКазой на колонке. РНК подвергали обратной транскрипции в кДНК с использованием набора для обратной транскрипции кДНК высокой емкости (Invitrogen) в соответствии с инструкциями производителей. Количественную ПЦР проводили с 8 нг кДНК в реакционной смеси объемом 10 мкл с использованием PowerTrack SYBR Green Master Mix (Thermo Scientific) со считыванием на QuantStudio 6 Flex с использованием стандартных параметров цикла.

Сигнал скрытого экзона UNC13A измеряли с использованием пары праймеров, которые обнаруживают соединение CE и экзона mCherry непосредственно ниже него. Пару праймеров, которые картированы во втором экзоне eGFP, использовали для измерения эффективности трансфекции репортерной конструкции сплайсинга и использовали в качестве нормализатора. ΔΔ C t рассчитывали, используя в качестве эталона уровень сигнала скрытого экзона в клетках HEK 293T дикого типа без конструкций со сверхэкспрессией TDP-43.См. дополнительную таблицу 6 для праймеров.

Уровни экспрессии конструкций со сверхэкспрессией измеряли с использованием пары праймеров, обнаруживающих второй экзон TDP-43. Праймеры обнаруживают эндогенный TDP-43, но поскольку нокаутные клетки HEK 293T TDP-43 не имеют экспрессии TDP-43, как показано ранее 36 , использование праймеров не мешает измерению уровней экспрессии TDP-43. конструкции в нокаутных клетках. ΔΔ C t рассчитывали с использованием уровня экспрессии TDP-43 в нокаутных клетках HEK 293T TDP-43 с полноразмерными конструкциями со сверхэкспрессией TDP-43 в качестве эталона. RPLP0 и GAPDH использовали в качестве внутреннего контроля. См. дополнительную таблицу 6 для праймеров.

Генерация минигенной конструкции pTB

UNC13A

Минигенная конструкция pTB UNC13A , содержащая последовательность скрытого экзона человека UNC13A и фланкирующие нуклеотидные последовательности выше по течению (50 п.н. , и всю последовательность интрона 20 выше скрытого экзона) и ниже (примерно 300 п.н. интрона 20) скрытого экзона амплифицировали из геномной ДНК человека с использованием следующих праймеров: FWD 5′-3′, AGGTCATATGCACTGCTATAGTGGGAAGTTC и RVS 5 ‘–3’, CTTACATATGTAATAACTCAACCACACTTCCATC; и субклонировали в сайт NdeI вектора pTB.Ранее мы использовали аналогичный подход для изучения регуляции сплайсинга TDP-43 других мишеней TDP-43 46 .

Спасение сплайсинга

UNC13A с использованием минигена pTB и конструкций сверхэкспрессии TDP-43 % пенициллин/стрептомицин (Gibco). Для экспериментов по двойной трансфекции и нокдауну клетки сначала трансфицировали 1,0 мкг минигенной конструкции pTB UNC13A и 1.0  мкг одной из следующих плазмид: GFP, GFP-TDP-43 или GFP-TDP-43. Липофектамин 2000 в соответствии с инструкциями производителя (Invitrogen). Через четыре часа после трансфекции среду заменяли полной средой, содержащей siLentfect (Bio-Rad) и комплексы миРНК (AllStars Neg. Control миРНК или миРНК против TARDBP 3′-нетранслируемой области, области, не включенной в конструкции сверхэкспрессии TDP-43). (Qiagen) в соответствии с протоколом производителя.Циклогексимид (Sigma) добавляли в конечной концентрации 100 мкг мл -1 за 6 ч до сбора клеток. Затем из клеток выделяли РНК с помощью реагента TRIzol (Zymo Research), следуя инструкциям производителя. Приблизительно 1 мкг РНК превращали в кДНК с использованием набора для обратной транскрипции кДНК высокой емкости с ингибитором РНК (Applied Biosystems). Анализ RT-qPCR проводили на кДНК (разведенной 1:40) с помощью SYBR GreenER qPCR SuperMix (Invitrogen) с использованием системы ПЦР в реальном времени QuantStudio7 Flex (Applied Biosystems).Все образцы были проанализированы в трехкратной повторности. Программа RT-qPCR была следующей: 50°С в течение 2 мин, 95°С в течение 10 мин и 40 циклов 95°С в течение 15 с и 60°С в течение 1 мин. Для кривых диссоциации в конце программы была добавлена ​​стадия диссоциации 95°С в течение 15 с, 60°С в течение 1 мин и 95°С в течение 15 с. Относительное количественное определение определяли с использованием метода ∆∆ C t и нормализовали к эндогенным контролям RPLP0 и GAPDH . Мы нормализовали относительные уровни транскриптов для дикого типа UNC13A и GFP к уровню контрольного состояния siRNA (среднее значение равно 1).См. дополнительную таблицу 6 для праймеров.

Исследования связывания TDP-43 in vitro

Клонирование

Плазмида, кодирующая TDP43 в виде С-концевого белка, меченного MBP (TDP43–MBP–His 6 ), была приобретена у Addgene (#104480).

Бактериальный рост и экспрессия белка

Экспрессионную плазмиду TDP-43 дикого типа трансформировали в клетки E. coli One Shot BL21 Star (DE3) (ThermoFisher). Трансформированные E. coli выращивали при 37 °C в 1 л среды LB с добавлением 0.2% декстрозы и 50 мкг мл -1 канамицина до тех пор, пока поглощение при 600 нм не достигнет 0,5–0,6. Затем культуру инкубировали при 4 °С в течение 30–45 мин. Экспрессию TDP-43 индуцировали 1 мМ IPTG в течение 16 часов при 4 °C. Клетки собирали центрифугированием.

Очистка рекомбинантного TDP-43

TDP-43-MBP дикого типа очищали, как описано 48 . Вкратце, клеточные осадки ресуспендировали в лизирующем буфере 1 М NaCl, 20 мМ Трис (рН 8,0), 10 мМ имидазола, 10% глицерина и 2,5 мМ 2-меркаптоэтанола и добавляли полные, не содержащие ЭДТА таблетки коктейля ингибитора протеазы (Roche). затем лизируют с помощью ультразвука.Клеточные лизаты центрифугировали при 31 400 g при 4°C в течение 1 ч, фильтровали, затем очищали с помощью FPLC с использованием колонки XK 50/20 (Cytiva), заполненной агарозными шариками Ni-NTA (Qiagen), которые уравновешивали в лизирующем буфере. TDP-43 извлекали с помощью градиентной элюции 0–80% с использованием 1 М NaCl, 20 мМ TrisHCl (pH 8,0), 10 мМ имидазола, 10 % глицерина и 2,5 мМ 2-меркаптоэтанола в качестве основного буфера и 1 М NaCl, 20 мМ. TrisHCl (pH 8,0), 500 мМ имидазола, 10% глицерина и 2,5 мМ 2-меркаптоэтанола в качестве буфера для элюирования.Элюированный белок концентрировали с использованием центрифужных фильтров Amicon Ultra-15, MWCO 50 кДа (Millipore), фильтровали и далее очищали эксклюзионной хроматографией с использованием колонки 26/600 Superdex 200 мкг (Cytiva), уравновешенной 300 мМ NaCl, 20 мМ TrisHCl ( рН 8,0) и 1 мМ ДТТ. Второй из трех пиков, оцененных по поглощению при 280 нм, собирали, центрифугировали, как и раньше, разделяли на аликвоты, мгновенно замораживали в жидкости N 2 и хранили при -80°С до дальнейшего использования. Концентрации белка определяли по поглощению при 280 нм (Nanodrop), а чистоту определяли путем переноса образцов на 4–20% гель SDS-PAGE и визуализировали с помощью красителя Кумасси.

Анализ сдвига подвижности с помощью электрофореза

EMSA использовали для сравнения связывания TDP-43 с последовательностями эталонной и рисковой РНК для эталонных и рискованных аллелей CE (rs12973192), интрона (rs12608932) и повторяющихся последовательностей (rs56041637) (см. дополнительную таблицу). 5). Возрастающие концентрации TDP-43 в диапазоне от 0 до 4 мМ инкубировали с постоянной концентрацией 1 нМ РНК в буфере (50 мМ трис-HCl, pH 7,5, 100 мМ KCl, 2 мМ MgCl2, 100 мМ β-меркаптоэтанол, 0,1 мг мл). -1 БСА) в течение 30 мин при комнатной температуре.РНК имеет двойную метку (Cy3 и Cy5) и содержит 18-нуклеотидный частичный дуплекс на 3′-конце. Реакции смешивали с загрузочным красителем и запускали на 6% неденатурирующем полиакриламидном геле и визуализировали в режиме флуоресценции (Cy5) на сканере Typhoon. Связанные фракции определяли с помощью подключаемого модуля Analyze Gel в ImageJ и нормализовали по общей интенсивности на дорожку. Кажущуюся аффинность связывания рассчитывали с использованием функции «Специфическое связывание с уклоном холма» в Graphpad.

Статистические методы

Кривые выживаемости сравнивали с использованием функции коксфа в выживаемости (3.1.12) R-пакет, который согласуется с многомерной моделью пропорциональных рисков Кокса, которая включает пол, зарегистрированные генетические мутации и возраст на момент начала заболевания, а также выполняет критерий оценки (логарифмический ранг). Величину эффекта сообщают как отношение опасности. Предположения о пропорциональных опасностях были проверены с использованием функции cox.zph. Кривые выживания были построены с помощью ggsurvplot в пакете suvminer (v.0.4.8) R. Линейные модели смешанных эффектов были проанализированы с использованием пакета lmerTest R (3.1.3). Статистический анализ проводился с использованием R (версия 4.0.0) или Prism 8 (GraphPad), которые также использовались для построения графиков.

Сводка отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета об исследовании природы, связанном с этим документом.

Минутку…

Включите Cookies и перезагрузите страницу.

Этот процесс выполняется автоматически. Вскоре ваш браузер перенаправит вас на запрошенный вами контент.

Пожалуйста, подождите 5 секунд…

Перенаправление…

+((!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+!![]+!![] +[])+(!+[]+(!![])+!![]+!![])+(+!![])+(!+[]-(!![])) +(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+!![])+(!+[] +(!![])+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![ ]+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![] +!![])+(+!![]))/+((!+[]+(!![])+!![]+!![]+!![]+!![] +[])+(!+[]+(!![])+!![]+!![]+!![]+!![])+(!+[]+(!![] )+!![]+!![]+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![]) -[])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![])+(!+[]+ (!![])+!![]+!![]+!![]+!![]+!![]+!![])+(!+[]-(!![]) )+(+!![])+(!+[]+(!![])-[]))

+((!+[]+(!![])+!![]+! ![]+!![]+!![]+!![]+!![]+[])+(!+[]+(!![])+!![]+!![] +!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+!![]) +(!+[]+(!![])+!![]+!![]+!![])+(!+[]+(!![])+!![]+!! []+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![ ]+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![] +!![])+(!+[]-(!![]))+(!+[]+(!![])+!![]))/+((!+[]+( !![])+!![]+!![]+!![]+[])+(!+[]+(!![])+!![]+!![]+!! []+!![]+!![])+(!+[]-(!![]))+(!+[]+(!![])+!![]+!![] +!![]+!![]+!![]+!![])+(!+[]+(!![] )+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![])+(!+[]-(! ![]))+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![])+(!+[] +(!![])+!![]))

+((!+[]+(!![])+!![]+!![]+!![]+!![] +!![]+!![]+[])+(!+[]+(!![])+!![])+(!+[]+(!![])+!![ ]+!![]+!![]+!![]+!![]+!![])+(!+[]-(!![]))+(!+[]+(! ![])+!![]+!![])+(+!![])+(!+[]+(!![])+!![]+!![]+!![ ]+!![])+(!+[]+(!![])+!![]+!![])+(+!![]))/+((!+[]+( !![])+!![]+[])+(!+[]+(!![])+!![]+!![]+!![]+!![])+( !+[]-(!![]))+(!+[]+(!![])+!![]+!![]+!![])+(!+[]+(! ![])+!![]+!![])+(!+[]-(!![]))+(!+[]+(!![])+!![]+!! []+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![ ])+(!+[]+(!![])+!![]))

+((!+[]+(!![])+!![]+!![]+! ![]+!![]+!![]+!![]+!![]+[])+(!+[]+(!![])+!![]+!![] )+(+!![])+(!+[]-(!![]))+(!+[]+(!![])+!![]+!![]+!![ ]+!![]+!![]+!![])+(!+[]+(!![])+!![])+(!+[]+(!![])+ !![]+!![]+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+! ![]+!![]+!![]+!![]+!![]+!![])+(+!![]))/+((!+[]+(!! [])+!![]+!![]+!![]+!![]+[])+(!+[]-(!![]))+(!+[]+(! ![])-[])+(!+[]+(!![])+!![]+!![])+(!+[]+(!![])+!![] +!![]+!![]+!![]+!![]+!![]+ !![])+(!+[]+(!![])-[])+(!+[]+(!![])+!![]+!![])+(!+ []+(!![])+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+! ![]+!![]))

+((!+[]+(!![])+!![]+!![]+!![]+!![]+!![ ]+!![]+!![]+[])+(!+[]+(!![])+!![]+!![])+(+!![])+(! +[]-(!![]))+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+ !![])+(!+[]+(!![])+!![])+(!+[]+(!![])+!![]+!![]+!! []+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![ ]+!![]+!![]+!![])+(+!![]))/+((+!![]+[])+(!+[]-(!![ ]))+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+!![]+!![ ])+(!+[]+(!![])+!![]+!![])+(!+[]+(!![])+!![]+!![]+ !![]+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![])+ (!+[]+(!![])+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![ ]+!![]+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![] +!![]))

+((!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+! ![]+!![]+[])+(!+[]+(!![])+!![]+!![])+(+!![])+(!+[] -(!![]))+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+!![ ])+(!+[]+(!![])+!![])+(!+[]+(!![])+!![]+!![]+!![]+ !![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+! ![]+!![]+!![])+(+!![]))/+((!+[]+(!![])+!![]+!![]+! ![]+!![]+!![]+!![]+[])+(!+ []+(!![])-[])+(!+[]+(!![])-[])+(!+[]+(!![])+!![]+! ![])+(!+[]+(!![])+!![]+!![]+!![])+(!+[]+(!![])+!![ ]+!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![] +!![]+!![]+!![]+!![]+!![])+(!+[]+(!![])+!![]+!![]+ !![]+!![]+!![]+!![]+!![])+(!+[]+(!![])-[]))

+((!+ []+(!![])+!![]+!![]+!![]+!![]+!![]+!![]+!![]+[])+( !+[]+(!![])-[])+(!+[]-(!![]))+(!+[]+(!![])+!![]+!! [])+(+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+ !![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+! ![])+(!+[]+(!![])-[])+(!+[]+(!![])+!![]))/+((+!![] +[])+(+!![])+(!+[]+(!![])+!![])+(!+[]+(!![])+!![]+ !![]+!![]+!![]+!![])+(+!![])+(!+[]+(!![])+!![]+!![ ]+!![]+!![])+(!+[]-(!![]))+(!+[]+(!![])+!![]+!![]) +(+!![]))

+((!+[]+(!![])+!![]+!![]+!![]+!![]+!![] +!![]+[])+(!+[]+(!![])+!![])+(!+[]+(!![])+!![]+!![ ]+!![]+!![]+!![]+!![])+(!+[]-(!![]))+(!+[]+(!![])+ !![]+!![])+(+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![ ])+(!+[]+(!![])+!![]+!![])+(+!![]))/+((!+[]+(!![]) +!![]+!![]+[])+(!+[]+(!![])+!![])+(!+[]+(!![])+!![ ]+!![]+!![]+!![]+!![]+!![] )+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+!![]+!![]) +(!+[]+(!![])+!![]+!![]+!![])+(!+[]+(!![])+!![]+!! []+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![ ]+!![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![] +!![]+!![])+(!+[]+(!![])+!![]+!![]+!![]+!![]+!![]+ !![]+!![]))

.

Добавить комментарий

Ваш адрес email не будет опубликован.