Фортранс в какой воде растворять: Подготовка к колоноскопии препаратом «ФОРТРАНС»

Содержание

Подготовка к диагностическим исследованиям

Подготовка к ирригоскопии

Накануне исследования пообедать примерно в 11.00 – 12.00, затем до самого исследования твердую пищу принимать нежелательно (можно бульон, кисель, соки и т.п.), прием жидкости (вода, чай) не ограничивать.

2 пакета фортранса растворить в 2-х литрах воды (лучше прохладной) и выпить в течение 2-х часов примерно с 14.00 до 16.00 вечером (накануне). Действие препарата проявляется в виде обильного многократного жидкого стула. Если не приятен (приторно-сладкий) вкус препарата, то можно выжимать в приготовленный раствор сок лимона или запивать чем-нибудь кислым.

Утром легкий завтрак (сладкий чай и бутерброд).

Если принимаете постоянно какие-либо лекарственные препараты (сердечные, гормональные и др.), то надо продолжить их прием, но не одновременно с фортрансом.

Чем тщательнее подготовлен кишечник, тем лучше качество обследования.

Показатель эффективной очистки кишечника, отсутствие каловых масс при испражнении.

На обследование необходимо при себе иметь простынь.

Подготовка к колоноскопии(ФКС)

Накануне исследования пообедать примерно в 14.00 – 15.00, затем до самого исследования твердую пищу принимать нежелательно (можно бульон, кисель, соки и т.п.), прием жидкости(вода, чай) не ограничивать.

3 пакета фортранса растворить в 3-х литрах воды (лучше прохладной) и выпить в течение 3-х часов примерно с 16.00 до 19.00 вечером (накануне). Действие препарата проявляется в виде обильного многократного жидкого стула. Если не приятен (приторно-сладкий) вкус препарата, то можно выжимать в приготовленный раствор сок лимона или запивать чем-нибудь кислым.

1 оставшихся пакета фортранса растворить утром в день исследования в 2-х литрах воды и выпить примерно с 5.00 до 6.00.

Если по какой-либо причине не удается выпить фортранс, нужно вечером и утром сделать по 3-4 очистительные клизмы(из кружки Эсмарха, вводя каждый раз по 1,5 – 2.0 литра воды)

Если принимаете постоянно какие-либо лекарственные препараты (сердечные, гормональные и др. ), то надо продолжить их прием, но не одновременно с фортрансом.

Можно выпить какое-либо обезболивающее примерно за 1 час до исследования (при частых болях в животе).

Чем тщательнее подготовлен кишечник, тем лучше качество обследования.

Показатель эффективной очистки кишечника, отсутствие каловых масс при испражнении.

На обследование необходимо при себе  иметь простынь, можете одеть сменные облегающие трусы (разрезаются для проведения аппарата).

Правила забора мочи для бактериологического исследования.

Исследованию подлежит средняя порция свободно выпущенной мочи, в количестве 3-5 мл в стерильную посуду после тщательного туалета наружных половых органов.

Туалет наружных половых органов:

Утром необходимо подмыться теплой водой с хозяйственным мылом (для мужчин туалет с отодвиганием крайней плоти) и промокнуть оставшиеся капли воды стерильной салфеткой или чистым проглаженным утром полотенцем. Открыть банку и собирать среднюю порцию мочи, не задевая баночкой наружные половые органы. Аккуратно закрыть банку.

Доставка в лабораторию строго в течение 1-2 часов.

ПРАВИЛА СБОРА КАЛА ПРИ ИССЛЕДОВАНИИ МИКРОФЛОРЫ КИШЕЧНИКА (ДИСБАКТЕРИОЗ)  

  1. Все обследуемые пациенты за 1-3 дня до взятия пробы должны находиться на диете, исключающей приём продуктов, усиливающих процессы брожения в кишечнике и молочно-кислые продукты, также алкоголь, антибиотики и бактерийные препараты (содержащие бифидобактерии, лактобактерии, кишечные палочки и т.д.).

  2. Материалом служит кал после естественной дефекации, который собирают в чистый одноразовый контейнер с завинчивающейся крышкой и ложечкой.

  3. Не рекомендуется собирать кал из унитаза.

  4. Собирают кал на чистую поверхность, в качестве которой может быть использован чистый новый лист (пакет) из полиэтилена или бумаги (этот способ является предпочтительным).

  5. При использовании судна, его предварительно хорошо промывают с мылом и губкой, ополаскивают многократно водопроводной водой, а потом обдают кипятком и остужают.  

Кал берут преимущественно из средней порции специальной ложечкой, вмонтированной в крышку стерильного контейнера, в количестве не более 1/3 от объема контейнера. Не наполняйте контейнер доверху. Тщательно закройте крышку.

Подготовка к анализам

Кровь нужно сдать натощак, т.е. между последним приемом пищи и взятием крови должно пройти не менее 8-12 часов. Следует воздержаться от сока, чая, кофе. За сутки необходимо исключить прием алкоголя, в течение часа рекомендуется воздержаться от курения.

Перед сбором мочи нужно произвести гигиенический туалет половых органов и отобрать первую порцию утренней мочи (среднюю порцию), выделенную сразу же после сна.

P.S. Не стесняйтесь спрашивать мы дадим подробные, понятные Вам рекомендации.

Дополнительную информацию можно получить по телефону: 30-49-55.

Узнаем как принимать «Фортранс» при подготовке к колоноскопии

Колоноскопия – это специальная процедура, позволяющая исследовать внутреннюю оболочку толстого кишечника. При проведении данного исследования можно выявить различные заболевания толстой кишки: язвы, воспаления, полипы и другие. Данная процедура имеет большое значение, так как при ее проведении врач может осмотреть слизистую оболочку кишечника, что позволяет распознавать и лечить различные болезни на ранних стадиях. Очень важно правильно подготовиться к процедуре, так как это позволит быстро и качественно провести колоноскопию, избежав при этом каких-либо осложнений. Обязательно проводят полную очистку желудочно-кишечного тракта. Наиболее часто используется препарат «Фортранс», способ применения которого рассмотрим в этой статье. Это средство имеет форму порошка, который необходимо растворять в воде из расчета: один пакетик на 25 кг веса пациента. Данное средство удобно тем, что оно заменяет сразу несколько клизм, поэтому при подготовке к эндоскопическому исследованию кишечника многих людей интересует вопрос о том, как принимать «Фортранс» перед колоноскопией.

Общая подготовка к процедуре

Очень важный этап – предварительная подготовка к колоноскопии. Чтобы все сделать правильно, необходимо за несколько дней до исследования перестать принимать (если их прием был) такие препараты как «Имодиум» или «Лоперамид». Это связано с тем, что данные лекарственные средства обладают закрепляющим эффектом и способны снизить моторику кишечника. Кроме того, нужно перестать принимать пищу, которая богата клетчаткой, стараться выбирать еду более легкую и пить больше жидкости. За день перед процедурой можно покушать около двух часов дня, после этого необходимо прекратить прием пищи до следующего дня — до того момента, как завершится процедура.

Как принимать «Фортранс» при подготовке к колоноскопии

Подготовиться к эндоскопическому исследованию можно одним из двух способов: используя для очищения кишечника клизмы или применяя лекарство «Фортранс», описание которого подробно изложено в инструкции к препарату. Рассмотрим второй вариант. Для приготовления раствора необходимо содержимое одного пакета растворить в литре воды. В день перед обследованием нужно пить раствор маленькими глотками в течение трех-шести часов, начиная с середины дня. Как принимать «Фортранс» правильно, подскажет инструкция к препарату, которая указывает на то, что пить разведенную смесь нужно также утром в день проведения процедуры. С того момента, как начал использоваться «Фортранс», следует прекратить прием пищи. Количество разведенной жидкости должно удовлетворять условию: 1 литр лекарственного состава на 20 кг веса. 

Часто при большом количестве выпитого лекарства «Фортранс» появляется чувство тошноты, чтобы этого не происходило, можно использовать лимон. Достаточно просто выдавить несколько капель сока лимона на язык и чувство тошноты отступит. Также избежать неприятных ощущений поможет охлаждение приготовленного раствора. Но не следует забывать, что назначить лекарство и объяснить, как принимать «Фортранс», пациенту может только врач.

БУ «Центральная городская больница» Минздрава Чувашии

Подготовка к фиброколоноскопии (ФКС)

Колоноскопия — эндоскопическое исследование, во время которого визуально, то есть под контролем зрения, оценивается состояние слизистой оболочки толстой кишки. Исследование выполняется гибкими эндоскопами. В качестве источника света служит осветитель, работающий на галогеновой или ксеноновой лампе, то есть используется так называемый «холодный « свет, что исключает ожог слизистой.

Врач должен знать, не принимаете ли вы антикоагулянты и инсулин.

Если Вы постоянно принимаете препараты железа, то их надо отменить за 4 дня до исследования. Остальные лекарства, как в таблетках, так и в ингаляторах можно принимать и использовать вплоть до исследования.

За три дня до исследования рекомендована бесшлаковая диета, полностью исключаются фрукты и овощи в любом виде: капуста, бобовые (бобы, горох, фасоль), картофель, помидоры, лук и пр., молоко, варенье, хлеб зерновой, ягоды, в том числе в составе йогуртов и выпечки, орехи. Окрашенные соки, алкоголь, газированные напитки. Колбасные изделия.

Можно есть: нежирное мясо, предпочтительнее отварное (в том числе мясо птицы), рыбу нежирных сортов (карпов, судак, речная форель), яйца не более 2-3-х в день, сыр, творог, соки без мякоти, чай (без молока), кефир, желе, сахар, мед.

За 24часа до процедуры вы должны употреблять только жидкости (бульон, чай, вода, сок без мякоти) ЕСТЬ НЕЛЬЗЯ!

Если ВЫ страдаете запорами (стул 1 раза в три дня и реже), то жидкостная диета должна составлять 48 часов до исследования.

Обязательно прочитайте памятку «подготовка к эндоскопическим исследованиям.

На сегодняшний день подготовка к ФКС проводится:

Препаратом Фортранс

В упаковке 4 пакета, каждый следует растворить в 1 литре кипяченной воды.

Раствор фортранса нужно принимать пр 1 стакану в течении 15 минут отдельными глотками. За 1 час нужно выпить 1 литр раствора.

Для полного очищения кишечника, рекомендуется принять 4 литра раствора фортранса по схеме: накануне вечером с 15 до 19 часов выпить 4 литра фортранса. Действие наступает с 16 до21 часов.

Препаратом Флит-фосфо-сода

день перед процедурой

В 7 ч утра вместо завтрака выпить не менее 1 стакана легкой жидкости (вода или освобожденные от твердых частиц супы, фруктовые соки без мякоти, чай и кофе, прозрачные газированные и негазированные безалкогольные напитки и т.  п.).

Первую дозу препарата следует принять непосредственно после завтрака. В половине стакана (120мл) холодной воды следует растворить содержимое 1фл. (45мл). Готовый раствор випить и запить одним (или более) стаканом (240мл) холодной воды.

В 13ч вместо обеда следует выпить не менее 3 стаканов (720мл) легкой жидкости.

В 19ч вместо ужина выпить не менее 1 стакана легкой жидкости.

Вторую дозу препарата следует принять непосредственно после ужина. В половине стакана (120мл) холодной воды следует растворить содержимое второго флакона (45мл). Готовый раствор выпить и запить одним (или более) стаканом (240мл) холодной воды.

При желании можно выпить больший объем жидкости. Легкие жидкости можно пить вплоть до полуночи.

Препаратом Лавакол

Подготовка к колоноскопии Лаваколом осуществляется по следующей дозировке: 1 пакетик Лавакола (14 г.) развести в 200 мл (стакан) теплой, но не горячей воды. Этот раствор тщательно перемешивается, для вкуса можно добавить лимонный сироп или ложку любого сиропа (шиповник, боярышник). Это делается для улучшения вкуса, так как раствор не очень приятен самостоятельно.

Пить следует с 16.30-17.30 до 21.30-22.30 по стакану через полчаса. После 22.30 употреблять пищу запрещено. Для удобства можно запивать водой с лимонным соком и ложкой сахара. Готовить его следует так: лимон режется на небольшие кусочки и заливается кипятком (2 л), добавляется 3-6 чайных ложек сахарного песку или меда.

Стул начнется в течение 1-1,5 после приема первой порции Лавакола и закончится после последней дозы через 2-3 часа

Употреблять последнюю дозу Лавакола можно не позднее, чем за 4 часа до колоноскопии кишечника.

Препаратом Мовипреп

Если процедура назначена с 8.00 до 10.00 часов , то схема приема препарата одноэтапная (вечерняя),

если с 10.00 до 14. 00 часов- двухэтапная схема приема препарата (в вечерние и утренние часы)

1 упаковка препарата рассчитана на 1 процедуру подготовки кишечника, вне зависимости от массы тела пациента.

При одноэтапной подготовке весь объём раствора (2 литра) нужно выпить вечером накануне процедуры. Принять дополнительно дробно 1 литр жидкости (вода, бульон, чай без молока, сок без мякоти).

Для приготовления первого литра содержимое одного пакетика А и одного пакетика Б разводят в 1 литре воды. Второй литр раствора приготавливают так же.

Пить раствор мовипрепа дробно по 1 стакану каждые 15 минут. Эффект наступает через 1 час от начала приема. Действие каждого выпитого литра- 2 часа. Окончить прием препарата необходимо за 3-4 часа до начала обследования.

При двухэтапной схеме приема 1 литр препарата принять накануне процедуры, дополнительно выпив 500 мл жидкости. Утром за 3-4 часа до процедуры выпить еще 1 литр раствора мовипрепа и 500 мл жидкости.

ФКС проводится в 265 кабинете поликлиники

Подготовка к исследованиям – Городская поликлиника № 175


Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) – если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения – если имеются.
  • Результаты анализов: ГЛ1, ВИЧ, Гепатит В и С сроком давности не менее 6 мес. ОАК и Коагулограмма – по необходимости.

Подготовка пациента

ПРЕПАРАТЫ ДЛЯ ПОДГОТОВКИ ТОЛСТОЙ КИШКИ К КОЛОНОСКОПИИ

1.МНН Макрогол 4000

Фортранс (РУ П № 014306/01) — порошок для приготовления раствора. Один пакетик весом 73,69 г содержит: макрогол 4000 — 64 г, калия хлорид — 0,75 г, натрия гидрокарбонат — 1,68 г, натрия сульфат безводный — 5,7 г, натрия хлорид — 1,46 мг; натрия сахаринат

— 0,1 г.

Лавакол (РУ ЛС-000443) — порошок для приготовления раствора. Один пакетик весом 14 г содержит: макрогол 4000 — 12 г, калия хлорид — 0,2 г, натрия гидрокарбонат — 0,6 г, натрия сульфат — 1 г, натрия хлорид — 0,2 г.

Подготовка к колоноскопии с помощью антеградного кишечного лаважа полным объемом (4 л) ПЭГ-ЭЛР (разделенная дозировка)

В течение трех суток, предшествующих исследованию, пациенту рекомендуется соблюдать бесшлаковую диету, а накануне исследования перейти на прием прозрачных жидкостей. Последний прием прозрачных жидкостей следует завершить не менее чем за 2 часа до начала приема ПЭГ-ЭЛР.

ПЭГ-электролитный раствор рекомендуется приготовить заранее и охладить до комнатной температуры. Раствор Фортранса, в частности, готовится путем растворения 1 пакетика препарата в 1 л кипяченой и охлажденной воды, а раствор Лавакола — в 1 стакане (200 мл) питьевой воды (газированную воду использовать нельзя).

За 1 час рекомендуется постепенно и равномерно — по 1 стакану (250 мл) за 15 минут — выпивать 1 л ПЭГ-ЭЛР. Разрешается сократить время приема каждого литра препарата до получаса при его хорошей переносимости.

Для преодоления идиосинкразии к вкусовым качествам препарата можно запивать препарат небольшим количеством сладкого чая с соком лимона либо добавить свежевыжатый сок лимона непосредственно в раствор препарата, а также сосать леденцы (например, «Барбарис»). Также возможен прием прозрачного яблочного сока.

Если при приеме ПЭГ-ЭЛР возникло ощущение тошноты, можно прервать прием препарата на полчаса. Первые 2 л ПЭГ-ЭЛР рекомендуется выпить вечером накануне исследования. Прием двух следующих литров препарата (3-го и 4-го) рекомендуется начать не менее чем за 6 часов и не более чем за 10 часов до назначенного времени исследования, то есть утром в день исследования.

Непосредственно перед началом приема второй дозы ПЭГ-ЭЛР необходимо принять 30 мл пеногасителя (симетикон; саб-симплекс) в жидкой форме. Возможен прием пеногасителя в той же дозе и с первой дозой ПЭГ-ЭЛР.

Во время приема ПЭГ-ЭЛР пациенту рекомендуется двигаться (ходить, выполнять круговые движения корпусом тела) и выполнять самомассаж передней брюшной стенки.

Конечным результатом подготовки должно стать появление желтоватых или зеленоватых, но обязательно светлых и прозрачных кишечных выделений.

Особенности подготовки к колоноскопии с помощью антеградного кишечного лаважа сокращенным объемом (2 л) ПЭГ-электролитного раствора в комбинации с бисакодилом

Последний прием прозрачных жидкостей следует завершить не менее чем за 2 часа до начала приема бисакодила. Дозировка бисакодила составляет от 10 до 20 мг (от 2 до 4 таблеток по 5 мг).

Слабительное действие препарата наступает в среднем через 6–8 часов, назначается перед сном (ориентировочно в 22–23 часа).

Прием 2 л ПЭГ-ЭЛР рекомендуется начать ранним утром в день исследования, за 5–6 часов до колоноскопии. Если колоноскопия назначена на позднее дневное время, ПЭГ рекомендуется применять со сдвигом времени, ориентируясь также на 6-часовой промежуток между началом приема препарата и временем колоноскопии.

2.МНН Макрогол 3350

Эндофальк (Р № ЛСР-005714/08) — порошок для приготовления раствора.

Один пакетик содержит: макрогол 3350 — 52,5 г, натрия хлорид — 1,4 г, натрия гидрокарбонат — 0,715 г, калия хлорид — 0,185 г; вспомогательные вещества: кремния диоксид коллоидный — 0,00046 г, ароматизатор фруктовый — 0,4 г, ароматизатор апельсиновый — 0,1 г, натрия сахаринат — 0,018 г.

ПЭГ 3350 без сульфата натрия рекомендуется приготовить непосредственно перед употреблением. Раствор Эндофалька готовится путем растворения 2 пакетиков препарата в 1 л теплой питьевой воды с последующим охлаждением.

За 1 час рекомендуется постепенно и равномерно — по 1 стакану (250–300 мл) за 15–20 минут — выпивать 1 л раствора.

Для лучшей переносимости препарата можно его запивать небольшим количеством сладкого чая с соком лимона, прозрачного яблочного сока.

Если при приеме ПЭГ-ЭЛР возникло ощущение тошноты, можно прервать прием препарата на полчаса.

Первые 2 л раствора Эндофалька рекомендуется выпить вечером накануне исследования. Прием двух следующих литров препарата (3-го и 4-го) рекомендуется начать не менее чем за 6 часов и не более чем за 10 часов до назначенного времени исследования, то есть утром в день исследования. Непосредственно перед началом приема второй дозы препарата необходимо принять 30 мл пеногасителя (симетикон или саб-симплекс) в жидкой форме. Рекомендуется прием пеногасителя в той же дозе и с первым приемом «Эндофалька» вечером накануне исследования.

Во время приема Эндофалька пациенту рекомендуется двигаться (ходить, выполнять круговые движения корпусом тела) и выполнять самомассаж передней брюшной стенки.

Особенности подготовки к колоноскопии с помощью антеградного кишечного лаважа сокращенным объемом (2 л) ПЭГ без сульфата натрия в комбинации с сеннозидами

Дозировка Сенаде составляет от 27 мг (2 таблетки по 13,5 мг). Слабительное действие препарата наступает в среднем через 6–8 часов, назначается перед сном (ориентировочно в 22 часа).

Прием 2 л Эндофалька рекомендуется начать ранним утром (5:30–7:30) в день исследования, за 5–6 часов до колоноскопии. Если колоноскопия назначена на позднее дневное время, ПЭГ рекомендуется применять со сдвигом времени, ориентируясь также на 6-часовой промежуток между началом приема препарата и временем колоноскопии.

Мовипреп® (РУ ЛП-002630) — порошок для приготовления раствора.

Один пакетик (саше А) содержит: макрогол 3350 — 100 г, натрия сульфат — 7,5 г, натрия хлорид — 2,691 г, калия хлорид — 1,015 г; вспомогательные вещества: аспартам (E951) — 0,233 г, ацесульфам калия — 0,117 г, ароматизатор лимонный (V3938-1 N1) — 0, 34 г.

Второй пакетик (саше Б) содержит: аскорбиновая кислота — 4,7 г, натрия аскорбат — 5,9 г.

Упаковка препарата Мовипреп® содержит два саше А и два саше Б и рассчитана на приготовление 2 л раствора для приема внутрь. Вне зависимости от веса взрослого пациента для качественного очищения кишечника общий объем раствора препарата Мовипреп® составляет 2 л.

Для приготовления каждого литра раствора препарата Мовипреп® используется 1 саше А и 1 саше Б, содержимое которых растворяют в небольшом количестве питьевой негазированной воды комнатной температуры до полного растворения, а затем доводят объем раствора водой до 1 л и перемешивают.

Примечание: растворять содержимое саше непосредственно в 1 л воды менее предпочтительно, поскольку таким способом сложнее проконтролировать полное растворение порошка в воде, который осаждается на дно используемой емкости.

Приготовленный раствор целесообразно хранить в холодильнике.

Приготовленный раствор препарата Мовипреп® следует принимать дробно в течение 1–2 часов, например по 1 стакану (250 мл) каждые 15–30 минут.

Во время приема препарата Мовипреп® пациенту настоятельно рекомендуется дополнительно употребить минимум 1 л другой прозрачной жидкости: негазированной воды, бульона, фруктового сока без мякоти, безалкогольных напитков, чая или кофе без молока (можно с сахаром или медом). Это необходимо для предотвращения гиперосмолярности кишечного содержимого и повышения эффективности препарата.

Примечание: принимать 1 л дополнительной жидкости необходимо также дробно (после каждого принятого 1 л раствора препарата принять 500 мл дополнительной жидкости).

Во время приема раствора препарата нужно соблюдать двигательную активность: ходить, выполнять круговые движения корпусом, наклоны в стороны, вперед-назад, приседания. Начало действия препарата развивается индивидуально: в среднем через 1–2 часа от начала приема появляется первый стул. Активное действие препарата длится также индивидуально, в среднем в течение 2 часов. Критерием готовности к колоноскопии является появление жидкого прозрачного или почти прозрачного, слегка окрашенного стула.

В зависимости от времени проведения колоноскопии и повседневной активности пациента подготовку к колоноскопии с помощью препарата Мовипреп® можно осуществлять по двум схемам: раздельной (двухэтапной) или одноэтапной утренней.

Для колоноскопии, назначенной на первую половину дня, лучше всего подходит раздельная (двухэтапная) схема подготовки, при которой первый литр раствора препарата и минимум 500 мл дополнительной прозрачной жидкости принимаются вечером накануне процедуры, а второй литр раствора препарата и еще 500 мл дополнительной прозрачной жидкости — рано утром в день процедуры.

Для колоноскопии, назначенной на вторую половину дня, лучше всего подходит одноэтапная утренняя схема подготовки, при которой первый литр раствора препарата и минимум 500 мл дополнительной прозрачной жидкости принимаются в течение 1–2 часов утром в день процедуры и спустя 1 час аналогичным образом принимается второй литр раствора препарата и еще 500 мл дополнительной прозрачной жидкости.

Менее предпочтительной для подготовки к колоноскопии является одноэтапная вечерняя схема, так как время с момента окончания приема препарата и начала колоноскопии превышает рекомендованные ESGE 4 часа. Одноэтапная вечерняя схема более подходит для подготовки к хирургическим вмешательствам.

3. Жидкий фосфат натрия

Фосфо-сода (РУ ЛС-002170).

Жидкий фосфат натрия представляет собой гиперосмотический раствор малого объема, в 100 мл которого содержится 48 г (400 ммоль) одноосновного фосфата натрия и 18 г (130 ммоль) двуосновного фосфата натрия.

В день приема препарата разрешается употребление только прозрачных жидкостей.

Две дозы раствора объемом 45 мл каждая назначают с интервалом не менее 10–12 часов.

Перед началом приема раствор фосфата натрия необходимо развести водой (120 мл) для предотвращения рвоты. Перед приемом препарата рекомендуется выпить по крайней мере 1 стакан воды. После этого принимается первая доза препарата.

Каждую дозу препарата запивают минимум 1 стаканом (240 мл) жидкости, например холодной воды или чая. После приема первой дозы рекомендуется употребить не менее 3 стаканов (720 мл) жидкости. Количество жидкости в процессе подготовки неограниченно.

Вторую дозу следует принять не менее чем за 3 часа до исследования

4. МНН Натрия пикосульфат и цитрат магния

Пикопреп (Р № ЛП-002537) — порошок шипучий для приготовления раствора.

Один пакетик содержит: лимонная кислота безводная — 12 г, магния оксид — 3,5 г, пико-сульфат натрия моногидрат — 10,0 мг; вспомогательные вещества: калия гидрокарбонат — 0,5 г, натрия сахарината дигидрат — 0,06 г, ароматизатор апельсиновый* — 0,06 г.

* В состав ароматизатора апельсинового входят сухой экстракт апельсина, лактоза, ксантиновая камедь, аскорбиновая кислота и бутилгидроксианизол (Е320).

За день до проведения исследования рекомендуется перейти на диету и ограничить количество употребляемой пищи. Во избежание обезвоживания во время приема препарата Пикопреп® рекомендуется соблюдать питьевой режим.

Содержимое 1 пакетика растворяют в 150 мл воды, перемешивают 2–3 минуты, охлаждают до приемлемой температуры и выпивают. Если колоноскопия назначена на первую половину дня: содержимое первого пакетика принимают после обеда или ранним вечером (16–18 часов), запивая не менее 5 стаканами (по 250 мл) воды или прозрачной жидкости (воды, негазированных безалкогольных напитков, чая, кофе, фруктового сока без мякоти).

Содержимое второго пакетика принимают на ночь (22–24 часа), запивая не менее 3 стаканами (по 250 мл) воды или прозрачной жидкости. Последний стакан можно выпить не позднее чем за 1 час до исследования (если исследование проводится без анестезиологического обеспечения).

Если процедура назначена на вторую половину дня: содержимое первого пакетика принимают вечером (в 17–21 часов) в день, предшествующий исследованию, запивая его не менее 5 стаканами (по 250 мл) воды или прозрачной жидкости.

Содержимое второго пакетика принимают утром (за 5–9 часов до исследования), запивая не менее 3 стаканами (по 250 мл) воды или прозрачной жидкости.

Последний стакан можно выпить не позднее чем за 1 час до исследования (если исследование проводится без анестезиологического обеспечения).

5. Слабительные на основе солевых растворов

МНН Натрия пикосульфат

МНН Магния (магнезии) цитрат, МНН Магнезии сульфат.

Средняя дозировка составляет 125-200 мл 15-25% водного раствора магниевой соли. Слабительный эффект наступает через 4-6 часов после приема препарата.

ДОПОЛНИТЕЛЬНЫЕ И РЕЗЕРВНЫЕ СРЕДСТВА ДЛЯ ОЧИЩЕНИЯ ТОЛСТОЙ

КИШКИ ПЕРЕД КОЛОНОСКОПИЕЙ

МНН Сеннозиды А и B

Дозировка препарата составляет в среднем 130–150 мг сеннозидов А и В. Слабительный эффект наступает через 6–10 часов от момента его приема.

МНН Бисакодил

Дозировка препарата составляет 10-20 мг (2-4 таблетки вечером внутрь и утром — 10 мг (1свеча) ректально. Слабительный эффект развивается через несколько часов после его приема. Действие наступает в среднем через 6 часов при приеме внутрь в дневное время, через 8–12 часов при приеме внутрь перед сном и в течение первого часа при ректальном введении.

Касторовое масло (масло клещевины)

Дозировка составляет 1 г касторового масла на 1 кг массы тела, но не более 70 г на прием. Слабительный эффект при нормальной функции поджелудочной железы обычно наступает через 4–6 часов от момента приема.

Пеногасители:

МНН Симетикон

МНН Метоклапрамид

Клизмы

Клизмы могут применяться для подготовки пациента к ректосигмоскопии при недостаточной подготовленности дистальных отделов толстой кишки, дополнительно применяют одну или две очистительные клизмы.

Клизмы эффективно очищают дистальные отделы толстой кишки у пациентов с проксимально наложенной колостомой или при нефункционирующем дистальном отрезке кишки (например, после операции Гартмана).

Рекомендации. Применение клизм может быть рекомендовано пациентам с недостаточной подготовкой дистальных отделов толстой кишки к колоноскопии, а также пациентам с нефункционирующими дистальными отделами толстой кишки. Их применение в составе резервной подготовки оправдано только в ситуациях, когда пациенты не переносят средства для антеградного лаважа либо они отсутствуют. Также возможно применение клизм при наличиия противопоказаний к назначению ПЭГ электролитных растворов. Методика подготовки толстой кишки резервным способом

Бесшлаковую диету требуется соблюдать в течение 2–3 дней до исследования.

Накануне исследования рекомендуется прием прозрачных жидкостей. Последний прием прозрачных жидкостей — в 13–14 часов накануне исследования. Через 2 часа после последнего приема прозрачных жидкостей, то есть в 15–16 часов, необходимо принять 30–45 мл (не более 70 мл) касторового масла.

Пациентам с желчнокаменной болезнью и хроническим панкреатитом принимать касторовое масло не следует, в этом случае можно использовать 25% водный раствор сульфата магнезии (200 мл) или бисакодил (20–30 мг) в таблетках.

Вечером после самостоятельного стула нужно провести 2 очистительные клизмы по 1,5–2 л каждая. Утром в день исследования необходимо провести еще 2 очистительные клизмы по 1–2 л каждая с интервалом в 1 час (конечным результатом должно быть появление практически чистых промывных вод).

Последняя клизма ставится не позднее чем за 2 часа до момента осмотра. Исследование проводится после полного опорожнения толстой кишки.

Подготовка к колоноскопии фортранс

Пью фортранс для подготовки к колоноскопии, начало знобить. Это может быть связано с препаратом?

Может

Подготовка к колоноскопии. Вы можете выбрать любой из 4 препаратов 1. Фортранс 1 пакет на 1 л воды из расчета 1 л на 25 кг веса 2. Дюфалак 200 мл на 3.5-4 л 3. Флит Фосфо сода см. инструкции 4. Лавакол 15 пакетиков на 3 л .

Фортранс при подготовке к Колоноскопии

Странно, уже должен начаться процесс..
не допивайте до конца, подождите, а то рвота начнется

С помощью французского препарата Фортранс , который специально предназначен для подготовки ЖКТ к исследованиям вроде колоноскопии, ирригоскопии, к операциям на кишечнике.

Можно фортранс растворять в горячей воде?

Схемы подготовки к колоноскопии
Если исследование планируется с 8.00 до 14.00
Подготовка проводится с помощью препарата ФОРТРАНС. При этом в подавляющем большинстве случаев отпадает необходимость в постановке очистительных клизм. Для эффективной подготовки нужно приобрести в аптеке 4 пакета препарата ФОРТРАНС (одна картонная упаковка) .
Накануне исследования можно позавтракать, но обед и ужин исключаются (можно принимать светлые жидкости без газа: питьевая вода, чай, чай на травах) . Содержимое каждого пакета ФОРТРАНС растворяется в 1 литре качественной питьевой воды комнатной температуры. На протяжении интервала времени с 15.00 до 20.00 накануне исследования необходимо выпить 4 л раствора ФОРТРАНС (1 л раствора выпивается медленно, отдельными глотками в течение 1 часа — 1 часа 20 мин) . Пациентам, чувствительным к приёму больших объёмов жидкости (тошнота, отрыжка и т. п.) , рекомендуется за 1 час до начала подготовки принять 1 таб. препарата мотилиум, а склонным к спастическим болям в животе — 1-2 таб. но-шпы. Спустя приблизительно 1,5-2 часа после начала приёма раствора ФОРТРАНС появится жидкий стул, что является закономерным следствием приёма этого препарата. Жидкий стул будет периодически появляться ещё несколько раз примерно до 22. 00-23.00. После этого, как правило, позывы на низ прекращаются и подготовка считается завершённой.
Если по какой-либо причине пациенту не удалось принять более 2 литров раствора ФОРТРАНС, то утром в день исследования в 7.00 и 8.00 ему необходимо поставить по одной очистительной клизме объёмом 2 литра каждая.
В день исследования явиться натощак в назначенное время (с 7.00 до 8.00 утра допускается приём воды без газа или чая в объёме не более 300 мл) . Если исследование планируется выполнить под внутривенным наркозом, то пациент является строго натощак!

Советы по подготовке к колоноскопии. Подготовка к колоноскопии начинается за два-три дня до исследования с соблюдения бесшлаковой диеты при которой.С 17.00 в день накануне исследования начинается прием препаратов для очистки кишечника. Подготовка фортрансом.

В 12.30 колоноскопия, подготовка накануне фортрансом. Немного урчит в животе и иногда стул жёлтой водой.

Ляяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяя яяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяяя

Если подготовка проводится с помощью препарата Фортранс , отпадает необходимость в постановке очистительных клизм. В дни подготовки к колоноскопии возможен и даже необходим прием необходимых Вам лекарств за исключением препаратов железа и…

Если всё по инсрукции значит клизму не нужно.

Подготовка к колоноскопии!!!

Я готовилась фортрансом, где-то в Инете читала, что можно добавлять либо в раствор лимонный сок, либо после того как выпьешь пососать кусочек лимона поверьте легче пойдет. Я вообще выпила 3 кулька, а меня в этот день не взяли, пришлось весь день голодать и опять пить еще один кулек, а только на следующий день сделали. Ну и собственно Ваш настрой тоже важен, люди вон просто пьют эту гадость чтобы похудеть. С лимоном легче пойдет. Удачи!

Недостаточная подготовка к колоноскопии приводит к тому, что не уда тся осмотреть толстую кишку.А как выглядит плохая подготовка смотрите в видео! Положительной стороной очистки кишечника фортрансом является то, что он избавляет от неприятных очищений…

Подготовка к колоноскопии, если начать пить фортранс, немного позже указанного времени не в 17.

00, а в 19.00 ..

Ну по возможности в 17.00, но если позже, то думаю страшного ничего не случится. хотя нет, случится, это ж фортранс. жесткая вещь))) мне для рентгена надо было, я тоже позже пил, да и не уложился я за час эту жижу выпить, минут 15 не хватило)

25 летний мировой опыт применения Фортранса или других препаратов на основе макрогола в медицинской практике подтвердил их безусловную эффективность и предпочтительность при подготовке пациентов к колоноскопии.

Фортранс, подготовка к колоноскопии

Это значит хорошо. со стенок отложения сходят. вот если бы была прозрачной значит нихрена не почистилась.

Первый вариант подготовки к колоноскопии. Подготовка к обследованию проходит по следующей схеме но лишь в случае, если для1-й способ подготовки препаратом Фортранс одноэтапная подготовка В день, предшествующий исследованию, не употреблять в пищу…

В отчаянии хочу знать что стало

Молитвами пробовали?

Препарат более щадящий, чем Фортранс знаю по собственному опыту , однако стоит дороже около 1000 р. Тимур, 23 года Я не знал, как проводится колоноскопия и не думал, что подготовка к ней будет самым неприятным моментом.

Заведи друзей (побольше бывай в обществе) тебе найти себя, приготовь что то необычное

Вот такие у нас хорошие врачи. Зато крымнаш!

Черемуха. ягоды, компот, варенье. не увлекаться, плавно повышать дозировку, резко не прекращать прием, не делать перерывов, т. е. на завтрак, обед и ужин всегда должна присутствовать черемуха.

Пройдите обследование!

Первое — сменить врачей (может и не одного, пока нормального не найдёшь), второе — ищи рецепты и способы лечения в интернете, в книжных магазинах в отделе лечения и медицины, спроси сушёные травяные сборы в аптеке при своём недуге. делай и пей из низ травяные отвары по рецепту
наше здоровье и жизнь — только в наших рукках

Подготовка. Фортранс . Схема подготовки. Калькулятор.От качества подготовки к колоноскопии напрямую зависят точность постановки диагноза и вероятность выявления рака на ранних стадиях. 1.

Целый год? Как вы до сих пор живы? У вас должно быть обевазживание организма. Меняйте врача, срочно!

Больше ешь фастфуда.

Надо к нескольким врачам ходить, что бы поставить правильный диагноз, в разные клиники, не показывая старые диагнозы.

Пей больше миниральной воды это поможет.

Пройти полное обследование всего организма

Подготовка пациента к колоноскопии. Наилучшей является очищение кишечника специальными препаратами Фортранс, Лавакол.Есть две стандартные схемы подготовки к процедуре колоноскопии Фортрансом

Питаться правильно начни.

Больше ешь

Действительно, «посадили панкреас», а дальше или сахарный диабет или язвеный колит с дерьмоприёмником на животе …и никакой личной жизни…. пока НЕ НАЛАДИТЕ ПИТАНИЕ… И то, что раньше так ели не отговорка- ели и «посадили», будете продолжать, совсем добъёте… Ваш выбор…

На прием к гастроэнтерологу, проктологу. В передаче «Я стесняюсь своего тела» показывали 2-х молодых мужчин с такой проблемой. Каждые полчаса- понос. Ни работать, ни из дома выйти. Нашли у них язвенный колит в кишках. Лечения практически нет. Но им сделали простую процедуру, как бы экспериментально. Вот жду продолжения программы, как все закончится.

Я бы, на месте твоих родителей, отвела бы тебя на колоноскопию и фгс с СЕДАЦИЕЙ, и чтобы анализы из желудка и кишечника сразу взяли. И уже лечение по этим анализам. А вообще, у меня тоже были проблемы именно с диареей частой. Ставили синдром раздраженного кишечника. Так вот после подготовки к колоноскопии с фортрансом ( когда вымывается из кишечника все!!!!) , врач назначила бактерии в большом колличестве, чтобы заселить заново хорошими бактериями. И у меня все прошло. Т. е можете попробывать попить фортранс по инструкции и каких нибудь бактерий 10 дней попить

Оглавление. Состав, дозировка и форма выпуска Фортранс. Терапевтическое действие. Показания к применению. Фортранс инструкция по применению. Общие правила использования Фортранса. Подготовка к колоноскопии или ирригоскопии.

Вам к эндокринологу

Рисовый отвар. делай сама йогурт домашний и бей бифидумбактерин. а также не всех паразитов можно диагностировать на ранней стадии. у меня был 2года понос. после дисбактериоза-неверного лечения антибиотиками.

Тебе уже надо сходить к врачу гастроэнтерологу, скорре всего панкреатит дает тебе такие проблемы

Может это у тебя не с ЖКТ проблемы? а с питанием? или с чем то другим? с ходи к другому врачу и срочно

Больше ешь

Как правильно подготовиться к колоноскопии кишечника Фортрансом ? Безусловно, колоноскопия — не самая приятная процедура, поэтому для снижения доли дискомфорта требуется провести подготовку кишечника.

Как ты кушаешь? Пробовала наладить правильное питание? (результат будет не сразу, но будет).
корень калгана можно попробовать заваривать по инструкции и пить ещё

Лоперамид поможет! не, ну реально!

Синдром раздраженного кишечника? Что пьете?

Печалька, доктора скунсы

Провести комплексное обследование

Подготовка к колоноскопии фортрансом занимает от 4 до 6-8 часов в зависимости от реакции организма пациента. Обычно подготовку начинают накануне операции или колоноскопии.

Глисты походу

Попробуй обратиться а платную клинику по рейтингу

Возьми шкорлупу и перегородки грецких орехов и залей водой, покипяти полчаса, чтобы жидкость стала коричневатой, настоять немного, и пить, ешё кожура от гранатов помогает, тоже самое сделать

Лоперамид попробуй. Мне помогло. Недорогой..

Я так и не понял, что с тобой? можете просто объяснить

Из своего рациона на период подготовки к колоноскопии следует исключитьПрименение препарата Фортранс. Важным звеном в качественной очистке кишечника перед проведением колоноскопии является хорошо зарекомендовавший себя препарат Фортранс.

Вы себе поджелудочную посадили и продолжаете сажать дальше

Это может быть нервное, срк

ДОРОГАЯ! Скорее всего у тебя ТИРЕОТОКСИКОЗ. Сдай гормоны Т4 Т3 и ТТг и сходи к эндокринологу. Не затягивай!

Есть ещё вариант, из-за желчного пузырика траблы, из-за него и панкреатит и диарея могут быть.
И что это за диагноз советский — дизбактериоз, кажись такого диагноза в мире нету, только у нас придумали и пихают линекс горстями, а толку всё равно 0!

Начни с диеты. Смысл глотать пилюли — если причина твоих проблем в твоем же питании. Еще чуток такой жизни — и посадишь себе сердечко (микроэлементы ведь из организма вымываются) А тогда еще пилюль к картошке фри добавишь …

Подготовка к исследованию За 2 дня до колоноскопии необходимо перейти на специальную бесшлаковую диету, исключив из рациона питания овощи иМетоды очистки кишечника при подготовке к колоноскопии препаратами ФОРТРАНС и ЭСПУМИЗАН Внимание!

Помались Аллаху он тебе поможет!
Молитва:
Ооо великий Аллах даруй мне здоровье и излечи мой гастрит и я буду благодарна тебе всё свою жизнь! Аллах Велик! Аллах Велик! Аллах Велик!

Колоноскопия. поделитесь впечатлениями и ощушениями может советом

Это не больно, но неприятно. Просто чувство сильного распирания в животе, но боли никакой. Процедура недолгая, так что бояться ее не стоит.

Подготовка к колоноскопии. За 3 дня до исследования необходимо исключить из рациона пищу, богатую клетчаткой свежие фрукты и овощи, зелень, злаковые, бобовые, грибы, ягодыПодготовка препаратом ФОРТРАНС — исследование в первой половине дня. до 14 часов .

Процедура не из приятных

И если кишечник не выдержит и лопнет то бояться не стоит- врачи то рядом.

Ничего, конечно, не лопнет, но крайне неприятно.

Я делала под наркозом, так что ощущений нет, совет по приему ФОРТРАНСА, чтобы не тошнило либо в раствор добавьте сок лимона, либо после питья немного пожевать лимон и выплюнуть. Ничего не лопнет и кишки никто не порвет, главное чтобы результат был хорошим.

Чуть дополню: постарайтесь выбрать нормального врача.
Мне хотел эту процедуру сделать хирург-ортопед в городской поликлинике. У него там ч/б ТВ, медсестры нет вообще. Предлагал с седацией: 1 ампула трЕмадола за пол часа внутримышечно.
Вот у этого ортопеда седация уж точно пригодилась бы!
Обратился в другое учреждение — там и колоноскоп импортный, и плазменная панель, и мед. персонал в полном составе (врач эндоскопист + медсестра) . Скажу сразу: живу не в Москве, так что это не роскошь. Ищите узкопрофильного врача.

Подготовка препаратом ФОРТРАНС. Препарат ФОРТРАНС предназначен для подготовки желудочно-кишечного тракта к диагностическим исследованиям в том числе к колоноскопии и КТ-колографии , а также к оперативным вмешательствам на кишечнике.

Какое слабительное самое сильное?

Фортранс — используется для подготовки кишечника к колоноскопии.

Подготовка к виртуальной колоноскопии кишечника повышает диагностическую ценность информации и избавляет от токсинов и шлаков.Как подготовиться к колоноскопии фортрансом.

Лидокаин

Магнезия и кастровое масло
Но это плохой вариант т к есть множество более безопасных и более мягких по действию слабительных

Гуталакс. К ночи ожидать сюрприз точно

Слабикап

Отвар шиповника с сорбитом на 1 стакан отвара шиповника 2 стол. л. сорбита выпить и через 20 минут еще выпить 1 стакан отвара шиповника без сорбита . Стул будет через 1 час в несколько позывов . Почиститься кишечник..

Какие возникают трудности при подготовке Фортрансом? Подготовка больного к колоноскопии с использованием Фортранса занимает сравнительно немного времени, не требует участия медицинского персонала.

Жуткая боязнь клизм…

Купи грушу

Подготовка к колоноскопии кишечника. Колоноскопия метод медицинского обследования, основанный на применении гибкого зонда, позволяющего оценитьПрием Фортранса перед колоноскопией. прозрачные жидкости в течение дня в неограниченном количестве.

Потренируйся дома один в ванной.

Представь что это слоник своим хоботом моет тебя изнутри…

Смажь палец вазелином и засунь в анал вот и узнаешь, как оно это!

Перед какой процедурой клизма? колоноскопия?

В аптеках продают «Фортранс», его нужно пить. Примите по инструкции в больнице (это специальное средство, врачи не против него) и все будет норм и вводить в вас ни чего туда не будут. Удачи

Без подготовки толстой кишки с помощью препарата Фортранс исследование невозможно! Рекомендации врача по подготовке к колоноскопии. Опубликовано 8 Декабрь, 2013 — 15 06 отзыв от Muumimamma.

Можно обойтись без клизмьi: порошки, соли, йогурт с пробиотиком-все прочистится.

Очищение кишечника, способы

Клизма (пеняю правило клизмы предлагать)

Чтобы максимизировать эффективность метода колоноскопии, требуется правильная подготовка.Для повышения эффективности Фортранса не следует выпивать весь раствор залпом. Растяните каждую литру хотя бы на несколько стаканчиков.

Фортранс

Даже при использовании «безопасного»(т. е. оно сколько входит столько и выходит) вазелинового масла риск устроить СРК существует.

Турбослим))))

Фортранс
Создан специально для подготовки пациентов к хирургическим операциям и диагностики заболеваний ЖКТ. Фортранс выпускается в форме порошка. Чтобы правильно подготовиться к обследованию придётся выпить много воды (1 л жидкости на 20 кг веса). Пакетик порошка разводится в литре воды. Очищение Фортрансом можно проводить двумя способами. Например, вам нужно выпить 4 литра раствора. Делите его на две одинаковые порции. Одну принимаете вечером накануне колоноскопии, вторую — утром, но не позднее, чем за 3 часа до процедуры. Такую большую дозу выпить тяжело. Обычно во время приёма второго литра возникает тошнота. Чтобы от неё избавиться, каждый стакан жидкости заедайте лимончиком. Второй способ более лёгкий. Начиная с 15 часов ежечасно нужно выпивать по стакану раствора. Подготовка Фортрансом сравнительно недорогой метод, позволяющий добиться более полной очистки, чем клизма.
Дюфалак
Мягкий слабительный препарат. Выпускается в форме сиропа. В двух литрах воды разводится 200 мл средства. Раствор начинают принимать через два часа после обеда. За три часа нужно выпить всю дозу. Вкус Дюфалака слегка приторный, но вполне терпимый. При вздутии живота можно выпить Эспумизан.
Лавакол
Пакетик порошка разводится в стакане тёплой воды непосредственно перед приёмом. Неприятный солоноватый вкус жидкости можно немного улучшить, если добавить ложку сиропа. Каждые 15-30 минут выпивается стакан раствора. На 5 кг веса принимается пакет Лавакола. Начинать очищение лучше через три часа после обеда.
Эндофальк
Препарат способствует быстрому опорожнению кишечника. Отзывы о средстве положительные. Пациенты отмечают приятный фруктовый вкус раствора, отсутствие тошноты. Пакетик средства разводится в литре воды. При весе 50-80 кг потребуется три пакета Эндофалька. Во второй половине дня, предшествующего исследованию, выпивается два литра раствора. После начала приёма стул начинает отходить примерно через час. Оставшаяся жидкость употребляется на следующее утро, но не позднее, чем за 4 часа до колоноскопии.
Флит фосфо-сода
За день перед обследованием разводится 45 мл препарата в половине стакана воды и выпивается после завтрака. Такую же дозу нужно выпить после ужина. Важно, чтобы завтрак, обед и ужин состояли только из бульона, чая или сока без мякоти. Если колоноскопия назначена на вторую половину дня, то начинать очищение Флит фосфо-содой нужно после обеда. Между двумя приёмами препарата необходимо пить как можно больше жидкости. Все методы позволяют правильно подготовиться дома к фиброколоноскопии. Из них можно выбрать наиболее подходящий с учётом особенностей организма.
Источник: http://opischevarenii.ru/diagnostika/kolonoskopiya/podgotovka.html
© ОПищеварении. ру

А Вам для чего нужно-то? Хотя собственно какая разница, знаю что и перед диетами многие чистятся, а при запоре например это вообще необходимо можно сказать жизненно, еще перед обследованиями. Я сама перед диетой провожу чистку от шлаков, так как незашлакованый организм лучше отзывается на диету. Использую для этой цели таблетки Слабилен, хорошо чистят, принимать удобно – на ночь, а с утра действует уже. В составе никаких вредных веществ нет, никаких побочек тоже не было.

Подготовка к процедуре препаратом Фортранс. Препарат не всасывается в желудочно-кишечном тракте, действует исключительно в кишечнике и выводится в неизменном виде. Подготовка к колоноскопии Фортранс достаточно проста.

На мой взгляд главное наладить желудочно-кишечный тракт, сбалансировать микрофлору! Главное в этом деле — здоровое питание, спортивный образ жизни. Также лично я ем только органические и натуральные продукты. Очень эффективный продукт черничная паста Ликбери. Я принимаю как лекарственную пасту с утра и перед обедом. У меня всё как часы!)

Поесть свеклу с растительным маслом, а еще проще пить компот из сухофруктов и есть эти фрукты! Можно поесть с пищей отруби- как источник клетчатки! Пить больше сырой фильтрованной воды!

Хорошо чистит Слабилен, про который уже выше Мария писала, попробуйте его купить, стоит совсем недорого, а хватит пачки надолго, ведь на одно очищение требуется 1 таблетка.
Никакие народные средства так не очистят как эти таблетки, кроме того они не только содержимое кишечника выводят, но и шлаки вредные, токсины.

Утром с 5 до 7 час выпить 3 литра подсоленной воды с лимоном стаканами, через каждый литр упражнения медленно : повороты туловища, наклона в стороны. вращение таза и туловища, сидя на полу наклоны к ногам по 5 повторений- это называется клизма сверху

Коловада -если комплексно весь организм, на каждый день -корал детокс

Подготовка к колоноскопии. За три дня до исследования необходимо соблюдать диетуПодготовка препаратом Фортранс. Один пакетик Фортранса растворяется в 1 литре холодной воды ебз газа.

Сделайте салат из свежей свклы, только еште его маленькими порциями, побольше клетчатки, пропйте сорбент полисорб, он очистить организм от шлаков и токсинов, делайте винигреты, тушите капусту, делайте рагу, запекайте морковку, компоты из сухофрукты., а утром на тощак 1 стакан воды.

Употребляйте в рационе побольше клетчатки, вареной свеклы, морковки ,, убрать острую, соленую, копченую пищу, почистить кишечник сорбентом полисорб, от шлаков и токсинов, у него очень хорошие показания.

ПЕРЕД СНОМ ВЫПЕЙТЕ 30 МЛ КАТОРОВОГО МАСЛА СМЕШАВ ЕГО С 30 МЛ (2 СТ ЛОЖКИ) СОКА ЛИМОНА. ТАК ПРОЧИСТИТ ЧТО БУДЕТ ВСЕ ХОРОШО. ВСЕ БЕЗБОЛЕЗНЕННО И ЭФФЕКТИВНО.

А мне помогало средство чай и кофе турбослим) Отличные напитки, которые чистят мягко и без побочных действий) я когда начинала худеть поняла, что диеты мне не помогут из-за того, что вредные вещества уже и так накопились в моем организме и что в первую очередь нужно почиститься) и турбослим прекрасно справился с этим и за месяц минус 3.5 кг и аппетит стал умеренным и без упорных тренировок бега и тд)

Можно ли делать клизму?

Тебе можно

Чтобы понять какую роль в качественной диагностике играет подготовка к колоноскопии фортрансом и как важно правильно принимать фортранс, надо знать, что колоноскопия это метод исследования стенок толстой кишки…

Можно, но только осторожно! Без тяжестей и вибраций.:)

Можно, без особых проблем

Сейчас для очищения кишечника необязательно делать клизму. Можно использовать специальные препараты — например, фортранс. Но при желании — можно и клизму

Ну если назначили клизму-значит клизму! Ничего опасного и страшного в вашем случае нет! Это плановое мероприятие перед ректороманоскопией.

После работы можно..

3. Подготовка к колоноскопии Фортрансом предотвращает потерю микроэлементов. Благодаря наличию в растворе электролитов в просвете кишки создается изоосмотическое состояние, нет необходимости в секреции этих веществ.

Можно, не чего страшного. Но почему клизма? Сейчас есть специальные припараты чтобы не раздражать кишку. И темболее клизма не приятно.

Клизмы и тяжёлый физический труд особо не взаимосвязаны, они в основном влияют на деятельность и микрофлору кишечника.. . Удивляет сама постановка вопроса- непрофессионал до чистых вод хоть месяц делай, не сделает.. . А профессионалу вполне хватает одноразово на месте даже при ириго или колоноскопии- на сиффоные клизмы тупо техника нужна.. . Так что кто-то тупо отказался возиться с Вашим дерьмом или Вы приплатить за процедуру…

Можно, но опасно ставить клизму перед работой (тем более с тяжестями))))))

Можно

Можно конечно)

Фортранс. Подготовка к колоноскопии Фортрансом наиболее эффективный способ очищения кишечника для получения максимальных результатов во время осмотра.

Можно!

Да конечно же можно а кто сказал что нет

Полагаю, что хирург вам сказал, как подготовиться к ректороманоскопии \ в народе телевизор \.Вечером и утром надо обязательно делать клизмы, а не клизмочки. А сегодня надо после обеда не сеть вообще.

Нежелательно.

Не можно, а нужно

Подготовка к колоноскопии Фортрансом. Схема приема лаважного средства зависит от того, на какое время суток назначено обследование. Если эндоскопическая процедура назначена на утро, подготовка начинается почти за сутки до исследования

Можно

Можно

Ты я смотрю слишком увлекся этим занятием..

Конечно можно) от того что на толчке посидишь и просрешься сильно не устанешь ))

Может стоит посмотреть ближайшее место в городе, где ее делают. Как правило в санаториях-профилакториях существует такая процедура. После курса как правило уходят поворотнички. Да промывают там специальными растворами.

Чтобы эндоскопическое обследование кишечника дало максимально объективную информацию, необходимо заранее подробно изучить требования к подготовке к колоноскопии Фортрансом…

Зачем спрашивать, если назначили?

Можно

Можно, токо осторожно перед тяжестями))

Можно, но только если тебе сказали! Не надо делать себе больно. После этого живот болит.

Можно

Подготовка к колоноскопии препаратом Фортранс. За три дня до исследования.1 пакетик ФОРТРАНС растворить в 1 литре воды. принимать 3 литра раствора ФОРТРАНС в течении 4 часов 1 стакан в 20мин.

Перед ректоромано лучше все таки клизму, а не фортранс, так осмотрят только ближайшие отделы, не надо мучаться несколько часов, очищая фортрансом.

Осторожно только

Можно.

Клизмы клизмами, но надо бы еще и слабительное выпить. Клизмой залежи не убрать

Клизма-не имеет никакой подготовки. всё зависит уже от того, как вы ее поставите

Фортранс для очищения кишечника. Важную роль играет подготовка к колоноскопии, Фортранс и другие препараты помогут очистить кишечник полностью. Чем лучше проведена подготовка, тем точнее будут результаты исследования.

Литров не 18 чтобы отбило желание здесь пробовать перо

Можно

Бабушка очень боится делать колоноскопию, потому что у неё очень слабый болевой порог. Как быть, и как выпить 4 л. воды?

Согласна, с&ки. Искать хорошего, пусть платного врача, узнать как можно обезболить.

Подготовку к колоноскопии Фортрансом, если процедура утром, надо проводить строго по инструкции. Препарат в короткие сроки опустошает кишечник, что гарантирует легкое и быстрое проведение исследования, а также получение достоверной информации.

Что-то многовато, со спец. сиропами сейчас обходятся меньшим кол-вом жидкости, врач выписывал рецепты на латыни, но можно найти описание подготовки в инете

Обезболивают всегда-не больно совсем

Колоноскопия под местным обезболиванием делается у нас в стране. А на Западе, например, под общим наркозом. Поищите где в вашем городе на таких условиях её проводят, если изначально их не заявлено.
__
Ты мужик или где, отвлеки бабушку от её надрачивания на свой страх. Какой смысл бояться того, что неизбежно? Это просто процедура, такая же как у лора, только смотрят кишечник. Бабушка выберет от рака помереть или всё-таки провериться?
Через силу пить воду, это для процедуры потому что надо, а не для того чтобы бабушке по выпиванию этой воды веселее стало. От воды не умирают, пописает после почаще и побольше, в чём проблема то? Пусть пить начинает за 2-1 час. Успокоительное пусть выпьет прямо перед процедурой, валерианы с пустырником на стакан воды (успокоительный коктейль так называемый) .
Бабушке точно стоит пройти эту процедуру, её только и стоит проходить бабушкам да дедушкам, потому что они реально в группе риска именно такого рака, его надо исключить и заодно получите полную картину состояния кишечника. Многие люди умирают за 2-3 месяца потому что случайно, находясь по другому поводу в стационаре, обнаружили у себя уже неоперабельный рак 4-ой степени. Пусть бабушка бодрится, это просто процедура. Расстроенные нервы ей на ней только помешают.

Рентген сделайте

Эту процедуру нужно и реально сделать под общем наркозом, иначе очень болезненно- кишечник воздухом расправляют для лучшего обзора. Договоритесь по общему наркозу.

Назначение и применение Фортранса. Обычно Фортранс принимают в период подготовки к колоноскопии. Но также он назначается и перед операцией, требующей полного опустошения кишечника и желудка.

Возможности колоноскопии уникальны : именно поэтому ей отдают предпочтение ,
когда необходимо обследование толстого кишечника.
эта диагностическая процедура позволяет за считанные минуты оценить состояние толстого кишечника практически на всём его протяжении, а это ни много, ни мало почти 1,5 метра.
Очистительную клизму делают накануне колоноскопии дважды вечером, с интервалом 1 час.
Ещё раз кишечник очищают утром в день обследования, также 2 раза с часовым промежутком. Объём воды не должен быть меньше 1 – 1,5 литров за один раз, а очищать кишечник нужно до чистой воды. .
ещё дают слабительные .. Дюфалак, Флит и Фортранс.
Их разводят в определённом количестве воды и начинают принимать накануне процедуры
В некоторых ситуациях обследование проводится под наркозом:
у детей, пациентов со спаечной болезнью брюшной полости и при выраженных деструктивных процессах в толстом кишечнике ..
написал всё подробно ,
чтобы вы не паниковали, а объяснили бабушке, что, как, почему и зачем. .
манипуляция длится минут 10, неприятность бывает от нагнетания воздуха ..
чувствительным пациентам область ануса перед манипуляцией
смазывается анестезирующими гелями или мазями

Училась на медсестру я и что я могу вам сказать по этому поводу… невозможность проведения процедуры. связана с нежелание патента .так мы отвечали на экзамене… так что не может. не хочет. это ещё проблемы. насильно туда никто ничего вставлять не будет. она сама решает. если хочет провериться. то будет терпеть. а проверяться даже здоровым надо. так как рак потом поздно лечить будет…

Вот под общим наркозом не надо соглашаться, иначе травмируют, а она не отреагирует. Лучше уж успокоительного принять, но терпеть так. если что-то не туда пойдет, она хоть просигналит… Знакомого ищите лучше, или заплатите дополнительно, чтобы бережно провели.

1. Под общим наркозом. Ищите нормальную частную клинику, в которой врачи не вчера из колхоза. XXI век на дворе. А страшилки про опасность процедуры под наркозом не слушайте. Бараку Обаме её делали под наркозом, да.
2. Выпить не трудно. Через пол часа всё будет выливаться через низ. Пусть включит НТВ, смотрит сериалы и каждую рекламу пьёт по пол литра.

В чем особенность подготовки к колоноскопии и делается ли данная процедура амбулаторно без госпитализации в стационар?

Делают в кабинете колоноскопии. Сделали, получил результат, гуляй. Подготовка такая: накануне нужно выпить назначенное количество фортранса, он выводит из кишечника все содержимое. Нужно находиться дома, т. к. Раствора где-то 2 литра. И постоянно освобождается кишечник.

Если проведение колоноскопии планируется с 8.00 до 14.00. Подготовка проводится с помощью препарата ФОРТРАНС.Подготовка к колоноскопии запрещенные продукты. От многих продуктах перед проведением колоноскопии стоит отказаться.

Это разовая процедура а вот сколько раз сделать скажет врач, бывает до 7 процедур в зависимости как забит кишечник. Но такая чистка может вызвать дисбактериоз так как вымывается полезная флора кишечника, потом замучаетесь ее восстанавливать таблетками. Что надо сделать перед этим проконсультирует врач

Касторовое масло перед эндоскопией кишечника подойдёт? Или лучше купить средство в аптеке какое-нибудь?

Про это должен был сказать врач… Чтоб его не обосрали во время исследования….

Подготовка к исследованию колоноскопии с помощью Фортранса. Фортранс можно легко купить в аптеке. Лекарство продается в пакетах в виде порошка в 1 упаковке 4 порошка .

Минеральная вода DONAT -2-3 литра за сутки до исследования. Имеет мощный послабляющий эффект.

Мне врач назначил «Фортранс» -порошок для очищения толстой кишки при подготовке пациента к исследованию.

Фортранс, Эндофальк, Лавакол. Подготовка в течении двух дней перед колоноскопией. 1-й день- отказ от всех газообразующих продуктов (хлеб, картофель, капуста, яблоки и пр.), 2-й день- приём самого препарата.

Блин не пойму у мужа колопроскопия.

До процедуры не надо. потерпит

Как подготовиться к утренней колоноскопии? Подготовка к колоноскопии Фортрансом, если процедура утром, должна проводиться строго накануне. В упаковке препарата содержится 4 пакетика с порошком.

Муж твой?

Мучения какие !!!и все за зря? поест и всё на смарку будет!
а вообще есть менее жестокие методы — фортранс например

Кормить нельзя!

Если я выпью пива перед колоноскопией это может повлиять на результат? так как очень страшно

А Шелдон с вами идёт?

Давайте рассмотрим основные аспекты применения Фортранса, чтобы понять, почему пациенты выбирают именно Фортранс. Предварительная подготовка к колоноскопии общая для всех методов.

Колоноскопия — хуйня, это не страшно и не больно. В миллион раз лучше, чем когда такую же кишку — в глотку. Честное слово говорю, мне несколько раз делали, и послезавтра опять предстоит, я совершенно не боюсь. Неприятно кишку в жопу, но не страшно. Ну, типа пивка — можно, страх уходит, если только незадолго выпить. А то как пернете на врача пивом! :))) Представляете, какой конфуз? :)))

Ах, Антон вы не правы! может вы путаете колоно с ректоскопией? При колоно даже премидикацию делают (подготовка моральных и физических сил, я работала в эндоскопии-знаю!), тут лучше не пиво, а валерьянка, корвалол или, что вы успокоительное принимаете, да и вообще, алкоголем на врача дышать-это неуважение к специалисту! (да и писать после пива хочется. представляете*конфуз*у вас инструмент в попе а вам по-маленькому приспичило…) уж лучше после процедуры оторвитесь!!!

Девушки не пью, пиво пьют бабы

Со рта вонять будет хуже, чем из вашей жооооп….

Подскажите пожалуйста! как проходит узи кишечника?

Ни как.

Для правильной подготовки к колоноскопии потребуется выпить много жидкости с учетом пропорции 1 л на 20 кг . Подготовка к колоноскопии Фортрансом проводится с помощью следующих методов

Предстоит КТ — комплексное исследование органов брюшной полости с виртуальной колонографией.

Виртуальная??? Не слыхал о такой, это, что «тупо виртуальные картинки»… Ну а если колоноскопию «в живую», её ещё никто «до конца не получал»…Вероятнее всего это обычная иригоскопия, с введением контраста «per rectum»… Короче, развод «от самого немогу», зато Ваша фамилия на плёнке будет написана компьтером и на не нашем языке…

Недостаточная подготовка к колоноскопии приводит к тому, что не уда тся осмотреть толстую кишку.Подготовка Фортрансом сравнительно недорогой метод, позволяющий добиться более полной очистки, чем клизма. Дюфалак.

Старайтесь следовать назначенному режиму.
Принимайте фортранс.
ТАКОЕ ИССЛЕДОВАНИЕ. ВСЕ РАВНО БУДЕТ ПРОВЕДЕНО.
И пригодные для анализа ситуации результаты бывают.
Даже у тех, кто плохо подготовился.
Желаю спокойствия и терпения.

Если делать клизму, то дома. В больнице, если вы прибыли на плановое КТ — клазму делать вам никто не разрешит и никто делать не будет.

Кто и как лечит геморрой в первой стадии ?

Мазь «релиф», все по инструкции, если тюбик не поможет, то повторить в комплексе с таблетками «детралекс»

Подготовка к колоноскопии Фортрансом начинается за 12-14 часов до исследования, поэтому следует рассчитать начало приема лекарства самостоятельно. Можно такую очистку проводить с вечера, если диагностика назначена утром.

Гепатромбин Г_свечи

Попробуй пиявки.

Подготовка к исследованиям — Городская поликлиника № 220

Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) —
    если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения — если
    имеются.

Подготовка пациента

  • Исследование проводится натощак — за б часов до процедуры нельзя
    есть и пить.
  • за 3 дня до предстоящего исследования рекомендована легкая диета:
    исключаются продукты, усиливающие перистальтику кишечника и газообразование (мучные изделия, черный хлеб, сырые овощи и фрукты ,
    бобовые, молоко, соки, газированные и алкогольные напитки).
  • При повышенном газообразовании рекомендовать пациенту в течение
    трех дней принимать препараты-адсорбенты (активированный уголь,
    пигнин гидролизный, кремния диоксид коллоидный).
  • 3а 3 дня до процедуры не проводить рентгеновские исследования
    с введением.
  • 3а сутки до исследования не проводить гастроскопию, колоноскопию, клизмы.
Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) —
    если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения — если
    имеются.

Подготовка пациента

  • Исследование проводится натощак — за б часов до процедуры нельзя
    есть и пить.
  • За 3 дня до предстоящего исследования рекомендована лёгкая диета:
    исключаются сырые овощи и фрукты , бобовые, молоко, соки, газированные и алкогольные напитки.
  • За 2-3 дня необходимо исключить препараты, способствующие разжижению крови, например аспирин, плавикс и т.д. Обязательна предварительная консультация своего лечащего врача (кардиолога).
  • Последний прием пищи желательно совершить за 12 часов до процедуры. Если процедура назначена на утро, ужин накануне должен быть не
    позднее 19 часов и состоять из легких блюд, например легкий куриный суп, нежирный творог с натуральным йогуртом.
  • 3а 3-4 часа до исследования необходимо опорожнить кишечник. Сделать клизму или выпить предварительно слабительное.
  • Перед исследованием необходимо наполнить мочевой пузырь, как при УЗИ мочевого пузыря. (Важно: газированная вода не подходит для подготовки к исследованию простаты — это может исказить результаты, в связи с чем возникнет необходимость повторного ТРУЗИ.)
  • Нельзя проводить ТРУЗИ предстательной железы при анальных трещинах.
Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) —
    если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения — если
    имеются.

Подготовка пациента

  • Для женщин репродуктивного возраста исследование желательно проводить на 5-10-й день цикла (считая от первого дня начала менструации).
  • Для женщин в менопаузе исследование можно проводить в любое удобное время.
Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) —
    если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения — если
    имеются.

Подготовка пациента

  • Для женщин репродуктивного возраста исследование желательно проводить с 6-го по 11-й день менструального цикла.
  • Для женщин в менопаузе исследование можно проводить в любое удобное время.
  • В день исследования рекомендовать пациенту не использовать дезодоранты на основе талька и мази на основе цинка.
Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) — если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения — если имеются.
  • Результаты анализов: ГЛ1, ВИЧ, Гепатит В и С сроком давности не менее 6 мес. ОАК и Коагулограмма — по необходимости.

Подготовка пациента

  • Исследование проводится строго натощак! Последний прием пищи — накануне вечером не позднее 19:00.
  • Если пациент постоянно принимает какие-либо препараты, их нужно принять за три часа до исследования, запив небольшим количеством воды!
  • Если пациент принимает препараты, влияющие на свертываемость крови (антикоагулянты: гепарин, натрия гидроцитрат, неодикумарин, синкумар; антиагрегантные средства: ацетилсалициловая кислота, дипиридамол, пентоксифиллин, тиклопидин), необходимо накануне проконсультироваться с врачом, назначившим эти лекарственные средства, с решением вопроса о предстоящем исследовании с возможной биопсией.
  • 3а 5 дней до процедуры пациенту необходимо избегать приема железосодержащих препаратов, активированного угля, висмут содержащих препаратов.
  • Важно: пациентам с эпилепсией выполнение ЭГДС показано только в условиях внутривенной седации! Пациентам с аритмией, перенесенным инфарктом миокарда, инсультом следует накануне проконсультироваться с кардиологом и неврологом. Пациентам с сахарным диабетом необходимо записаться на ЭГДС в утренние часы и взять принимаемые лекарственные препараты с собой (таблетированные формы, инсулин). Обязательно проконтролировать уровень глюкозы перед исследованием. Проверить уровень глюкозы крови утром перед исследованием. Пациентам с бронхиальной астмой необходимо взять с собой ингалятор.
Перечень документов для исследования
  • Направление (форма N° 057/у) и выписка из МКАБ форма N° 027/у) — если исследование будет проводиться в другой МО.
  • Данные предыдущих исследований/стационарного лечения — если имеются.
  • Результаты анализов: ГЛ1, ВИЧ, Гепатит В и С сроком давности не менее 6 мес. ОАК и Коагулограмма — по необходимости.

Подготовка пациента

ПРЕПАРАТЫ ДЛЯ ПОДГОТОВКИ ТОЛСТОЙ КИШКИ К КОЛОНОСКОПИИ

1.МНН Макрогол 4000

Фортранс (РУ П № 014306/01) — порошок для приготовления раствора. Один пакетик весом 73,69 г содержит: макрогол 4000 — 64 г, калия хлорид — 0,75 г, натрия гидрокарбонат — 1,68 г, натрия сульфат безводный — 5,7 г, натрия хлорид — 1,46 мг; натрия сахаринат

— 0,1 г.

Лавакол (РУ ЛС-000443) — порошок для приготовления раствора. Один пакетик весом 14 г содержит: макрогол 4000 — 12 г, калия хлорид — 0,2 г, натрия гидрокарбонат — 0,6 г, натрия сульфат — 1 г, натрия хлорид — 0,2 г.

Подготовка к колоноскопии с помощью антеградного кишечного лаважа полным объемом (4 л) ПЭГ-ЭЛР (разделенная дозировка)

В течение трех суток, предшествующих исследованию, пациенту рекомендуется соблюдать бесшлаковую диету, а накануне исследования перейти на прием прозрачных жидкостей. Последний прием прозрачных жидкостей следует завершить не менее чем за 2 часа до начала приема ПЭГ-ЭЛР.

ПЭГ-электролитный раствор рекомендуется приготовить заранее и охладить до комнатной температуры. Раствор Фортранса, в частности, готовится путем растворения 1 пакетика препарата в 1 л кипяченой и охлажденной воды, а раствор Лавакола — в 1 стакане (200 мл) питьевой воды (газированную воду использовать нельзя).

За 1 час рекомендуется постепенно и равномерно — по 1 стакану (250 мл) за 15 минут — выпивать 1 л ПЭГ-ЭЛР. Разрешается сократить время приема каждого литра препарата до получаса при его хорошей переносимости.

Для преодоления идиосинкразии к вкусовым качествам препарата можно запивать препарат небольшим количеством сладкого чая с соком лимона либо добавить свежевыжатый сок лимона непосредственно в раствор препарата, а также сосать леденцы (например, «Барбарис»). Также возможен прием прозрачного яблочного сока.

Если при приеме ПЭГ-ЭЛР возникло ощущение тошноты, можно прервать прием препарата на полчаса. Первые 2 л ПЭГ-ЭЛР рекомендуется выпить вечером накануне исследования. Прием двух следующих литров препарата (3-го и 4-го) рекомендуется начать не менее чем за 6 часов и не более чем за 10 часов до назначенного времени исследования, то есть утром в день исследования.

Непосредственно перед началом приема второй дозы ПЭГ-ЭЛР необходимо принять 30 мл пеногасителя (симетикон; саб-симплекс) в жидкой форме. Возможен прием пеногасителя в той же дозе и с первой дозой ПЭГ-ЭЛР.

Во время приема ПЭГ-ЭЛР пациенту рекомендуется двигаться (ходить, выполнять круговые движения корпусом тела) и выполнять самомассаж передней брюшной стенки.

Конечным результатом подготовки должно стать появление желтоватых или зеленоватых, но обязательно светлых и прозрачных кишечных выделений.

Особенности подготовки к колоноскопии с помощью антеградного кишечного лаважа сокращенным объемом (2 л) ПЭГ-электролитного раствора в комбинации с бисакодилом

Последний прием прозрачных жидкостей следует завершить не менее чем за 2 часа до начала приема бисакодила. Дозировка бисакодила составляет от 10 до 20 мг (от 2 до 4 таблеток по 5 мг).

Слабительное действие препарата наступает в среднем через 6–8 часов, назначается перед сном (ориентировочно в 22–23 часа).

Прием 2 л ПЭГ-ЭЛР рекомендуется начать ранним утром в день исследования, за 5–6 часов до колоноскопии. Если колоноскопия назначена на позднее дневное время, ПЭГ рекомендуется применять со сдвигом времени, ориентируясь также на 6-часовой промежуток между началом приема препарата и временем колоноскопии.

2.МНН Макрогол 3350

Эндофальк (Р № ЛСР-005714/08) — порошок для приготовления раствора.

Один пакетик содержит: макрогол 3350 — 52,5 г, натрия хлорид — 1,4 г, натрия гидрокарбонат — 0,715 г, калия хлорид — 0,185 г; вспомогательные вещества: кремния диоксид коллоидный — 0,00046 г, ароматизатор фруктовый — 0,4 г, ароматизатор апельсиновый — 0,1 г, натрия сахаринат — 0,018 г.

ПЭГ 3350 без сульфата натрия рекомендуется приготовить непосредственно перед употреблением. Раствор Эндофалька готовится путем растворения 2 пакетиков препарата в 1 л теплой питьевой воды с последующим охлаждением.

За 1 час рекомендуется постепенно и равномерно — по 1 стакану (250–300 мл) за 15–20 минут — выпивать 1 л раствора.

Для лучшей переносимости препарата можно его запивать небольшим количеством сладкого чая с соком лимона, прозрачного яблочного сока.

Если при приеме ПЭГ-ЭЛР возникло ощущение тошноты, можно прервать прием препарата на полчаса.

Первые 2 л раствора Эндофалька рекомендуется выпить вечером накануне исследования. Прием двух следующих литров препарата (3-го и 4-го) рекомендуется начать не менее чем за 6 часов и не более чем за 10 часов до назначенного времени исследования, то есть утром в день исследования. Непосредственно перед началом приема второй дозы препарата необходимо принять 30 мл пеногасителя (симетикон или саб-симплекс) в жидкой форме. Рекомендуется прием пеногасителя в той же дозе и с первым приемом «Эндофалька» вечером накануне исследования.

Во время приема Эндофалька пациенту рекомендуется двигаться (ходить, выполнять круговые движения корпусом тела) и выполнять самомассаж передней брюшной стенки.

Особенности подготовки к колоноскопии с помощью антеградного кишечного лаважа сокращенным объемом (2 л) ПЭГ без сульфата натрия в комбинации с сеннозидами

Дозировка Сенаде составляет от 27 мг (2 таблетки по 13,5 мг). Слабительное действие препарата наступает в среднем через 6–8 часов, назначается перед сном (ориентировочно в 22 часа).

Прием 2 л Эндофалька рекомендуется начать ранним утром (5:30–7:30) в день исследования, за 5–6 часов до колоноскопии. Если колоноскопия назначена на позднее дневное время, ПЭГ рекомендуется применять со сдвигом времени, ориентируясь также на 6-часовой промежуток между началом приема препарата и временем колоноскопии.

Мовипреп® (РУ ЛП-002630) — порошок для приготовления раствора.

Один пакетик (саше А) содержит: макрогол 3350 — 100 г, натрия сульфат — 7,5 г, натрия хлорид — 2,691 г, калия хлорид — 1,015 г; вспомогательные вещества: аспартам (E951) — 0,233 г, ацесульфам калия — 0,117 г, ароматизатор лимонный (V3938-1 N1) — 0, 34 г.

Второй пакетик (саше Б) содержит: аскорбиновая кислота — 4,7 г, натрия аскорбат — 5,9 г.

Упаковка препарата Мовипреп® содержит два саше А и два саше Б и рассчитана на приготовление 2 л раствора для приема внутрь. Вне зависимости от веса взрослого пациента для качественного очищения кишечника общий объем раствора препарата Мовипреп® составляет 2 л.

Для приготовления каждого литра раствора препарата Мовипреп® используется 1 саше А и 1 саше Б, содержимое которых растворяют в небольшом количестве питьевой негазированной воды комнатной температуры до полного растворения, а затем доводят объем раствора водой до 1 л и перемешивают.

Примечание: растворять содержимое саше непосредственно в 1 л воды менее предпочтительно, поскольку таким способом сложнее проконтролировать полное растворение порошка в воде, который осаждается на дно используемой емкости.

Приготовленный раствор целесообразно хранить в холодильнике.

Приготовленный раствор препарата Мовипреп® следует принимать дробно в течение 1–2 часов, например по 1 стакану (250 мл) каждые 15–30 минут.

Во время приема препарата Мовипреп® пациенту настоятельно рекомендуется дополнительно употребить минимум 1 л другой прозрачной жидкости: негазированной воды, бульона, фруктового сока без мякоти, безалкогольных напитков, чая или кофе без молока (можно с сахаром или медом). Это необходимо для предотвращения гиперосмолярности кишечного содержимого и повышения эффективности препарата.

Примечание: принимать 1 л дополнительной жидкости необходимо также дробно (после каждого принятого 1 л раствора препарата принять 500 мл дополнительной жидкости).

Во время приема раствора препарата нужно соблюдать двигательную активность: ходить, выполнять круговые движения корпусом, наклоны в стороны, вперед-назад, приседания. Начало действия препарата развивается индивидуально: в среднем через 1–2 часа от начала приема появляется первый стул. Активное действие препарата длится также индивидуально, в среднем в течение 2 часов. Критерием готовности к колоноскопии является появление жидкого прозрачного или почти прозрачного, слегка окрашенного стула.

В зависимости от времени проведения колоноскопии и повседневной активности пациента подготовку к колоноскопии с помощью препарата Мовипреп® можно осуществлять по двум схемам: раздельной (двухэтапной) или одноэтапной утренней.

Для колоноскопии, назначенной на первую половину дня, лучше всего подходит раздельная (двухэтапная) схема подготовки, при которой первый литр раствора препарата и минимум 500 мл дополнительной прозрачной жидкости принимаются вечером накануне процедуры, а второй литр раствора препарата и еще 500 мл дополнительной прозрачной жидкости — рано утром в день процедуры.

Для колоноскопии, назначенной на вторую половину дня, лучше всего подходит одноэтапная утренняя схема подготовки, при которой первый литр раствора препарата и минимум 500 мл дополнительной прозрачной жидкости принимаются в течение 1–2 часов утром в день процедуры и спустя 1 час аналогичным образом принимается второй литр раствора препарата и еще 500 мл дополнительной прозрачной жидкости.

Менее предпочтительной для подготовки к колоноскопии является одноэтапная вечерняя схема, так как время с момента окончания приема препарата и начала колоноскопии превышает рекомендованные ESGE 4 часа. Одноэтапная вечерняя схема более подходит для подготовки к хирургическим вмешательствам.

3. Жидкий фосфат натрия

Фосфо-сода (РУ ЛС-002170).

Жидкий фосфат натрия представляет собой гиперосмотический раствор малого объема, в 100 мл которого содержится 48 г (400 ммоль) одноосновного фосфата натрия и 18 г (130 ммоль) двуосновного фосфата натрия.

В день приема препарата разрешается употребление только прозрачных жидкостей.

Две дозы раствора объемом 45 мл каждая назначают с интервалом не менее 10–12 часов.

Перед началом приема раствор фосфата натрия необходимо развести водой (120 мл) для предотвращения рвоты. Перед приемом препарата рекомендуется выпить по крайней мере 1 стакан воды. После этого принимается первая доза препарата.

Каждую дозу препарата запивают минимум 1 стаканом (240 мл) жидкости, например холодной воды или чая. После приема первой дозы рекомендуется употребить не менее 3 стаканов (720 мл) жидкости. Количество жидкости в процессе подготовки неограниченно.

Вторую дозу следует принять не менее чем за 3 часа до исследования

4. МНН Натрия пикосульфат и цитрат магния

Пикопреп (Р № ЛП-002537) — порошок шипучий для приготовления раствора.

Один пакетик содержит: лимонная кислота безводная — 12 г, магния оксид — 3,5 г, пико-сульфат натрия моногидрат — 10,0 мг; вспомогательные вещества: калия гидрокарбонат — 0,5 г, натрия сахарината дигидрат — 0,06 г, ароматизатор апельсиновый* — 0,06 г.

* В состав ароматизатора апельсинового входят сухой экстракт апельсина, лактоза, ксантиновая камедь, аскорбиновая кислота и бутилгидроксианизол (Е320).

За день до проведения исследования рекомендуется перейти на диету и ограничить количество употребляемой пищи. Во избежание обезвоживания во время приема препарата Пикопреп® рекомендуется соблюдать питьевой режим.

Содержимое 1 пакетика растворяют в 150 мл воды, перемешивают 2–3 минуты, охлаждают до приемлемой температуры и выпивают. Если колоноскопия назначена на первую половину дня: содержимое первого пакетика принимают после обеда или ранним вечером (16–18 часов), запивая не менее 5 стаканами (по 250 мл) воды или прозрачной жидкости (воды, негазированных безалкогольных напитков, чая, кофе, фруктового сока без мякоти).

Содержимое второго пакетика принимают на ночь (22–24 часа), запивая не менее 3 стаканами (по 250 мл) воды или прозрачной жидкости. Последний стакан можно выпить не позднее чем за 1 час до исследования (если исследование проводится без анестезиологического обеспечения).

Если процедура назначена на вторую половину дня: содержимое первого пакетика принимают вечером (в 17–21 часов) в день, предшествующий исследованию, запивая его не менее 5 стаканами (по 250 мл) воды или прозрачной жидкости.

Содержимое второго пакетика принимают утром (за 5–9 часов до исследования), запивая не менее 3 стаканами (по 250 мл) воды или прозрачной жидкости.

Последний стакан можно выпить не позднее чем за 1 час до исследования (если исследование проводится без анестезиологического обеспечения).

5. Слабительные на основе солевых растворов

МНН Натрия пикосульфат

МНН Магния (магнезии) цитрат, МНН Магнезии сульфат.

Средняя дозировка составляет 125-200 мл 15-25% водного раствора магниевой соли. Слабительный эффект наступает через 4-6 часов после приема препарата.

ДОПОЛНИТЕЛЬНЫЕ И РЕЗЕРВНЫЕ СРЕДСТВА ДЛЯ ОЧИЩЕНИЯ ТОЛСТОЙ

КИШКИ ПЕРЕД КОЛОНОСКОПИЕЙ

МНН Сеннозиды А и B

Дозировка препарата составляет в среднем 130–150 мг сеннозидов А и В. Слабительный эффект наступает через 6–10 часов от момента его приема.

МНН Бисакодил

Дозировка препарата составляет 10-20 мг (2-4 таблетки вечером внутрь и утром — 10 мг (1свеча) ректально. Слабительный эффект развивается через несколько часов после его приема. Действие наступает в среднем через 6 часов при приеме внутрь в дневное время, через 8–12 часов при приеме внутрь перед сном и в течение первого часа при ректальном введении.

Касторовое масло (масло клещевины)

Дозировка составляет 1 г касторового масла на 1 кг массы тела, но не более 70 г на прием. Слабительный эффект при нормальной функции поджелудочной железы обычно наступает через 4–6 часов от момента приема.

Пеногасители:

МНН Симетикон

МНН Метоклапрамид

Клизмы

Клизмы могут применяться для подготовки пациента к ректосигмоскопии при недостаточной подготовленности дистальных отделов толстой кишки, дополнительно применяют одну или две очистительные клизмы.

Клизмы эффективно очищают дистальные отделы толстой кишки у пациентов с проксимально наложенной колостомой или при нефункционирующем дистальном отрезке кишки (например, после операции Гартмана).

Рекомендации. Применение клизм может быть рекомендовано пациентам с недостаточной подготовкой дистальных отделов толстой кишки к колоноскопии, а также пациентам с нефункционирующими дистальными отделами толстой кишки. Их применение в составе резервной подготовки оправдано только в ситуациях, когда пациенты не переносят средства для антеградного лаважа либо они отсутствуют. Также возможно применение клизм при наличиия противопоказаний к назначению ПЭГ электролитных растворов. Методика подготовки толстой кишки резервным способом

Бесшлаковую диету требуется соблюдать в течение 2–3 дней до исследования.

Накануне исследования рекомендуется прием прозрачных жидкостей. Последний прием прозрачных жидкостей — в 13–14 часов накануне исследования. Через 2 часа после последнего приема прозрачных жидкостей, то есть в 15–16 часов, необходимо принять 30–45 мл (не более 70 мл) касторового масла.

Пациентам с желчнокаменной болезнью и хроническим панкреатитом принимать касторовое масло не следует, в этом случае можно использовать 25% водный раствор сульфата магнезии (200 мл) или бисакодил (20–30 мг) в таблетках.

Вечером после самостоятельного стула нужно провести 2 очистительные клизмы по 1,5–2 л каждая. Утром в день исследования необходимо провести еще 2 очистительные клизмы по 1–2 л каждая с интервалом в 1 час (конечным результатом должно быть появление практически чистых промывных вод).

Последняя клизма ставится не позднее чем за 2 часа до момента осмотра. Исследование проводится после полного опорожнения толстой кишки.

 

КТ БЕЗ КОНТРАСТА (ВСЕ, КРОМЕ БРЮШНОЙ ПОЛОСТИ И ОРГАНОВ МАЛОГО ТАЗА)

13С-УРЕАЗНЫЙ ДЫХАТЕЛЬНЫЙ ТЕСТ ДЛЯ ДИАГНОСТИКИ Н. PYLORI

Подготовка к лабораторным методам исследования

ОБЩИЕ РЕКОМЕНДАЦИИ И ПРАВИЛА ПОДГОТОВКИ ДЛЯ СДАЧИ АНАЛИЗОВ КРОВИ

ОБЩИЕ РЕКОМЕНДАЦИИ И ПРАВИЛА ПОДГОТОВКИ ДЛЯ СБОРА И СДАЧИ АНАЛИЗОВ МОЧИ

ОБЩИЕ РЕКОМЕНДАЦИИ И ПРАВИЛА ПОДГОТОВКИ ДЛЯ СБОРА СУТОЧНОЙ МОЧИ НА АНАЛИЗЫ

ОБЩИЕ РЕКОМЕНДАЦИИ И ПРАВИЛА ПОДГОТОВКИ ДЛЯ СБОРА И СДАЧИ АНАЛИЗОВ КАЛА

ОБЩИЕ РЕКОМЕНДАЦИИИ ПРАВИЛАПОДГОТОВКИ ДЛЯСБОРА МОКРОТЫ НА ОБЩИЙ АНАЛИЗ

ПРАВИЛА ПОДГОТОВКИ К ГЛЮКОЗОТОЛЕРАНТНОМУ ТЕСТУ

Системы контроля pH, очистка промышленных и сточных вод

рН-контроль

Fortrans, Inc.® предлагает полный спектр инновационных решений для контроля pH для широкого спектра применений, включая очистку промышленных технологических вод. В наших системах контроля pH используется запатентованная технология Dif-Jet для растворения углекислого газа (CO2) в воде с высоким pH для простого, экономичного и экологически безопасного контроля pH.В отличие от других систем контроля pH, представленных на рынке, наши системы очень надежны, просты в обслуживании, доступны по цене в эксплуатации и не засоряются и не загрязняются накипью или другими растворенными твердыми частицами. Читайте ниже для получения дополнительной информации о наших надежных системах контроля pH.

Модель 5000B

Система контроля pH Fortrans модели 5000B использует запатентованные инжекторы углекислого газа Dif-Jet для автоматического снижения и поддержания целевого pH в резервуарах, бассейнах, отстойниках сточных вод и прудах для ливневых стоков.Газовые форсунки Dif-jet растворяют более 90% газообразного CO₂ в воде. Пакетная система обеспечивает тщательное перемешивание и циркуляцию очищенной воды. Газовые форсунки Dif-jet не загрязняются и не засоряются при работе, что позволяет регулировать рН сточных вод с высоким содержанием твердых частиц. Система заключена в защищенную от непогоды панельную сборку для наружного или внутреннего использования.
Стандартный 5000B будет обрабатывать бассейны, лагуны, резервуары и пруды, содержащие до 2 миллионов галлонов. Эта система контроля pH обрабатывает со скоростью от 65 до 75 галлонов в минуту со встроенным центробежным насосом или погружным насосом.Системы 5000B могут быть оборудованы для обработки производительностью до 150 или 230 галлонов в минуту с циркуляционными насосами соответствующего размера и дополнительными газовыми инжекторами для обработки защитной оболочки от 8 до 10 миллионов галлонов.

Поли-Кат

Устройство Fortrans Poli-Cut представляет собой портативную или стационарную систему контроля pH, которая включает в себя резервуар для обработки на 200 галлонов с общей высотой 71″. Эту систему контроля pH можно перевозить в стандартных строительных прицепах. Система включает газовый инжектор Dif-Jet C0₂ вместе с панелью NEMA 4X для размещения приборов.Система имеет высоту 71 дюйм и может быть загружена в строительные прицепы для обработки на месте. Poli-Cut включает в себя конусообразный нижний бак с клапаном для легкой очистки. Системы Poli-Cut могут обрабатывать порционно или быть настроены на непрерывную очистку с переливом на разгрузку. Эта система контроля pH может обрабатывать от 75 до 100 галлонов в минуту поступающей воды с высоким pH.

Модель 5000SP

Модель Fortrans 5000SP представляет собой небольшую портативную систему контроля pH, способную обрабатывать и циркулировать от 65 до 75 галлонов в минуту воды с высоким pH в резервуарах, бассейнах, прудах и других подобных устройствах.Система может быть оснащена встроенными центробежными или погружными насосами с мокрым напором. Установка предназначена для облегчения транспортировки на различные объекты для точечной обработки.

Серия 6000

Новая серия Fortrans 6000 представляет собой линейку высокопроизводительных систем контроля pH, которые могут вводить до 120 фунтов углекислого газа в час в воду, содержащуюся в резервуарах или накопительных резервуарах, или даже в воду, протекающую по трубам. Оборудование серии 6000 включает в себя мощную технологию автоматизации, и эти системы размещены в высококачественных панелях NEMA 4X для долговечной работы.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка браузера для приема файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

Макрогол 3350 — обзор

Слабительные средства

У большинства пациентов с запорами ежедневная дефекация поддерживается ежедневным приемом слабительных средств, начиная с вечера посещения клиники. Рекомендуемые дозы часто используемых слабительных средств приведены в таблице 12-7.

Полиэтиленгликоль (ПЭГ) без добавления электролитов (ПЭГ 3350, MiraLax, Braintree Laboratories, Inc., Брейнтри, Массачусетс; ПЭГ 4000, Forlax, Ипсен, Париж, Франция) и полиэтиленгликоль 3350 с электролитами (Movicol, Norgine Pharmaceuticals Ltd., Великобритания) были разработаны и в настоящее время испытаны для длительного ежедневного применения в качестве слабительного у младенцев, детей ясельного возраста и детей старшего возраста. 40,41,43,52-58 ПЭГ не имеет вкуса, запаха и цвета и не образует песка при перемешивании в соке, охлаждающей жидкости или воде в течение нескольких минут. ПЭГ не разлагается бактериями; плохо всасывается и поэтому действует как отличный осмотический агент; и безопасно. 41,52,56

Лактулоза и сорбит являются невсасываемыми углеводами. Они вызывают повышенное содержание воды за счет осмотического действия лактулозы, сорбитола и их метаболитов.Они ферментируются кишечными бактериями, в результате чего образуются газы и иногда возникает дискомфорт в животе. Оба легко принимаются детьми при смешивании с безалкогольными напитками.

Механизм действия магнезиального молока заключается в относительном невсасывании магния и, как следствие, повышении осмоляльности просвета.

Минеральное масло превращается в оксижирные кислоты, вызывающие накопление жидкости и электролитов. Минеральное масло никогда не следует насильно кормить или давать пациентам с дисфагией или рвотой из-за опасности аспирационной пневмонии.Анальное просачивание минерального масла, часто вызывающее оранжевое пятно, является нежелательным побочным эффектом, особенно у детей, посещающих школу.

Сенна влияет на перистальтику кишечника, а также на транспорт жидкости и электролитов и стимулирует дефекацию. Мы используем сенну, когда задерживается жидкий стул, вырабатываемый осмотическими слабительными, а также у детей с недержанием кала и запорами, вызванными органическими или анатомическими причинами. Североамериканское общество детской гастроэнтерологии, гепатологии и питания рекомендовало продукты сенны для краткосрочной терапии. 59

Иногда я советую использовать 10-мг бисакодиловый суппозиторий или фосфатную или глицериновую клизму ежедневно в качестве начального лечения в течение нескольких месяцев у ребенка старшего возраста, который хотел бы немедленно контролировать функциональное недержание кала.

В настоящее время наиболее часто используемыми слабительными средствами являются полиэтиленгликоль и лактулоза. Гидроксид магния (магнезиальное молоко), минеральное масло и сорбит также использовались для длительного лечения. Слабительные средства следует использовать в зависимости от массы тела и степени тяжести запора.Выбор препарата при функциональном запоре представляется не таким важным, как соблюдение ребенком и родителями схемы лечения. Для любого слабительного нет установленной дозы. Для каждого ребенка существует только начальная доза (см. Таблицу 12-7), которую необходимо скорректировать, чтобы вызвать от одного до двух опорожнений кишечника в день, достаточно жидких, чтобы обеспечить полное ежедневное опорожнение нижних отделов кишечника и предотвратить недержание кала и боль в животе. .

Аэраторы DiF-JET

Продукты доступны только в США и Канаде

Новые и инновационные аэраторы: системы аэрации DiF-JET™

Аэрация является сердцем большинства промышленных и муниципальных систем очистки сточных вод, и у нас есть новое передовое решение.

Компания Fortrans, Inc.® рада представить систему аэрации и аэрации DiF-JET, которая добавляет кислород или воздух в сточные воды, чтобы обеспечить эффективность и результативность процесса очистки воды. Системы не обрастают и более эффективны, чем обычные процессы диффузии и/или аэрации.

Почему вам следует выбрать передовую технологию DiF-Jet для очистки промышленных и муниципальных вод:

Системы аэрации DiF-JET повышают эффективность производства в биологических производственных процессах, добавляя воздух или кислород для ускорения таких процессов без диффузоров в баке.

Технология DiF-JET также может использоваться для подачи озона для стерилизации воды или газообразного азота для удаления кислорода из воды при бурении нефтяных скважин. Технология также эффективна при оксигенации глубоких скважин.

Превосходная технология очистки сточных вод при добыче золота и операций по извлечению золота.

Если в вашей воде есть твердые частицы или минералы, устройства аэрации Dif-Jet будут работать эффективно, не загрязняя ее.

  • Предлагайте менее капиталоемкие решения для промышленных и муниципальных очистных сооружений.
  • Предлагайте прямое вливание газа в проточный поток воды без загрязнения или засорения. Кроме того, недорогая технология может быть включена в плавучие или стационарные системы аэрации бассейнов.
  • Может быть установлен выше или ниже по течению на проточной водопроводной воде, не загрязняя устройство, или может быть установлен на плавучей основе. Недорогие плавучие системы легко настраиваются для добавления кислорода на любую глубину или толщу воды. Системы легко перенастроить позднее для изменения мест аэрации или разных водяных столбов.
  • Портативны и могут быть оснащены контроллером растворенного кислорода (ПЛК) и датчиком растворенного кислорода или управляться с помощью регулятора давления или таймеров или комбинации давления и времени.
  • Может быть установлен на коллекторе для очень больших требований к аэрации или для перекачки аэрированной воды в определенные места на очистных сооружениях или для нескольких выходов в окислительной канаве или бассейнах окончательной аэрации перед сбросом очищенной воды.
  • Идеально подходят для операторов промышленных установок по очистке сточных вод, которые доплачивают городским очистным сооружениям за высокую биохимическую потребность в кислороде (БПК) или химическую потребность в кислороде (ХПК).Аэраторы или системы аэраторов DiF-JET легко устанавливаются на существующих объектах, чтобы исключить эти дорогостоящие дополнительные расходы. Для этих применений рекомендуется использовать кислород высокой чистоты.

Преимущества аэрации кислородом высокой чистоты

DiF-JET может использоваться с воздухом или чистым кислородом. Аэрация кислородом высокой чистоты предлагает более низкие первоначальные затраты и множество поддающихся проверке преимуществ:

  1. Легко увеличивайте загрузку и очистку органической установки энергоэффективным и экономичным способом.Диффузионный впрыск DiF-JET обеспечивает очень высокую эффективность переноса кислорода — не требуется дорогостоящая модернизация систем воздуходувки или воздушных компрессоров с соответствующим увеличением энергопотребления. Помогите избавиться от надбавок за БПК и ХПК и штрафов Агентства по охране окружающей среды.
  2. Воздух содержит 21% кислорода и 78% азота. Азот конкурирует с кислородом за растворимость, что требует более мощных воздуходувок. Азот удаляет летучие соединения, которые вызывают проблемы с запахом на многих объектах.
  3. Усиленное бактериальное дыхание с кислородом высокой чистоты распространяется на другие области и может повысить общую эффективность работы.

Сравнение двух общепринятых амбулаторных препаратов для подготовки к колоноскопии у детей и подростков

Детям часто проводят колоноскопию в диагностических и терапевтических целях. В нашем исследовании сравнивались два раствора для очистки кишечника: пикосульфат натрия, оксид магния и лимонная кислота (Pico-Salax) с жидким цитратом магния в качестве препаратов для колоноскопии.Был проведен ретроспективный обзор карт всех пациентов, наблюдавшихся в гастроэнтерологической амбулаторной клинике и подвергшихся очищению кишечника при подготовке к колоноскопии с февраля по декабрь 2006 года. 32 ребенка получали Пико-Салакс, а 36 — жидкий цитрат магния. Переносимость обоих растворов была одинаковой. У большинства детей в обеих группах был жидкий стул и полная колоноскопия. Подготовка кишечника к колоноскопии может быть успешно достигнута с использованием Пико-Салакса или жидкого цитрата магния.

1. Введение

Обследование нижних отделов желудочно-кишечного тракта методом колоноскопии часто требуется в детском возрасте не только с диагностической, но и с лечебной целью [1]. Бывают ситуации, когда эндоскописты не могут выполнить полную колоноскопию из-за неадекватной очистки кишечника, что особенно сложно для детей. Как правило, дети в нашем учреждении проходят двухдневную подготовку, которая включает в себя применение слабительных средств (пико-салакс или цитрат магния) и прозрачную жидкую диету.В ряде случаев детям проводят промывание назогастрального зонда раствором, содержащим полиэтиленгликоль-электролит, однако это требует госпитализации, что увеличивает стоимость процедуры [2].

Мы сравнили два препарата для очистки кишечника в амбулаторных условиях у детей, проходящих колоноскопию; нашим основным результатом было сравнение эффективности очищения при эндоскопии. Вторичные результаты заключались в сравнении переносимости и консистенции стула между двумя группами.

2. Материалы и методы

Был проведен ретроспективный обзор карт всех пациентов, наблюдавшихся в амбулаторной гастроэнтерологической клинике, которым проводилась чистка кишечника в рамках подготовки к колоноскопии с февраля по декабрь 2006 г. в Детской больнице Восточного Онтарио.

Медсестры клиники по своему усмотрению назначают каждому пациенту один из двух препаратов кишечника, используемых в амбулаторных условиях. Один препарат содержал оксид магния, лимонную кислоту с пикосульфатом натрия (Pico-Salax, Ferring Pharmaceuticals Inc., Канада). Этот порошок состоит из 10 мг пикосульфата натрия, 3,5 г оксида магния и 12,0 г лимонной кислоты на пакетик. Оксид магния и лимонная кислота образуют цитрат магния (при растворении в воде) и назначают следующим образом (согласно рекомендациям производителя): детям от 1 до 6 лет по 1/4 пакетика, от 6 до 12 лет по 1/2. пакетик, а дети от 12 до 18 лет принимали по 1 пакетику Пико-Салакса один раз в день в течение двух дней подряд. Жидкий цитрат магния вводили в дозе 60 мл (1.74 г цитрата магния на 30 мл) для детей от 10 до 15 кг, 90 мл для детей от 16 до 20 кг, 150 мл для детей от 21 до 35 кг и 300 мл для детей 36 кг также в течение двух дней подряд. Дополнительные меры включали введение бисакодила в дозе 15 мг детям с массой тела 20–35 кг или в возрасте от 6 до 12 лет и 20 мг детям с массой тела 36 кг или в возрасте 12–18 лет после приема Пико-Салакса или цитрата магния. Касторовое масло (15–30 мл) давали детям младше 6 лет.Дети оставались на прозрачной жидкой диете в течение двух дней до процедуры.

Врачи систематически регистрировали успешность подготовки кишечника, включая легкость эндоскопии, классифицированную по необходимости промывания и отсасывания, минимальному отсасыванию или завершению процедуры без промывания и/или отсасывания. Легкость эндоскопии считалась отличной, когда отсасывание было минимальным или не было необходимости в ирригации или отсасывании. Переносимость оценивали по регистрации таких жалоб, как рвота, спазмы и боль в животе.

Статистический анализ выполнен с использованием программного обеспечения R (V2.7.2). Двусторонние -значения менее 0,05 считались статистически значимыми. Непрерывные переменные были суммированы с использованием среднего и стандартного отклонения. Категориальные переменные были суммированы с использованием частоты и процента. Логистическую регрессию проводили для сравнения шансов на первичный исход (отличный исход) между группами, принимавшими Пико-Салакс и цитрат магния, с поправкой на возраст и без нее. Частоту отличных исходов у детей в возрасте до 6 лет и старше 6 лет сравнивали с помощью точного критерия Фишера.Вторичные исходы (переносимость и тип стула) также сравнивались между двумя группами с использованием точного критерия Фишера.

3. Результаты

Всего в исследование было включено 68 детей, 32 получали Пико-Салакс и 36 получали цитрат магния. Средний возраст лет. Из 68 кандидатов 37 (54,4%) были мужчинами. Характеристики пациента сообщаются в таблице 1.

4


3


9

0

0
Цитрат магния Value
Всего 68 32 36
Возраст лет, средний (СО) 11.63 (3.88) 13.01 (3.09) 10.40 (4.13) .0042
гендер, (%) мужской 37 (54.4) 15 (46.9) 22 (61.1) 0,35

Средний возраст значительно отличался между двумя группами (). Только 3,1% (1/32) детей, получавших Пико-Салакс, были младше 6 лет, тогда как 22,2% (8/36) детей, получавших цитрат магния, были моложе 6 лет.Таким образом, Pico-Salax чаще применялся у детей старшего возраста, тогда как цитрат магния предпочтительнее для детей младшего возраста. Пятьдесят девять процентов (19/32) детей в группе Пико-Салакса и 52,8% (19/36) в группе цитрата магния имели отличный результат (, 95% ДИ 0,5–3,4, ) (таблица 2). Логистический регрессионный анализ с учетом возраста показал, что отношение шансов на отличный исход между группой, получавшей Пико-Салакс, и группой, получавшей цитрат магния, составляло 1,50 (95% ДИ, 0,54–4,20, ).Таким образом, не было статистически значимых доказательств того, что шансы на отличный результат различались между двумя растворами для очистки кишечника.


4



Pico-Salax Магний Грубый соотношение эндоскопии (Pico-Salax / Magnesium) 95% CI для жестокого соотношения шансов -Value

(%) 19 (59.4) 19 (52.8) 1.31 0.31 0.50, 3.42 .59
EO: Отличный результат минимальный или нет необходимости для орошения и / или всасывания.

Также сравнивался процент отличных результатов у детей младше 6 лет и старше 6 лет. Было обнаружено, что у 55,6% (5/9) детей в возрасте до 6 лет был отличный исход, а у 55,9% (33/59) детей старше 6 лет был отличный результат (1).Таким образом, не было статистически значимых доказательств того, что процент отличных исходов различался у детей в возрасте до 6 лет и старше 6 лет. и боль), и у большинства пациентов симптомы отсутствуют (таблица 3). Как указано в таблице 3, у группы магния, как правило, был более жидкий стул, чем у группы пико-салакса. Однако эта разница не достигала 0.05 уровень значимости. В группе, принимавшей цитрат магния, было больше жидкого стула, чем в группе, принимавшей Пико-Салакс, поэтому, по-видимому, наблюдалось компенсирование нежелательных явлений по сравнению с твердостью стула.

93



9

1

Pico-Salax () Цитрат магния ()

Неблагоприятное мероприятие (%) 1 (3.1) 4 (11.1) .36
Нет симптомов 31 (96.9) 32 (88.9)
Табурет 50170
Сформированные табуретки (жесткие, мягкие) 8 (25) 3 (8.3) . 9098
Жидкость 24 (75) 33 (91,7)

.

Процент полной колоноскопии составил 97% в группе Pico-Salax и 92%.7% в группе цитрата магния. Было два пациента (по одному в каждой группе), которым не удалось провести полную колоноскопию из-за наличия сформированного стула; в конечном итоге эти пациенты были госпитализированы для промывания назогастрального зонда с помощью голитела (полиэтиленгликоль 3350 и раствор электролита).

4. Обсуждение

Адекватная подготовка кишечника имеет решающее значение для успешной колоноскопии. Это может быть серьезно затруднено в педиатрической популяции, поскольку прием и переносимость доступных агентов могут быть плохими.

В нашем центре доступны два протокола подготовки кишечника (пико-салакс и жидкий цитрат магния), которые используются в сочетании с бисакодилом или касторовым маслом. Интересно, что в нашем исследовании не было обнаружено существенных различий между Pico-Salax и цитратом магния. Переносимость и эффективность обоих методов были одинаковыми; это можно объяснить наличием цитрата магния (осмотического агента) в обоих растворах в качестве основного ингредиента. Добавление пикосульфата натрия (контактное слабительное, стимулирующее сокращение гладких мышц) к оксиду магния и лимонной кислоте (которая образует цитрат магния при растворении в воде) не показало более высоких преимуществ у наших пациентов.

Одним из ограничений настоящего исследования является потенциальный дисбаланс в других клинических параметрах (таких как возраст) между двумя группами. Этот дисбаланс может спутать влияние методов подготовки кишечника на результат подготовки кишечника. Маленьких детей труднее всего подготовить к колоноскопии. Мы сравнили результаты у детей младше 6 лет и детей старше 6 лет и не обнаружили различий между простотой проведения эндоскопии или переносимостью очищающего средства. Это может быть связано с небольшой когортой в нашем исследовании; Потребовалось бы включить 900 субъектов, чтобы обнаружить значительную разницу с мощностью 80%.

Можно было бы предположить, что подготовка кишечника у детей старшего возраста будет более качественной, чем у детей младшего возраста, однако в нашем исследовании это было не так. Можно предположить, что дети старшего возраста, возможно, не были полностью послушны, принимая слабительное, или что диета не соблюдалась полностью, поскольку дети старшего возраста, возможно, находились под меньшим контролем.

Существуют разногласия относительно наилучшей комбинации слабительных средств, а также необходимости диетических ограничений. Абубакар и др.[3] заявили, что пероральный прием бисакодила в течение двух дней подряд перед процедурой и фосфатная клизма утром перед процедурой обеспечили отличную подготовку кишечника, эти дети не соблюдали диетических ограничений.

С другой стороны, Dahshan et al. [4] пришли к выводу, что 2-дневный препарат бисакодила приводил к плохой очистке кишечника по сравнению с двумя препаратами Golytely или комбинацией цитрата магния и X-prep (плоды сенны, сахар и 7% спирта).

Другие считают, что ограничения в питании являются ограничивающим фактором для успешного очищения кишечника, особенно у детей.Эль-Баба и др. [5] показали, что введение предварительно упакованного диетического набора (набор твердой и жидкой пищи с низким содержанием остатков) в сочетании с цитратом магния и бисакодилом за день до процедуры было более эффективным, чем пероральный прием фосфата натрия и жидкой диеты при подготовке к колоноскопии.

Другие методы очистки кишечника, такие как пероральное введение раствора фосфата натрия, показали более высокий риск электролитных нарушений, особенно гиперфосфатемии, гипокальциемии и гипокалиемии, у 57% взрослых пациентов [6, 7] и, как можно подозревать, также быть проблематичным у детей и молодежи.

Растворы, содержащие полиэтиленгликоль-электролит, высокоэффективны при подготовке к колоноскопии у детей [4, 8], ограничением этого метода очищения кишечника является большой объем, необходимый для достижения адекватных результатов. Кроме того, большинство детей не могут принимать этот раствор перорально и нуждаются в госпитализации для промывания через назогастральный зонд, что может быть неудобно и более дорого.

Пико-Салакс показал высокую эффективность и безопасность у взрослых в качестве метода подготовки к колоноскопии [9–13].Пинфилд и Стрингер [14] описали эффективность Пико-Салакса в педиатрическом рандомизированном исследовании, в котором его сравнивали с бисакодилом. Сообщалось, что все дети (+), принимавшие Пико-Салакс, имели хорошую или отличную подготовку и меньше эпизодов болей в животе, чем в группе, получавшей бисакодил. В нашем исследовании симптомы боли в животе или рвоты были незначительными, при этом показатели переносимости в обеих группах были одинаковыми.

О высокой эффективности цитрата магния в качестве очищающего средства у взрослых сообщили Chen et al.[15], где цитрат магния в сочетании с бисакодилом переносился лучше и был более эффективен, чем касторовое масло. Цитрат магния, введенный за день до колоноскопии, оказался более эффективным, чем пероральный фосфат натрия у взрослых [16]. Совсем недавно Sabri et al. [17] сравнили цитрат магния и пероральный фосфат натрия, демонстрируя схожую переносимость и эффективность у подростков. В настоящем исследовании мы использовали цитрат магния в сочетании с бисакодилом или касторовым маслом с хорошими результатами, которые были аналогичны использованию Пико-Салакса.

Таким образом, сравнение двух доступных препаратов кишечника не показало существенной разницы в отношении простоты проведения эндоскопии и переносимости. Колоноскопия с минимальной потребностью в ирригации и/или аспирации или без нее была достигнута примерно у половины пациентов в каждой группе, а остальным потребовалось вмешательство колоноскописта, что привело к успешной полной колоноскопии у большинства пациентов. Ретроспективный характер исследования и небольшая группа участников представляют собой потенциальные ограничения, поэтому могут быть оправданы более крупные исследования.

Приложение

См. Таблицы 1, 2 и 3

Раскрытие информации

У авторов нет конфликта интересов, о котором следует заявить, и нет финансовых интересов с фармацевтическими компаниями, связанными с данным исследованием.

Как принимать Фортранс при подготовке к колоноскопии

Колоноскопия – это специальная процедура, позволяющая исследовать внутреннюю оболочку толстого кишечника. При проведении этого исследования можно выявить различные заболевания толстой кишки: язвы, воспаления, полипы и другие.Эта процедура имеет большое значение, так как во время ее проведения врач может осмотреть слизистую оболочку кишечника, что позволяет распознавать и лечить различные заболевания на ранних стадиях. Очень важно правильно подготовиться к процедуре, так как это позволит быстро и качественно провести колоноскопию, избежав при этом каких-либо осложнений. Обязательно провести полную очистку желудочно-кишечного тракта. Наиболее часто используется препарат «Фортранс», способ применения которого будет рассмотрен в данной статье.Это средство имеет форму порошка, который необходимо растворить в воде из расчета: один пакетик на 25 кг веса больного. Это средство удобно тем, что заменяет сразу несколько клизм, поэтому при подготовке к эндоскопическому исследованию кишечника многих интересует вопрос, как принимать Фортранс перед колоноскопией.

Общая подготовка к процедуре

Очень важным этапом является предварительная подготовка к колоноскопии.Чтобы все сделать правильно, необходимо за несколько дней до исследования прекратить прием (если они были) таких препаратов, как Имодиум или Лоперамид. Это связано с тем, что эти препараты обладают закрепляющим действием и способны снижать перистальтику кишечника. Кроме того, нужно перестать принимать пищу, богатую клетчаткой, постараться легче выбирать пищу и пить больше жидкости. За день до процедуры можно кушать около двух часов дня, после этого нужно воздержаться от еды до следующего дня – до окончания процедуры.

Как принимать Фортранс при подготовке к колоноскопии

Подготовиться к эндоскопическому исследованию можно одним из двух способов: с помощью Очищения кишечника клизмой или с помощью препарата «Фортранс», описание которого подробно описано в инструкции к препарату. Рассмотрим второй вариант. Для приготовления раствора содержимое одного пакетика необходимо растворить в литре воды. За день до обследования следует пить раствор маленькими глотками в течение трех-шести часов, начиная с середины дня.Как правильно принимать Фортран, подскажет инструкция к препарату, в которой указано, что пить разведенную смесь следует также утром перед процедурой.

С момента начала применения Фортранса следует отказаться от приема пищи. Количество разведенной жидкости должно удовлетворять условию: 1 литр лекарственного состава на 20 кг веса.

Часто при большом количестве выпитого лекарства «Фортранс» возникает чувство тошноты, чтобы этого не произошло, можно использовать лимон. Достаточно просто выдавить на язык несколько капель лимонного сока и чувство тошноты отступит.Также охлаждение приготовленного раствора поможет избежать неприятных ощущений. Но не следует забывать, что врач может назначить лекарство и объяснить, как принимать Фортранс.

р>>

Разработка гидрогелей, нагруженных цисплатином, для химиоэмболизации воротной вены на мышиной модели ортотопического рака печени

1. Введение

На первичный рак печени в Китае приходится половина всех случаев заболевания в мире, при этом 70–90% приходится на гепатоцеллюлярный рак карцинома (ГЦК) (Torre et al., 2016). Трансартериальная химиоэмболизация (ТАХЭ) остается стандартным методом лечения промежуточной стадии ГЦР и одним из основных способов снижения стадии прогрессирующей ГЦР перед резекцией или трансплантацией печени (Otto et al., 2013; Sieghart et al., 2015). При традиционной ТАХЭ химиотерапевтические агенты, эмульгированные с рентгеноконтрастным липиодолом, вводят через печеночную артерию, а затем эмболическую частицу (Raoul et al., 2019). Химиотерапевтические агенты оказывают локорегионарное цитотоксическое действие на рост опухоли, а эмболизация печеночной артерии приводит к ишемическому воздействию на рост опухоли (Golfieri et al., 2011; Льюис и Дреер, 2012). Эта способность в некоторой степени обеспечивает локальную доставку химиотерапевтических агентов, что снижает нежелательные системные побочные эффекты и сохраняет остаток печени. ТАХЭ на основе липиодола обычно переносится в большинстве случаев, хотя у 4-7% пациентов возникают серьезные осложнения (например, абсцесс печени, инфаркт и легочная эмболия) с почти 1% смертностью в течение одного месяца (Liapi & Geschwind, 2011). Преимущество выживаемости было спорным из-за непостоянной и нестабильной терапевтической эффективности ТАСЕ (Lencioni et al., 2012; Иде и Гуйу, 2013). Такой дефицит приводит к тому, что в нашем исследовании изучается использование биофункциональных биоматериалов в качестве новой альтернативы химиоэмболизации.

Мы создали гидрогелевую систему фотополимеризуемой полувзаимопроникающей сети (IPN), состоящую из синтетического полимера и биомакромолекул, с широким спектром потенциальных применений, включая локальную доставку лекарств (Peppas et al., 2000; Guerra et al., 2017). ). Наше предыдущее исследование показало, что нагруженный макрофагами ВПС из тиолированного желатина (Gel-PEG-Cys) и диакрилата полиэтиленгликоля (PEGdA) имитирует внеклеточный матрикс, позволяя доставлять биомолекулы клеточного происхождения для проявления противораковых функций (Guerra et al., 2017). В последние годы несколько гидрогелей были изучены в качестве потенциального кандидата в качестве материала для эмболизации при ТАХЭ для повышения переносимости пациентами и снижения системной токсичности при обеспечении депо для местной доставки лекарств (Chan et al., 2018; Chen et al., 2019). Например, Poursaid et al. синтезировали состав рекомбинантного белкового полимера, подобного шелку и эластину, который может оставаться жидким при комнатной температуре и превращаться в твердые гидрогели при 37 °C in vitro (Poursaid et al., 2015).Дж. С. Лим и соавт. изготовили pH-чувствительный гидрогель, специально образующий гелеобразную структуру в условиях низкого pH, особенно в опухолевой среде при HCC (Lym et al., 2016). В настоящее время одной из основных проблем остается очень ограниченное время пребывания гидрогеля в кровеносных сосудах опухоли из-за их активной гемодинамики при сохранении противоопухолевых свойств. В этом исследовании мы стремились оптимизировать и выяснить противоопухолевую способность и системную безопасность надежной и биоразлагаемой гидрогелевой системы IPN в качестве потенциального эмболического агента при ТАСЕ.

2. Материалы и методы

2.1. Изготовление гидрогеля IPN

Гидрогель PEGdA/Gel-PEG-Cys был синтезирован в соответствии с ранее опубликованными процедурами с некоторыми модификациями (Burmania et al., 2003; Xu et al., 2012; Guerra et al., 2017). Раствор форполимера ВПС состоял из 1 % (масс./об.) фотоинициатора Iragcure 2959, 20 % масс./об. PEGdA и 20 % масс./об. Gel-PEG-Cys, растворенных в 1× растворе PBS (pH 4,0) с добавлением или без добавления цисплатина (1 мг/мл, рН 4,0). Такие поперечно-сшитые гидрогели ВПС демонстрировали более высокий коэффициент набухания при максимальном весе, более высокое содержание воды, значительно более низкое кумулятивное растворение желатина до 7 дней и более низкую жесткость геля по сравнению с физически включенными желатиновыми гидрогелями (Fu et al., 2012; Сюй и др., 2013).

Сначала мы приготовили различные составы (таблица 1) геля-ПЭГ-цис плюс ПЭГдА, чтобы получить быстро образующийся гидрогель ВПС. 10% или 20% масс./об. раствор PEGdA и 10% или 20% масс./об. раствор Gel-PEG-Cys готовили при pH 4,0 1× PBS при 37°C. Затем раствор Gel-PEG-Cys смешивали с раствором PEGdA и 1% масс./об. фотоинициатора Iragcure 2959 путем встряхивания. 200 мкл раствора предшественника гидрогеля капали на плоское предметное стекло и подвергали воздействию длинноволнового УФ-света (λ макс. = 365 нм, интенсивность при 100 мВт/см 2 ) до тех пор, пока он не превращался в твердый гель.Как показано в таблице 1, при более высоких концентрациях раствора PEGdA и раствора Gel-PEG-Cys для образования геля может потребоваться меньше времени. Это заняло не более 2 минут при использовании 20 % раствора PEGdA (вес/объем) и 20 % раствора Gel-PEG-Cys (вес/объем), что соответствовало следующему исследованию in vivo .

Разработка гидрогелей, нагруженных цисплатином, для химиоэмболизации транспортной воротной вены на мышиной модели ортотопического рака печени

Все авторы

Xinxiang Yang, Wai-Ho Oscar Yeung, Kel Vin Tan, Tak-Pan Kevin Ng, Li Pang, Jie Zhou, Jinyang Li, Changxian Li, Xiangcheng Li, Chung Mau Lo, Weiyuan John Kao & Kwan Manhttps://doi.org/10.1080/10717544.2021.1895908

Опубликовано в Интернете:
09 марта 2021 г.

Таблица 1. Таблица рецептур.

2.2. Модель эктопической и ортотопической ГЦР на мышах

Модель мыши была создана с использованием клеток MHCC97L человека (Институт рака печени, Фуданьский университет), которые были помечены люциферазой в соответствии с протоколом, как описано ранее (Guerra et al., 2017). Использовали бестимусных мышей (возраст 6–8 недель, самцы), приобретенных в Лаборатории животных в Университете Гонконга.Для создания модели эктопической ГЦК у голых мышей 2 × 10 6 MHCC97L, суспендированных в 0,1 мл PBS, вводили подкожно в бока мышей. Подкожная опухоль была удалена через 4 недели и использована для создания ортотопической модели ГЦК. Вкратце, опухоль разрезали на фрагменты хирургическими ножницами и скальпелями в DMEM (Gibco, ThermoFisher). Объем каждого кусочка опухоли составлял приблизительно 1 мм 3 . Другой группе бестимусных мышей сделали анестезию для введения опухолевого имплантата.Фрагмент опухолевой ткани был вставлен в левую долю печени. Мыши с ортотопическими опухолями были случайным образом разделены на три группы, включая группу отрицательного контроля, группу, получавшую IPN, и группу, получавшую цисплатин-IPN. В каждую группу включали по пять мышей.

2.3. Процедура эмболизации транспортной вены (TPVE)

Процедура TPVE была изменена в соответствии с нашим предыдущим исследованием (Liu et al., 2014). Мышей лечили гидрогелями IPN с цисплатином или без него через 2 недели после имплантации фрагмента опухоли.20 мкл IPN или гидрогелей IPN, нагруженных цисплатином, вводили через основную воротную вену, в то время как правая воротная вена была пережата зажимом для мини-сосудов. Затем перевязывали печеночную артерию. Место локальной инъекции кратковременно облучали длинноволновым УФ-светом, чтобы гарантировать образование геля в левой воротной вене и в опухоли, прежде чем микрозажим был удален. Образцы периферической крови, опухолевых тканей и тканей печени, прилегающих к опухоли, брали через 2 недели после лечения ТПВЭ. Размер опухоли измеряли штангенциркулем, а объем рассчитывали по следующей формуле: V = 0.5 × Д × Ш 2 (V, объем; L, длина; W, ширина).

2.4. МРТ мелких животных и биолюминесцентная визуализация

Изображения воротной вены до и после эмболизации гидрогелем IPN были получены с помощью ПЭТ-МР-томографа nanoScan ® компании Mediso (Mediso kft., Будапешт, Венгрия). После индукции анестезии изофлураном мышей помещали в кровать сканера с грелкой для поддержания температуры тела на уровне 35 °C. Во время МРТ изофлуран вводили в дозе 1.5-3,0% в 500 мл/мин медицинского кислорода, с попыткой поддерживать частоту дыхания между 55 и 65 уд/мин. Были проанализированы последовательности Т1 и Т2 МРТ-изображений.

Развитие опухолей выявляли с помощью системы визуализации IVIS Spectrum in vivo один раз в неделю в течение 4 недель. Значения яркости опухоли автоматически рассчитывались системой визуализации со стандартным кругом, накладывающимся на область опухоли. Максимум и минимум масштабной линейки для каждого биолюминесцентного изображения устанавливали вручную на одно и то же, чтобы избежать насыщения сигнала.

2.5. Окраска гематоксилином и эозином (H&E) и иммуногистохимия (IHC)

В конце периода лечения животное умерщвляли, извлекали образцы опухоли и печени и фиксировали в 10% формалине, а затем заливали в парафин. Предметные стекла (толщиной 4 мкм) депарафинизировали в ксилоле с последующим ополаскиванием в этаноле. После регидратации препараты обрабатывали растворами гематоксилина и эозина для гистологического исследования. Окрашивание ИГХ проводили для обнаружения экспрессии Ki67 и CD34, как описано ранее (Li et al., 2014).

2.6. Анализ Tunel

Фрагменты ДНК

(представляющие апоптоз) были обнаружены с помощью метода мечения концевых участков терминальной дезоксинуклеотидилтрансферазой dUTP (TUNEL). Предметные стекла тканей инкубировали с 1 мкг/мл протеиназы К в течение 15 мин при комнатной температуре, дважды промывали PBS и инкубировали с раствором TUNEL в течение 60 мин при 37°С в темноте. Затем предметные стекла трижды промывали PBS с последующей инкубацией с хромогенным раствором субстрата HRP в течение 30 минут при комнатной температуре.Сигнал коричневого цвета генерировал указанные апоптотические клетки.

2.7. Определение сывороточного альфа-фетопротеина (АФП)

Уровни сывороточного АФП у мышей определяли в соответствии с инструкцией производителя (Abcam).

2.8. Полимеразная цепная реакция с обратной транскрипцией (ОТ-ПЦР)

Экспрессия внутриопухолевого VEGF и мРНК HIF-1α была обнаружена с помощью ОТ-ПЦР, которая проводилась с использованием модифицированного протокола, как описано ранее (Li et al., 2014) . VEGF человека (прямая последовательность: GGGTGCAGCCTAAAAGGACC и обратная: AGGGGATGGAGGAAGGTCAA, соответствующая эталонной последовательности NCBI NM_001025366.3) и HIF-1α (прямая последовательность: TGTAATGCTCCCCTCACCCA и обратная: TGCAGGGTCAGCACTACTTC, соответствующая эталонной последовательности NCBI NM_001530.4) были получены от Thermo Fisher Scientific Co. Вкратце, реакционную смесь для ПЦР готовили следующим образом: 2 мкл кДНК, 10 мкл SYBR Green, 0,1 мкл смеси праймеров (10 пмоль/мкл) и 7,9 мкл дистиллированной H 2 O. Условия проведения ПЦР устанавливали следующим образом: 50 °C, 2 минуты для 1 цикла, 95 °C, 10 минут для 1 цикла. , 95 °C 15 секунд с 60 °C 1 мин для 40 циклов, 95 °C 15 секунд для 1 цикла, 60 °C 1 мин для 1 цикла и 95 °C 15 секунд для 1 цикла. -△△T по сравнению с нормальной печенью.

2.9. Вестерн-блоттинг

Вестерн-блоттинг проводили с использованием системы электрофореза SDS-PAGE, как описано ранее (Li et al., 2014), с моноклональными антителами, специфичными к β-актину (MAB8929, R&D Systems), VEGF (ab46154, Abcam), AKT (9272S, Cell Signaling Technology), фосфо-AKT (13038, Cell Signaling Technology), Erk1/2 (4695, Cell Signaling Technology), фосфо-Erk1/2 (9101, Cell Signaling Technology), каспаза 3 (9662, Cell Signaling Technology). Technology) и расщепленную каспазу 3 (9579, Cell Signaling Technology).Антитело против β-актина разводили в концентрации 1:50000 для использования. Остальные антитела разводили в соотношении 1:2000 в качестве рабочей концентрации.

2.10. Статистический анализ

Статистический анализ проводился с использованием программного обеспечения GraphPad Prism 6. Непрерывные переменные были представлены как среднее ± стандартное отклонение (SD). Статистическую значимость различий между экспериментальными группами определяли с помощью анализа Манна-Уитни. Значение p < 0,05 было статистически значимым.

3. Результаты

3.1. Эмболизация гидрогелем ВПС левой воротной вены и внутриопухолевых микрососудов

После in situ-фотополимеризации ВПС в левой воротной вене сформировался выраженный массивный некроз левой доли печени (рис. 1(А)). Ишемическое повреждение привело к перипортальному и сливному некрозу, при котором гепатоциты были заменены фрагментами ядер мертвых гепатоцитов и инфильтрированными воспалительными клетками, вовлекающими множественные печеночные дольки в левую долю через 24 часа после инъекции гидрогеля IPN (рис. 1(A)).Некроз печени уменьшился на 7 дней позже по сравнению с подострой фазой (24 часа) (рис. 1(А)). Однако через 24 часа и 7 дней в легких и сердце не было обнаружено ни воспаления, ни некрозов (рис. 1(А)). Анатомию воротной вены сканировали с помощью МРТ в разные моменты времени после эмболизации воротной вены. Как Т2-взвешенные, так и Т1-взвешенные аксиальные МРТ-изображения показали, что левая ветвь воротной вены была полностью заблокирована через 2 часа (рис. 1(В)). Впоследствии через 24 часа после эмболизации наблюдалось обесцвечивание гидрогелей ВПС в левой воротной вене (рис. 1(В)).Эти результаты показали, что гидрогели IPN блокировали левую воротную вену в течение короткого времени сразу после полимеризации и постепенно разрушались и проникали в печень, вызывая тяжелое ишемическое повреждение левой доли печени.

Разработка гидрогелей, нагруженных цисплатином, для химиоэмболизации транспортной воротной вены на мышиной модели ортотопического рака печени

Все авторы

Xinxiang Yang, Wai-Ho Oscar Yeung, Kel Vin Tan, Tak-Pan Kevin Ng, Li Pang, Jie Zhou, Jinyang Li, Changxian Li, Xiangcheng Li, Chung Mau Lo, Weiyuan John Kao & Kwan Manhttps://doi.org/10.1080/10717544.2021.1895908

Опубликовано в Интернете:
09 марта 2021 г.

Рисунок 1. Тяжелый некроз печени в левой доле печени был вызван инъекцией гидрогеля IPN на ранней стадии. (A) Гистология печени была обнаружена с помощью окрашивания H&E. Обведенные области указывают на некроз печени. Бар = 400 мкм. (B) Анатомия воротной вены была просканирована с помощью МРТ до и после (через 2, 18 и 24 часа) обработки гидрогелем IPN.Верхняя панель представляла собой Т2-взвешенные МРТ-изображения, а нижняя панель представляла собой Т1-взвешенные МРТ-изображения. ( C ) Меченые RFP гидрогели и опухолевые клетки, меченные GFP, в области опухоли через 2 недели после обработки гидрогелем IPN были обнаружены с помощью флуоресцентного микроскопа. Бар = 200 мкм.

В модели ортотопической ГЦК у мышей, созданной с помощью клеток MHCC97L, меченных GFP, мышей лечили гидрогелями IPN, меченными RFP. Сигналы RFP появились в микрососудах в области опухоли через две недели после обработки гидрогелем IPN (рис. 1(C)), что свидетельствует о длительном пребывании гидрогелей IPN во внутриопухолевых микрососудах.

3.2. TPVE на основе гидрогеля IPN подавлял развитие опухоли в мышиной модели ортотопической ГЦР

В мышиной модели ортотопической ГЦК, установленной меченными люциферазой клетками MHCC97L (Qi et al., 2016), мыши были разделены на три группы: отрицательный контроль (инъекция PBS ), IPN (обработанный гидрогелем IPN) и цисплатин-IPN (обработанный IPN, нагруженным цисплатином). Для наблюдения за развитием ортотопической опухоли печени применяли спектральную визуализацию IVIS. В первые три недели не было никаких существенных различий сигналов люциферазы между группой отрицательного контроля, группой IPN и группой цисплатин-IPN.На 4-й неделе средние уровни сигналов люциферазы у мышей в группе ВПН (9,61 ± 7,41 × 10 6 , p   = 0,050) и в группе цисплатин-ВПН (4,66 ± 2 6 6 6 0 4 х 6 900 10 900).  = .017) были значительно ниже, чем в группе отрицательного контроля (3,11 ± 1,95 × 10 7 ). Кроме того, сигналы в группе цисплатин-IPN были ниже, чем в группе IPN, что указывает на усиленный противоопухолевый эффект из-за добавления цисплатина (рис. 2(A)). Мышей забивали через 4 недели после имплантации опухоли.Средний объем опухолей в группе отрицательного контроля был значительно выше, чем в группе IPN и цисплатин-IPN соответственно (0,64 ± 0,25 против 0,29 ± 0,16 и 0,18 ± 0,15 см 3 ) (рис. 2 (B)). Альфа-фетопротеин (АФП) является специфическим биомаркером плазмы для развития ГЦК. Уровень АФП у мышей из группы цисплатин-IPN был значительно ниже, чем в группе отрицательного контроля и группе IPN соответственно (2,797 ± 0,369 против 4,317 ± 0,414 и 3,727 ± 0,829 нг/мл) (рис. 2(C)).Эти результаты показали, что ВПС, полимеризованный в TPVE, подавлял рост опухоли, и этот эффект еще больше усиливался, когда гидрогель ВПС был загружен цисплатином.

Разработка гидрогелей, нагруженных цисплатином, для химиоэмболизации транспортной воротной вены на мышиной модели ортотопического рака печени

Все авторы

Xinxiang Yang, Wai-Ho Oscar Yeung, Kel Vin Tan, Tak-Pan Kevin Ng, Li Pang, Jie Zhou, Jinyang Li, Changxian Li, Xiangcheng Li, Chung Mau Lo, Weiyuan John Kao & Kwan Manhttps://doi.org/10.1080/10717544.2021.1895908

Опубликовано в Интернете:
09 марта 2021 г.

Рисунок 2. TPVE на основе гидрогеля IPN уменьшил развитие опухоли (A) Спектр IVIS был введен для мониторинга развития опухоли каждую неделю после имплантации опухоли в течение 4 недель. На гистограмме показана средняя передача сигналов лучистости (люцифераза) опухолей. (B) Объем опухоли исследовали и сравнивали в каждой группе. (C) Уровни АФП в плазме сравнивали в каждой группе ( N  = 5/группа; ∗ p <  .05 различия между экспериментальной группой и группой отрицательного контроля; #p <  0,05 различия между группами лечения).

3.3. TPVE на основе гидрогеля ВПС подавлял пролиферацию опухоли

Окрашивание опухолевых тканей гематоксилин-эозином показало, что зоны некроза как в группе ВПП, так и в группе цисплатин-ВПС были значительно больше, чем в группе отрицательного контроля (рис. 3(А)). Однако в соседних неопухолевых областях каждой группы не наблюдалось некроза или воспаления (дополнительный рисунок), что указывает на то, что эмболизация сосудов, вызванная гидрогелями IPN, в основном затрагивала микрососуды опухоли.Окрашивание Ki67 использовали для оценки способности опухоли к пролиферации после TPVE. Как и ожидалось, среднее количество ki67-позитивных опухолевых клеток было значительно меньше в группе IPN и группе цисплатин-IPN по сравнению с таковым в группе отрицательного контроля (рис. 3(B)). Кроме того, в группе цисплатин-IPN наблюдалось усиление нарушенной пролиферации опухоли, чем в группе IPN, из-за высвобождения цисплатина (рис. 3(B)). Анализ TUNEL был проведен для изучения уровней апоптоза опухоли в каждой группе. Результаты показали увеличение количества TUNEL-положительных клеток в группе IPN и группе цисплатин-IPN по сравнению с группой отрицательного контроля (рис. 3(C)).

Разработка нагруженных цисплатином гидрогелей для химиоэмболизации транспортной воротной вены на мышиной модели ортотопического рака печени

Все авторы

Xinxiang Yang, Wai-Ho Oscar Yeung, Kel Vin Tan, Tak-Pan Kevin Ng, Li Pang, Jie Zhou, Jinyang Li, Changxian Li, Xiangcheng Li, Chung Mau Lo, Weiyuan John Kao & Kwan Manhttps://doi.org/10.1080/10717544.2021.1895908

Опубликовано в Интернете:
09 марта 2021 г.

Рисунок 3. TPVE на основе гидрогеля IPN подавляет пролиферацию опухоли. (A) Гистология опухоли была обнаружена с помощью окрашивания H&E. Бар = 400 мкм. Процент площади некроза в опухолях сравнивали для каждой группы, как показано на гистограмме.(B) Уровни пролиферации определяли окрашиванием анти-Ki67. Бар = 200 мкм. Ki67-положительные клетки на поле в опухолях сравнивали в каждой группе, как показано на гистограмме. (C) Уровни апоптоза были обнаружены с помощью анализа TUNEL. Бар = 200 мкм. TUNEL-положительные клетки на поле в опухолях сравнивали в каждой группе, как показано на гистограмме. (D) Экспрессия внутриопухолевой каспазы 3, расщепленной каспазы 3, Akt, фосфорилированного Akt, ERK1/2 и фосфорилированного ERK1/2 из каждой группы была обнаружена с помощью вестерн-блоттинга.(∗ p <  0,05 различий между экспериментальной группой и группой отрицательного контроля; #p <  0,05 различий между лечебными группами).

Поскольку каспаза 3 обычно активируется в процессе клеточного апоптоза, запускаемого как внешними, так и внутренними факторами (Ghavami et al., 2009), мы дополнительно исследовали уровень ее экспрессии в каждой группе. Результаты вестерн-блоттинга показали, что экспрессия расщепленной каспазы 3 увеличилась как в группе IPN, так и в группе цисплатин-IPN, будучи более выраженной в группе цисплатин-IPN (рис. 3(D)).Напротив, активация сигнальных путей Akt и MAPK/ERK способствует выживанию клеток за счет ингибирования проапоптотических белков, включая каспазу 3 (Vauzour et al., 2007; Balmanno and Cook, 2009). Как показано на рисунке 3(D), результат указывает на то, что фосфорилирование экспрессии Akt и Erk1/2 подавляется в группах IPN и цисплатин-IPN. В совокупности данные свидетельствуют о том, что эмболизация воротной вены и химиоэмболизация гидрогелем IPN подавляют пролиферацию опухолевых клеток печени и индуцируют апоптоз опухоли.

3.4. TPVE на основе гидрогеля IPN сдерживал опухолевый ангиогенез и гипоксию

Плотность микрососудов опухоли (MVD), характеризуемая экспрессией CD34, оценивали для оценки степени ангиогенеза в быстрорастущей опухоли. Результаты окрашивания CD34 с помощью ИГХ показали, что уровни MVD как в группе IPN, так и в группе цисплатин-IPN были заметно ниже, чем в группе отрицательного контроля через 4 недели после имплантации опухоли (рис. 4 (A)), что позволяет предположить, что лечение TPVE подавляло опухоль. ангиогенез.Сообщалось, что сигнальный путь индуцируемого гипоксией фактора 1-альфа (HIF-1α)/фактора роста эндотелия сосудов (VEGF) играет ключевую роль в образовании новых кровеносных сосудов в ответ на низкий уровень кислорода, травмы, цитокины и факторы роста (Ferrara, 2004; Де Франческо и др., 2017). Как показано на рисунке 4(B), экспрессия мРНК как HIF-1α, так и VEGF была значительно снижена как в группе IPN, так и в группе цисплатин-IPN. Как и ожидалось, результаты вестерн-блоттинга показали, что внутриопухолевая экспрессия VEGF была снижена в группе ИПН, особенно в группе цисплатин-ИПН, по сравнению с отрицательным контролем (фиг. 4(С)).Гипоксия является распространенным явлением во внутриопухолевых областях ГЦК из-за аномальной микроциркуляции и неконтролируемой пролиферации ГЦК, что приводит к ангиогенезу (Xiong et al., 2017). Гидрогель IPN блокировал внутриопухолевые микрососуды после TPVE, а затем уменьшал поступление кислорода к опухоли, что могло способствовать гипоксии в опухоли. Таким образом, мы оценили уровни гипоксии в мышиной модели, обнаружив 8  F-фтормизонидазол ( 18  F-FMISO), обычно используемый индикатор ПЭТ-МРТ для выявления гипоксии, через 4 недели после имплантации опухоли.Как показано на рисунке 4 (D), поглощение 18  F-FMISO опухолью в группе ВПН было значительно ниже по сравнению с отрицательным контролем, что свидетельствует о снижении гипоксии после обработки гидрогелем ВПП.

Разработка гидрогелей, нагруженных цисплатином, для химиоэмболизации транспортной воротной вены на мышиной модели ортотопического рака печени

Все авторы

Xinxiang Yang, Wai-Ho Oscar Yeung, Kel Vin Tan, Tak-Pan Kevin Ng, Li Pang, Jie Zhou, Jinyang Li, Changxian Li, Xiangcheng Li, Chung Mau Lo, Weiyuan John Kao & Kwan Manhttps://doi.org/10.1080/10717544.2021.1895908

Опубликовано в Интернете:
09 марта 2021 г.

Рисунок 4. TPVE на основе гидрогеля IPN подавляет опухолевый ангиогенез. (A) MVD (плотность микрососудов) определяли окрашиванием анти-CD34. Бар = 200 мкм. MVD на поле в опухолях сравнивали в каждой группе, как показано на гистограмме. (B) Экспрессия мРНК внутриопухолевых HIF-1α и VEGFA была обнаружена с помощью RT-PCR.(C) Экспрессию VEGF в опухолях каждой группы определяли с помощью вестерн-блоттинга. ( D ) Уровни поглощения 18   F-FMISO в группе IPN и группе отрицательного контроля были зафиксированы с помощью сканирования microPET-MRI. (∗ p <  0,05 различия между экспериментальной группой и группой отрицательного контроля).

4. Обсуждение

В настоящем исследовании мы изготовили тиолированный гидрогель Gel-PEG-Cys и сшитый PEGdA ВПС, нагруженный цисплатином, предлагая эмболическую частицу и агент доставки лекарств для ТАСЕ.Это исследование было первым, в котором сообщалось, что эмболизация транспортной воротной вены с использованием гидрогелей IPN продемонстрировала противоопухолевый эффект за счет снижения выживаемости опухолевых клеток и ангиогенеза. Нагруженные цисплатином гидрогели IPN обеспечивали как блокировку кровоснабжения, так и доставку противоопухолевых химиотерапевтических препаратов в модели ортотопической ГЦК у мышей.

На эффективность ТАСЕ может влиять опухолевый ангиогенез остаточного заболевания, при котором HIF-1α и VEGF играют ключевую роль в ответ на гипоксию (Liang et al., 2010; Лю и др., 2016). Локальная гипоксия в опухоли, индуцированная ТАСЕ, может оказывать дальнейшее влияние на экспрессию HIF-1α и VEGF. Исследования показали, что уровни как HIF-1α, так и VEGF в сыворотке быстро увеличивались через день после ТАСЕ, а затем постепенно снижались до уровня, существовавшего до ТАСЕ (Li et al., 2004; Guo et al., 2012; Ranieri et al., 2015). Но внутриопухолевая экспрессия HIF-1α и VEGF оставалась спорной. В настоящем исследовании экспрессия HIF-1α и VEGF в опухоли снизилась после эмболизации как IPN, так и цисплатин-IPN по сравнению с группой отрицательного контроля.Более того, окрашивание CD34 в опухоли указывало на то, что ангиогенез был подавлен обработкой IPN и цисплатином-IPN. Для дальнейшего определения уровня гипоксии опухоли после лечения TPVE на основе IPN мы выполнили 18   F-FMISO PET-MRI сканирование мышей. Результаты показали, что гипоксия в опухоли уменьшилась после лечения TPVE на основе IPN.

Гидрогели IPN также стали новой платформой для доставки химиотерапевтических препаратов в локальные области. Способы увеличения локальной концентрации химиотерапевтических средств стали активной областью исследований доставки на основе гидрогеля.Физическая сшивка полимерных цепей может быть достигнута с помощью различных триггеров окружающей среды (pH, температура, ионная сила) и физико-химических взаимодействий (гидрофобные взаимодействия, конденсация заряда, водородная связь, стереокомплексообразование или супрамолекулярная химия) (Hoare and Kohane, 2008). . В исследовании Джэ Сын Лима авторы разработали чувствительный к рН гидрогель, который может образовывать твердый гель в месте опухоли, где рН снижен (Lym et al., 2016). Как показано в настоящем исследовании, более сильные противоопухолевые и проапоптозные эффекты в опухоли были вызваны инъекцией гидрогеля ВПС, нагруженного цисплатином, по сравнению с чистыми гидрогелями ВПС, что указывает на применимость гидрогелей ВПС в качестве платформы для доставки лекарств.После лечения TPVE на основе цисплатина-IPN мы наблюдали некроз в участках опухоли, но не в прилегающих к опухоли тканях печени, предполагая, что эмболизация цисплатином-IPN в основном затрагивала локальный участок опухоли, а не нормальную ткань печени. Цисплатин является хорошо зарекомендовавшим себя химиотерапевтическим средством для лечения различных видов рака человека, включая рак легких (Pietanza et al., 2016), мочевого пузыря (Kamat et al., 2016), яичников (Armstrong et al., 2006) и рак печени ( Группа по изучению рака печени Японии, 2013 г.). Доставка на основе гидрогеля может обеспечить пролонгированное высвобождение лекарственного средства и обеспечить локальную доставку (Narayanaswamy and Torchilin, 2019).В нашей мышиной модели гидрогели IPN блокировали левую воротную вену за короткое время, оставаясь в микрососудах опухоли до конечной точки эксперимента. Скорость высвобождения растворенных веществ таким гидрогелем ВПС можно контролировать в зависимости от состава желатина и ПЭГ (Fu and Kao, 2010; Guerra et al., 2017). Одним из ограничений нашего исследования было то, что скорость высвобождения цисплатина была неизвестна после TPVE. Мы предположили высвобождение цисплатина на основании фактов усиленного противоопухолевого действия.

Добавить комментарий

Ваш адрес email не будет опубликован.

Copyright © 2022 Муниципальное образование «Новоторъяльский муниципальный район» Республика Марий Эл

(A) Гистология печени была обнаружена с помощью окрашивания H&E. Обведенные области указывают на некроз печени. Бар = 400 мкм. (B) Анатомия воротной вены была просканирована с помощью МРТ до и после (через 2, 18 и 24 часа) обработки гидрогелем IPN. Верхняя панель представляла собой Т2-взвешенные МРТ-изображения, а нижняя панель представляла собой Т1-взвешенные МРТ-изображения.( C ) Меченые RFP гидрогели и опухолевые клетки, меченные GFP, в области опухоли через 2 недели после обработки гидрогелем IPN были обнаружены с помощью флуоресцентного микроскопа. Бар = 200 мкм.

На гистограмме показана средняя передача сигналов лучистости (люцифераза) опухолей. (B) Объем опухоли исследовали и сравнивали в каждой группе. (C) Уровни АФП в плазме сравнивали в каждой группе ( N  = 5/группа; ∗ p <  .05 различия между экспериментальной группой и группой отрицательного контроля; #p <  0,05 различия между группами лечения).

Рисунок 3. Гидрогель с подавлением IPN разрастание опухоли.(A) Гистология опухоли была обнаружена с помощью окрашивания H&E. Бар = 400 мкм. Процент площади некроза в опухолях сравнивали для каждой группы, как показано на гистограмме. (B) Уровни пролиферации определяли окрашиванием анти-Ki67. Бар = 200 мкм. Ki67-положительные клетки на поле в опухолях сравнивали в каждой группе, как показано на гистограмме. (C) Уровни апоптоза были обнаружены с помощью анализа TUNEL. Бар = 200 мкм. TUNEL-положительные клетки на поле в опухолях сравнивали в каждой группе, как показано на гистограмме.(D) Экспрессия внутриопухолевой каспазы 3, расщепленной каспазы 3, Akt, фосфорилированного Akt, ERK1/2 и фосфорилированного ERK1/2 из каждой группы была обнаружена с помощью вестерн-блоттинга. (∗ p <  0,05 различий между экспериментальной группой и группой отрицательного контроля; #p <  0,05 различий между лечебными группами).

Рисунок 4. TPVE на основе гидрогеля IPN подавлял ангиогенез опухоли. (A) MVD (плотность микрососудов) определяли окрашиванием анти-CD34. Бар = 200 мкм. MVD на поле в опухолях сравнивали в каждой группе, как показано на гистограмме. (B) Экспрессия мРНК внутриопухолевых HIF-1α и VEGFA была обнаружена с помощью RT-PCR. (C) Экспрессию VEGF в опухолях каждой группы определяли с помощью вестерн-блоттинга.( D ) Уровни поглощения 18   F-FMISO в группе IPN и группе отрицательного контроля были зафиксированы с помощью сканирования microPET-MRI. (∗ p <  0,05 различия между экспериментальной группой и группой отрицательного контроля).