Заболеваемость гриппом и орви: О ситуации по заболеваемости гриппом и ОРВИ в Китайской Народной Республике

Содержание

В Роспотребнадзоре сообщили о росте заболеваемости гриппом в Москве

  © Игорь Самохвалов/ПГ

В Москве на второй неделе 2022 года (с 10 по 16 января) выросла заболеваемость гриппом и ОРВИ. Об этом сообщается на сайте столичного управления Роспотребнадзора.

В то же время показатели заболеваемости остаются ниже расчётных эпидемических пороговых величин среди детей всех возрастов. К примеру, среди детей 0-2 лет ниже на 80,4 процента, среди детей 3-6 лет — на 80,5 процента, среди детей 7-14 лет — на 54,9 процента. Однако среди взрослых превышение порогов заболеваемости гриппом и ОРВИ наблюдается на протяжении 30 недель. 

«Эпидемиологическая ситуация по гриппу и острым респираторным вирусным инфекциям (ОРВИ) в городе с 10 по 16 января 2022 года соответствует данному периоду года, отмечается умеренный уровень заболеваемости ОРВИ и гриппом, обусловленный циркуляцией вирусов гриппа и вирусов негриппозной этиологии: риновирусом, РС-вирусом, другими вирусами негриппозной этиологии», — отмечается в сообщении.

Читайте также:

• Роспотребнадзор: заболеваемость гриппом и ОРВИ превысила эпидпороги в 46 регионах • Исаев прокомментировал планы разрешить онлайн-торговлю рецептурными лекарствами • Роспотребнадзор предупредил о риске одновременного заражения гриппом и COVID-19

При этом по данным на 16 января, в столице вакцинацию от гриппа прошли около 7,3 миллиона человек, что составляет 57,72 процента от численности населения, включая привитых за счёт организаций и индивидуальных предпринимателей. Охват детей вакцинацией против гриппа составляет 65,43 процента.  

«В период подъёма заболеваемости гриппом и ОРВИ большое значение в плане профилактики заболеваемости имеет ношение масок в общественных местах, соблюдение социальной дистанции, мытье и обработка антисептиками рук, недопущение присутствия в организованном коллективе больных людей, которые являются источниками инфекции для окружающих», — подчеркнули в ведомстве. 

Ранее Роспотребнадзор сообщил, что заболеваемость гриппом и ОРВИ превысила эпидемические пороги в 46 регионах.   

По данным Роспотребнадзора на территории края регистрируется неэпидемический уровень заболеваемости ОРВИ и гриппом

За 02 неделю 2017 года (с 09.01.2017 г. по 15.01.2017 г.) на территории Красноярского края заболело 11661 человек. Заболеваемость ОРВИ и гриппом составила 40,7 на 10 тыс. населения. Показатель заболеваемости гриппом и ОРВИ на уровне предыдущей недели.

Заболеваемость гриппом и ОРВИ за отчетную неделю в Красноярском крае была выше эпидемического порога на 33,9 % в возрастной группе среди взрослого населения.

В связи с эпидемическим подъемом уровня заболеваемости гриппом и ОРВИ среди взрослого населения на территории Красноярского края введен комплекс противоэпидемических мероприятий против ОРВИ и гриппа, в части организации фильтров по разграничению приема лиц с температурой, признаками гриппа и ОРВИ в лечебно-профилактических организациях Красноярского края, обслуживающих взрослое население; введения режима текущей дезинфекции, обеззараживания воздуха и усиление режима проветривания во всех помещениях учреждений; обеспечения преимущественного обслуживания населения с признаками заболевания гриппом и ОРВИ на дому.

На прошедшей неделе, согласно данных лабораторного мониторинга за циркуляцией вирусов гриппа и ОРВИ, на территории Красноярского края среди населения преимущественно циркулировали возбудители гриппа типа А (h4N2) – 9,3 %, РС вирусные инфекции – 4,3 %, аденовирусной инфекции и другие респираторные вирусы – 3,6 %.

С целью профилактики заболевания гриппом и ОРВИ рекомендуется избегать контакта с больными людьми, использовать лицевую маску для защиты органов дыхания, воздержаться от посещения мест с большим скоплением людей (общественный транспорт, торговые центры, кинотеатры), регулярно проветривать помещение, в котором Вы находитесь. Необходимо вести здоровый образ жизни, совершать частые прогулки на свежем воздухе, полноценно питаться.

Будьте внимательны к своему здоровью – при появлении первых признаков заболевания необходимо остаться дома и вызвать врача. Вовремя начатое лечение существенно снижает риск развития осложнений.

В Москве выросла заболеваемость ОРВИ и гриппом

https://ria. ru/20220201/zabolevaemost-1770453130.html

В Москве выросла заболеваемость ОРВИ и гриппом

В Москве выросла заболеваемость ОРВИ и гриппом — РИА Новости, 01.02.2022

В Москве выросла заболеваемость ОРВИ и гриппом

Заболеваемость гриппом и ОРВИ в Москве среди взрослого и совокупного населения превышает эпидпороги, при этом среди детей заболеваемость сохраняется ниже… РИА Новости, 01.02.2022

2022-02-01T12:10

2022-02-01T12:10

2022-02-01T12:10

общество

грипп

москва

здоровье — общество

орви

россия

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/07e4/0c/08/1588252262_0:159:2876:1776_1920x0_80_0_0_8caff5a6e2145ea903423bbd672fcb12.jpg

МОСКВА, 1 фев — РИА Новости. Заболеваемость гриппом и ОРВИ в Москве среди взрослого и совокупного населения превышает эпидпороги, при этом среди детей заболеваемость сохраняется ниже пороговых величин, сообщается на сайте Управления Роспотребнадзора по Москве. Отмечается, что эпидемиологическая ситуация по гриппу и острым респираторным вирусным инфекциям (ОРВИ) в Москве с 24 по 31 января 2022 года характеризуется ростом заболеваемости ОРВИ и гриппом, преимущественно за счёт циркуляции риновируса и других вирусов не гриппозной этиологии.»На четвертой неделе 2022 года в сравнении с предыдущей неделей продолжается рост показателей заболеваемости по гриппу и ОРВИ среди всех возрастных групп населения. Вместе с тем, показатели заболеваемости остаются ниже расчётных эпидемических пороговых величин среди детей во всех возрастных группах», — говорится в сообщении.В том числе среди детей 0-2 лет заболеваемость ниже эпидпорога на 72,7%, среди детей 3-6 лет — на 64,1%, среди детей 7-14 лет — на 9,1%.»В то же время среди совокупного и взрослого населения наблюдается превышение эпидемических порогов заболеваемости гриппом и ОРВИ», — говорится в сообщении.

https://ria.ru/20220130/orvi-1770167389.html

https://ria.ru/20220131/covid-19-1770356605. html

москва

россия

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2022

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/07e4/0c/08/1588252262_6:0:2737:2048_1920x0_80_0_0_bde56b44aab1774ba65355c70b69bf14.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og. xn--p1ai/awards/

общество, грипп, москва, здоровье — общество, орви, россия

В Москве выросла заболеваемость ОРВИ и гриппом

Осторожно — грипп!

Среди многообразия инфекционных заболеваний, известных в современном мире, острые респираторные вирусные инфекции, в том числе-грипп, занимают 1 место по распространённости. Чаще всего заболеваемость ОРВИ вызывается вирусами парагриппа, аденовирусами, РС-вирусами, гриппа А (называемого сезонным) и В.

Следует отметить, что в эту осень прививочная кампания против гриппа идёт более активно, чем в прошлом году. Значительная часть приморцев, подлежащая вакцинации по плану, уже привита и врачи уверены, что к 1 ноября прививочная кампания будет завершена. И взрослые и дети в нынешнем году прививаются отечественной вакциной «Совигрипп». Иммунизация поможет им избежать заражения или, в случае заболевания, перенести его в лёгкой форме и без осложнений.

Детвора – наиболее активная категория населения. За день у неё может быть множество контактов с респираторными вирусными инфекциями: в детских садах, школах, кружках, секциях, просто на прогулках во дворе, а в зимние каникулы – на утренниках и новогодних праздниках. И именно от детей зачастую заражаются остальные члены семьи.

В нескольких словах напомним, что грипп – вирусное заболевание, быстро распространяется воздушно-капельным путём (при близком общении, кашле, разговоре, чихании). Особую опасность представляют места массового скопления людей. Для нас, взрослых, в первую очередь – заполненные «до отказа» автобусы, большие коллективы на предприятиях.

Заболевание начинается настолько остро, что больной может с точностью назвать день и даже час, когда он почувствовал себя плохо: резкий подъём температуры тела до высоких цифр, головная и мышечные боли, резь в глазах, светобоязнь. У некоторых грипп протекает только с этими симптомами – «на сухую». У других присоединяются кашель и обильный насморк. Кто-то выздоравливает через 5-7 дней, а кому-то мало и 2 недель. Всё зависит от степени иммунитета организма, от наличия у человека хронических заболеваний, от присоединения вторичной инфекции. Опасность представляют развивающиеся в этих случаях осложнения со стороны ЛОР-органов (воспаления среднего уха, гайморовых пазух, гортани), бронхо-лёгочной, сердечно-сосудистой систем, почек, суставов.

Любые органы и системы могут стать «мишенью» для возникновения воспалительного процесса, надолго выводящего человека из строя. Именно для избежания такого рода неприятностей и проводится вакцинация.

Заведующая Краевым центром вакцинопрофилактики Е.А.Воробьёва отмечает, что сейчас ещё можно привиться, пока грипп «не набрал обороты».

Следующий, очень важный вопрос – ношение масок. Они предохраняют верхние дыхательные пути от проникновения вирусов. Поэтому использование масок можно отнести к культуре поведения – «мы не хотим заразиться и не хотим заразить других».

В период повышенной заболеваемости ОРВИ для профилактики гриппа специалисты рекомендуют приём противовирусных препаратов, но этот вопрос следует решить с врачом. Для повышения защитных сил организма хорошо использовать наши природные растительные адаптогены (жень-шень, аралию, лимонник, элеутерококк, солодку и др.), а также поливитаминные комплексы, содержащие витамины А, С, Е, группы В. Для обработки носовых ходов в целях предупреждения попадания вирусов при дыхании перед выходом из дома следует использовать оксолиновую мазь или другой препарат аналогичного действия.

Конечно же почаще мыть руки с мылом или использовать влажные антибактериальные салфетки. А придя домой – умыться и промыть носовые ходы.

При возникновении симптомов болезни обязательно обращаться к врачу и оставаться дома, чтобы не отягощать своё состояние осложнением и не заражать других.

КГБУЗ «ВКДЦ» Приморский краевой центр медицинской профилактики, врач Минеева Т.Н.

Грипп — это острая вирусная инфекция, легко распространяемая от человека человеку. Вирус гриппа циркулирует во всем мире, и им может заболеть любой человек из любой возрастной группы. Грипп вызывает ежегодное сезонное повышение заболеваемости, пик которой в районах с умеренным климатом приходится на зиму.

Признаки и симптомы

Для сезонного гриппа характерны внезапное появление высокой температуры, кашель (обычно сухой), насморк, головная боль, ломота в мышцах, сильное недомогание (плохое самочувствие). Большинство людей выздоравливает в течение недели без какой-либо медицинской помощи. Но грипп может приводить к развитию тяжелой болезни или смерти у людей из групп повышенного риска. Период между инфицированием и заболеванием, известный как инкубационный период, длится около двух дней.

Кто подвергается риску

Ежегодные случаи заболеваемости гриппом могут оказывать серьезное воздействие на все возрастные группы, но самый высокий риск развития осложнений угрожает детям в возрасте до двух лет, взрослым в возрасте 65 лет и старше и людям любого возраста с определенными заболеваниями, такими как хронические болезни сердца, легких, почек, крови и болезни обмена веществ (например, диабет), или с ослабленной иммунной системой.

Передача инфекции

Сезонный грипп передается воздушно-капельным путём и может быстро распространяться в школах, домах престарелых и инвалидов, на предприятиях и в городах. Вирус может также передаваться через загрязнённые руки. Для предотвращения передачи люди должны прикрывать рот и нос при кашле носовым платком и регулярно мыть руки.

При первых симптомах недомогания очень важно правильно среагировать и предотвратить развитие инфекции. Необходимо незамедлительно обратиться к врачу. Лечение гриппа – это комплекс процедур, позволяющих уничтожить вирус и восстановить нормальное функционирование организма с минимальными осложнениями. Но назначить его может только врач!

При гриппозном заражении следует придерживаться следующего алгоритма:

  • Постельный режим

    Болезнь нельзя переносить на ногах, поэтому в этот период необходимо соблюдать постельный режим и больше спать. Но не стоит забывать, что недуг – это не повод проводить время за просмотром телевизора или за компьютером.

  • Питьевой режим

    Во время болезни наблюдается повышенное потоотделение, которые может привести к обезвоживанию организма. Поэтому для поддержания водно-солевого баланса, необходимо употреблять достаточное количество жидкости (травяные чаи, соки, морсы, чистая вода).

  • Климат в квартире

    Необходимо регулярно проводить влажную уборку в комнате, так как влажный климат помогает легче переносить болезнь. Проветривание помещения позволит вывести скопленные микробы и вирусы. Кроме того, свежий воздух способствует выздоровлению и улучшает самочувствие.

  • Питание

    Несмотря на то, что в первые дни недуга аппетит существенно снижен, правильное питание обогатит организм и ослабленную иммунную систему витаминами и полезными веществами. Еда должна быть легкой, в рационе должны преобладать каши, супы, отварное мясо, фрукты и овощи.

  • Витамины

    Помогают поддерживать организм в тонусе и быстрее устранить симптоматику заболевания. Хорошим иммуномодулирующим действием обладают витаминные комплексы.

Кроме вышеописанных методов лечения, существует и медикаментозная терапия. Прием лекарственных препаратов должен быть осознанным и рекомендованным лечащим врачом. Самостоятельно принимать таблетки противопоказано. На сегодняшний день, дефицита в выборе лекарств, устраняющих вирусные и простудные болезни нет.

Грипп диктует следующие условия:

  • обратиться к медицинской помощи или вызвать врача;
  • не принимать антибиотики или сульфаниламиды – они на вирус гриппа не действуют;
  • по возможности изолировать больного в отдельном помещении или ограничить его контакты со здоровыми членами семьи, которым рекомендуется носить марлевые повязки;
  • выполнять рекомендации лечащего врача;
  • принимать препараты, предназначенные для профилактики гриппа.

Для того,чтобы свести к минимуму вероятность заболевания гриппом и возможность осложнения, а так же с целью профилактики, рекомендована прививка от гриппа до наступления эпидемии гриппа.

Помните! Заниматься самолечением опасно! При появлении первых симптомов гриппа необходимо незамедлительно обращаться к квалифицированной медицинской помощи.

КГБУЗ «ВКДЦ» Приморский краевой центр медицинской профилактики, врач Савельева Л.В.

Роспотребнадзор по РД заявил о росте заболеваемости гриппом и ОРВИ на 37%, эпидпорог не превышен

Рубрика: Новость

2021-12-2 13:41


По информации Управления Роспотребнадзора по РД, за период с 22 по 28 ноября 2021 г. на территории Дагестана заболеваемость острыми респираторными вирусными инфекциями (ОРВИ) в целом оставалась на неэпидемическом уровне. Превышение недельных эпидемических порогов по совокупному населению не отмечено во всех административных территориях республики.

По сравнению с предыдущей неделей заболеваемость гриппом и ОРВИ в республике выросла на 37%, что обусловлено ростом заболеваемости в возрастной группе 7-14 лет на 45%, однако эпидпорог заболеваемости в данной возрастной группе не превышен.  

роспотребнадзором по РД осуществляется ежедневный мониторинг за посещаемостью детей в школах, детских дошкольных организациях, в ВУЗах и колледжах.

В соответствии с СанПиН 3.3686-21 «Санитарно-эпидемиологические требования по профилактике инфекционных болезней» в случае отсутствия в образовательной организации по причине гриппа и ОРИ 20% и более детей принимается  решения о приостановлении учебного процесса в организациях, осуществляющих образовательную деятельность.

С начала эпидсезона гриппа и ОРВИ Управлением Роспотребнадзора по РД, в связи с ростом  заболевания ОРВИ и гриппом среди учащихся школ и детских садов,  вынесены 45  Постановлений о введении ограничительных мероприятий (карантина) по гриппу (42 школы и 3 детских сада).

В целях установления возбудителя гриппа и ОРВИ за прошедшую неделю обследовано 304 человек, проведено 1062 исследований. По результатам обследования выделен вирус гриппа А (h4N2) – 1 сл., выделены  вирусы не гриппозной этиологии (риновирусы – 8 сл., парагрипп – 3 сл., аденовирусы – 3 сл., респираторно-синцитиальный вирус – 1 сл.).  

За текущий период эпидемического сезона в Республике Дагестан зарегистрировано 3 лабораторно подтвержденных случая гриппа А (h4N2) среди не привитых против гриппа.

Размещено: 2021-12-02 13:45:17 Изменено: 2021-12-27 13:00:55

Количество просмотров: 2231 Cегодня: 1

Информация и инфографика

ПАМЯТКА ДЛЯ НАСЕЛЕНИЯ

ПРОФИЛАКТИКА ГРИППА И ОРВИ

 

Что такое грипп?

Грипп — это тяжелая вирусная инфекция, которая поражает мужчин, женщин и детей всех возрастов и национальностей. Эпидемии гриппа случаются каждый год обычно в холодное время года. По количеству случаев в мире грипп и ОРВИ занимают первое место, удельный вес в структуре инфекционных заболеваний достигает 95%. 

Грипп и ОРВИ, постепенно подрывая здоровье, сокращают на несколько лет среднюю продолжительность жизни человека. При тяжелом течении гриппа часто возникают необратимые поражения сердечно-сосудистой системы, дыхательных органов, центральной нервной системы, провоцирующие заболевания сердца и сосудов, пневмонии, трахеобронхиты, менингоэнцефалиты. Распространенными осложнениями после гриппа являются риниты, синуситы, бронхиты, отиты, обострение хронических заболеваний, бактериальная суперинфекция. В ослабленный гриппом организм часто внедряется бактериальная инфекция (пневмококковая, гемофильная, стафилококковая). Наибольшие жертвы грипп собирает среди пожилых групп населения, страдающих хроническими болезнями. Смерть при гриппе может наступить от интоксикации, кровоизлияний в головной мозг, легочных осложнений (пневмония), сердечной или сердечно-легочной недостаточности.

Что такое ОРВИ? В чём отличие от гриппа?

Термин «острое респираторное заболевание» (ОРЗ) или «острая респираторная вирусная инфекция» (ОРВИ) охватывает большое количество заболеваний, во многом похожих друг на друга. Основное их сходство состоит в том, что все они вызываются вирусами, проникающими в организм вместе с вдыхаемым воздухом через рот и носоглотку, а также в том, что все они характеризуются одним и тем же набором симптомов. У больного несколько дней отмечается повышенная температура тела, воспаление в горле, кашель и головная боль. Самым распространенным симптомом респираторных заболеваний является насморк; он вызывается целым рядом родственных вирусов, известных как риновирусы. При выздоровлении, все эти симптомы исчезают и не оставляют после себя никаких следов.

Вирус гриппа очень легко передается. Самый распространенный путь передачи инфекции — воздушно-капельный. Также возможен и бытовой путь передачи, например через предметы обихода. При кашле, чихании, разговоре из носоглотки больного или вирусоносителя выбрасываются частицы слюны, слизи, мокроты с болезнетворной микрофлорой, в том числе с вирусами гриппа. Вокруг больного образуется зараженная зона с максимальной концентрацией аэрозольных частиц. Дальность их рассеивания обычно не превышает 2 — 3 м.

Симптомы гриппа.

Обычно грипп начинается остро. Инкубационный (скрытый) период, как правило, длится 2 — 5 дней. Затем начинается период острых клинических проявлений. Тяжесть болезни зависит от общего состояния здоровья, возраста, от того, контактировал ли больной с данным типом вируса ранее. В зависимости от этого у больного может развиться одна из четырех форм гриппа: легкая, среднетяжелая, тяжелая, гипертоксическая.

Профилактика гриппа и ОРВИ подразделяется на неспецифическую и специфическую.

Способы неспецифической профилактики:


1.  Личная гигиена.


Иначе говоря, множество заболеваний связано с немытыми руками. Источник, как и прежде, больной человек. Избегать в этот период необходимо рукопожатий. После соприкосновений с ручками дверей, туалета, поручнями в общественных местах, обработать руки антисептиком или тщательно их вымыть. Не трогайте грязными, немытыми руками нос, глаза, рот.


2.  Промываем нос.

Даже если вы не умеете этого делать, пришла пора учиться. Сейчас многие доктора советуют увлажнять или промывать в период эпидемий нос. Это можно сделать при помощи солевого раствора (на литр воды 1 ч.ложка соли) или специальными соляными спреями, коих в аптеках множество.

3.Одеваем маски.

Причем одевать как раз стоит ее на больного человека, чтобы исключить попадание в пространство крупных частиц слюны при кашле и чихании, мелкие же частицы она не задерживает.

4.Тщательная уборка помещений. Вирус любит теплые и пыльные помещения, поэтому стоит уделить время влажной уборке и проветриванию.

5.Избегайте массовых скоплений людей. В этот период лучше воздержаться от походов в театры, цирки, кафе и прочие места, где могут оказаться инфицированные люди и где шанс подцепить вирус высок.

6. Другие методы, к которым можно отнести сбалансированное питание и здоровый образ жизни, занятие физкультурой, прогулки и многое другое.

Всемирная организация здравоохранения считает вакцинацию единственной социально и экономически оправданной мерой борьбы с гриппом. Вакцинация на 90 % снижает заболеваемость, на 60 % снижает госпитализацию.

Основным методом специфической профилактики против гриппа является активная иммунизация — вакцинация, когда в организм вводят частицу инфекционного агента. Вирусы (его части), содержащиеся в вакцине, стимулируют организм к выработке антител (они начинают вырабатываться в среднем через две недели), которые предотвращают размножение вирусов и инфицирование организма. 

Вакцинацию лучше проводить осенью, поскольку эпидемии гриппа, как правило, бывают между ноябрем и мартом.

  

 

Будьте здоровы!

Защита персональных данных

Политика в отношении обработки персональных данных в Государственном бюджетном учреждении здравоохранения «Городская поликлиника № 46 Департамента здравоохранения города Москвы»

Приложение к приказу ГБУЗ «ГП №46 ДЗМ» от 28.04.2017 г.   №251 —  (150 КБ / 153 218 байт)

Видеоролик о защите детских персональных данных

Рекомендации гражданам по профилактике гриппа и орви

Видеосюжеты по теме профилактики гриппа и ОРВИ

Что такое грипп и какова его опасность?

Грипп — это инфекционное заболевание, заболеть которым может любой человек. Возбудителем гриппа является вирус, который от инфицированных людей попадает в носоглотку окружающих.

Большинство людей болеют гриппом всего лишь несколько дней, но некоторые заболевают серьёзнее, возможно тяжёлое течение болезни, вплоть до смертельных исходов.

При гриппе обостряются имеющиеся хронические заболевания, кроме этого, грипп имеет обширный список возможных осложнений:

Лёгочные осложнения (пневмония, бронхит). Именно пневмония является причиной большинства смертельных исходов от гриппа.
Осложнения со стороны верхних дыхательных путей и ЛОР-органов (отит, синусит, ринит, трахеит).
Осложнения со стороны сердечно-сосудистой системы (миокардит, перикардит).
Осложнения со стороны нервной системы (менингит, менингоэнцефалит, энцефалит, невралгии, полирадикулоневриты).
Чтобы избежать возможных осложнений, важно своевременно проводить профилактику гриппа и правильно лечить само заболевание.

Обычно грипп начинается внезапно. Возбудители гриппа, вирусы типов А и В, отличаются агрессивностью и исключительно высокой скоростью размножения, поэтому за считанные часы после заражения вирус приводит к глубоким поражениям слизистой оболочки дыхательных путей, открывая возможности для проникновения в неё бактерий.

Среди симптомов гриппа — жар, температура 37,5–39 °С, головная боль, боль в мышцах, суставах, озноб, усталость, кашель, насморк или заложенный нос, боль и першение в горле.

Грипп можно перепутать с другими заболеваниями, поэтому чёткий диагноз должен поставить врач, он же назначает тактику лечения.

Что делать при заболевании гриппом?

Самому пациенту при первых симптомах нужно остаться дома, чтобы не только не заразить окружающих, но и вовремя заняться лечением, для чего необходимо немедленно обратиться к врачу. Для предупреждения дальнейшего распространения инфекции заболевшего нужно изолировать от здоровых лиц, желательно выделить отдельную комнату.

Важно!
Родители! Ни в коем случае не отправляйте заболевших детей в детский сад, школу, на культурно-массовые мероприятия. При гриппе крайне важно соблюдать постельный режим, так как при заболевании увеличивается нагрузка на сердечно-сосудистую, иммунную и другие системы организма.

Самолечение при гриппе недопустимо, и именно врач должен поставить диагноз и назначить необходимое лечение, соответствующее состоянию и возрасту пациента.

Для правильного лечения необходимо строго выполнять все рекомендации лечащего врача и своевременно принимать лекарства. Кроме этого, рекомендуется обильное питьё — это может быть горячий чай, клюквенный или брусничный морс, щелочные минеральные воды. Пить нужно чаще и как можно больше.

Важно!
При температуре 38 — 39°С вызовите участкового врача на дом либо бригаду «скорой помощи».
При кашле и чихании больной должен прикрывать рот и нос платком или салфеткой.
Помещение, где находится больной, необходимо регулярно проветривать и как можно чаще проводить там влажную уборку, желательно с применением дезинфицирующих средств, действующих на вирусы.

Общение с заболевшим гриппом следует ограничить, а при уходе за ним использовать медицинскую маску или марлевую повязку.

Как защитить себя от гриппа?

Согласно позиции Всемирной организации здравоохранения, наиболее эффективным средством против гриппа является вакцинация, ведь именно вакцина обеспечивает защиту от тех видов вируса гриппа, которые являются наиболее актуальными в данном эпидемиологическом сезоне и входят в её состав.

Введение в организм вакцины не может вызвать заболевание, но путём выработки защитных антител стимулирует иммунную систему для борьбы с инфекцией. Эффективность вакцины от гриппа несравнимо выше всех неспецифических медицинских препаратов, которые можно принимать в течение зимних месяцев, например иммуномодуляторов, витаминов, гомеопатических средств, средств «народной медицины» и так далее.

Вакцинация рекомендуется всем группам населения, но особенно показана детям начиная с 6 месяцев, людям, страдающим хроническими заболеваниями, беременным женщинам, а также лицам из групп профессионального риска — медицинским работникам, учителям, студентам, работникам сферы обслуживания и транспорта.
Вакцинация должна проводиться за 2–3 недели до начала роста заболеваемости, делать прививку можно только в медицинском учреждении специально обученным медицинским персоналом, при этом перед вакцинацией обязателен осмотр врача.

Противопоказаний к вакцинации от гриппа немного. Прививку против гриппа нельзя делать при острых лихорадочных состояниях, в период обострения хронических заболеваний, при повышенной чувствительности организма к яичному белку (если он входит в состав вакцины).

Сделав прививку от гриппа, вы защищаете свой организм от атаки наиболее опасных вирусов — вирусов гриппа, но остается ещё более 200 видов вирусов, которые менее опасны для человека, но также могут явиться причиной заболевания ОРВИ. Поэтому в период эпидемического подъёма заболеваемости ОРВИ и гриппом рекомендуется принимать меры неспецифической профилактики.

Правила профилактики гриппа:

Сделайте прививку против гриппа до начала эпидемического сезона.
Сократите время пребывания в местах массовых скоплений людей и общественном транспорте.
Пользуйтесь маской в местах скопления людей.
Избегайте тесных контактов с людьми, которые имеют признаки заболевания, например чихают или кашляют.
Регулярно тщательно мойте руки с мылом, особенно после улицы и общественного транспорта.
Промывайте полость носа, особенно после улицы и общественного транспорта
Регулярно проветривайте помещение, в котором находитесь.
Регулярно делайте влажную уборку в помещении, в котором находитесь.
Увлажняйте воздух в помещении, в котором находитесь.
Ешьте как можно больше продуктов, содержащих витамин С (клюква, брусника, лимон и др.).
Ешьте как можно больше блюд с добавлением чеснока и лука.
По рекомендации врача используйте препараты и средства, повышающие иммунитет.
В случае появления заболевших гриппом в семье или рабочем коллективе — начинайте приём противовирусных препаратов с профилактической целью (по согласованию с врачом с учётом противопоказаний и согласно инструкции по применению препарата).
Ведите здоровый образ жизни, высыпайтесь, сбалансированно питайтесь и регулярно занимайтесь физкультурой.

С более подробной информацией о том, как защитить себя и близких от заражения гриппом и ОРВИ можно ознакомиться в специальном разделе на сайте Роспотребнадзора.

Будьте здоровы!

Грипп: симптомы и профилактика

Соблюдение правил безопасности на воде


Департамент гражданской защиты Москвы предупреждает! Купание на водоемах столицы разрешено только в специально оборудованных местах! Не купайтесь там, где установлен знак «Купание запрещено!». Соблюдайте правила безопасности на воде!



Соблюдение правил пожарной безопасности в быту


Департамент гражданской защиты Москвы предупреждает! Будьте осторожны с огнем в быту! Соблюдайте правила пожарной безопасности! Установите пожарную сигнализацию и огнетушитель! Берегите свой дом от пожара!


Поделиться:

Заболеваемость гриппом и ОРВИ в Хабаровском крае удерживается на неэпидемическом уровне — Новости — События

Почти на тысячу человек сократилось за неделю количество заболевших гриппом и ОРВИ в Хабаровском крае. Так, к врачам с признаками простуды обратилось 11434 пациента, на прошлой неделе – 12863 человека. Показатель заболеваемости установился на отметке на 7,3% ниже эпидпорога.

— Можно сказать, что в крае наметилась положительная тенденция к сокращению заболеваемости. Превышение эпидпорога все еще отмечается в Комсомольске-на-Амуре, Комсомольском, имени Лазо, Амурском и Солнечном районах. Однако в каждой из территорий прироста заболевших уже нет, а идет сокращение. Надеемся, что это будет первым признаком стабилизации ситуации, — уточнили в краевом минздраве.

В Хабаровске неделей ранее превышение эпидпорога составляло 9%. Сейчас число заболевших в краевом центре выходит за рамки нормы всего на 0,8%. На карантин закрыты девять групп в детских садах и 72 школьных класса, полностью закрыто одно из отделений школы «Открытие».

С 10 февраля в городе, как и во всем крае, действует масочный режим. В учреждениях образования повсеместно усилили утренние фильтры. Меры принимают не только из-за ОРВИ и гриппа, но и в целях профилактики новой коронавирусной инфекции, распространяющейся по миру из Китая. Пока случаев заражения этим заболеванием на территории региона не выявлено.

— Все больницы, поликлиники продолжают находиться в режиме повышенной готовности. В аэропортах и на вокзалах действует усиленный контроль за пассажирами. Лиц, вызывающих опасения, санитарные врачи помещают на карантин. Жителям края мы рекомендуем соблюдать меры личной гигиены, — подчеркнули в министерстве.

Врачи советуют на время обострения ситуации с коронавирусом отказаться от полетов за границу и сократить посещение мест с большим скоплением людей. Необходимо регулярно в течение дня мыть руки, обрабатывать мобильные телефоны и пользоваться защитными масками. При первых признаках простуды нужно немедленно обращаться к врачу, а при сильном недомогании – вызывать скорую помощь.

Пресс-служба губернатора и правительства Хабаровского края
При использовании материалов ссылка на сайт www.khabkrai.ru обязательна

Коинфекция SARS-CoV-2 и вируса гриппа среди пациентов с тяжелой острой респираторной инфекцией во время первой волны пандемии COVID-19 в Бангладеш: описательное исследование на базе больницы

Цель: Оценить долю коинфекции SARS-CoV-2 и вируса гриппа среди больных тяжелой острой респираторной инфекцией (ТОРИ) во время первой волны пандемии COVID-19 в Бангладеш.

Дизайн: Описательное исследование.

Параметр: Девять больниц третичного уровня в Бангладеш.

Участники: Пациенты, госпитализированные в качестве ТОРИ (определяемые как случаи с субъективной или измеренной лихорадкой ≥38 C° и кашлем, начавшимся в течение последних 10 дней и требующие госпитализации), случайные пациенты.

Первичные и вторичные результаты: Доля коинфекции SARS-CoV-2 и вируса гриппа и доля смертности среди пациентов с ТОРИ.

Результаты: Мы зарегистрировали 1986 пациентов с ТОРИ со средним возрастом: 28 лет (межквартильный интервал: 1,2–53 года) и 67 лет.6% были мужчинами. Среди них 285 (14,3%) были инфицированы SARS-CoV-2; 175 (8,8%) были инфицированы вирусом гриппа, а 5 (0,3%) были коинфицированы обоими вирусами. Во время обычного пикового сезона (с мая по июль) в Бангладеш грипп не появлялся. Инфекция SARS-CoV-2 была значительно больше связана с диабетом (14,0% против 5,9%, p<0,001) и артериальной гипертензией (26,7% против 11,5%, p<0,001). Но грипп среди больных ТОРИ был значительно меньше связан с диабетом (4.0% против 7,4%, р=0,047) и артериальная гипертензия (5,7% против 14,4%, р=0,001). Доля внутрибольничных смертей среди пациентов с ТОРИ, инфицированных SARS-CoV-2, была выше (10,9% (n=31) против 4,4% (n=75), p<0,001), чем среди пациентов без инфекции SARS-CoV-2. ; доля смертей после выписки в течение 30 дней также была выше (9,1% (n=25) против 4,6% (n=74), p=0,001) среди больных ТОРИ, инфицированных SARS-CoV-2, по сравнению с пациентами без инфекции. Среди пяти пациентов с коинфекцией ТОРИ не было зарегистрировано ни внутрибольничной, ни послевыписной летальности.

Выводы: Наши результаты показывают, что коинфекция SARS-CoV-2 и вирусом гриппа была не очень распространена и имела меньшую тяжесть заболевания с учетом смертности в Бангладеш. Во время пикового сезона гриппа во время пандемии COVID-19 в 2020 году циркулирующего вируса гриппа не было. Необходимы дальнейшие исследования для дальнейшего изучения.

Ключевые слова: COVID-19; эпидемиология; инфекционные заболевания.

Взаимодействия между SARS-CoV-2 и гриппом и влияние коинфекции на тяжесть заболевания: отрицательный тест | Международный журнал эпидемиологии

948″> Фон

Вполне вероятно, что как SARS-CoV-2, так и сезонные респираторные патогены, в первую очередь грипп, будут совместно циркулировать по мере приближения зимы 2020/2021 в северном полушарии.Потенциальное влияние COVID-19 наряду с гриппом на заболеваемость, смертность и возможности служб здравоохранения вызывает серьезную озабоченность, хотя в настоящее время мало что известно о взаимодействии между этими двумя респираторными вирусами. 1 , 2

Имеются данные о патогенной конкуренции между респираторными вирусами, в том числе между гриппом и сезонными коронавирусами. 3 , 4 Это может происходить из-за иммунно-опосредованного вмешательства, приводящего к ослаблению некоторых вирусов во время пика активности другого вируса — явление, известное уже много десятилетий. 3 , 5 , 6 На сегодняшний день имеются некоторые свидетельства эктопического взаимодействия между белком SARS-CoV-2 и белками хозяина, 7 , хотя информации о патогенном взаимодействии между ними нет. SARS-CoV-2 и грипп, и эпидемиологическое влияние такого взаимодействия неизвестно.

Ключевые сообщения

Если люди одновременно инфицированы SARS-CoV-2 и гриппом, это может привести к более тяжелым исходам болезни.С начала пандемии SARS-CoV-2 2020 г. был опубликован ряд сообщений о случаях коинфекции SARS-CoV-2 и гриппа с тяжелыми исходами. 1 , 8–12 Тем не менее, в отчетах о клинических случаях часто выделяются более тяжелые случаи, и не проводилось систематического анализа исходов заболевания у пациентов с коинфекцией по сравнению с контрольной группой без коинфекции.

  • Потенциальное влияние COVID-19 наряду с гриппом на заболеваемость, смертность и возможности медицинских служб вызывает серьезную озабоченность, и мало что известно о взаимодействии между этими двумя респираторными вирусами.

  • Мы оценили взаимодействие между гриппом и SARS-CoV-2 в Англии. Мы обнаружили, что SARS-CoV-2 был на 58% ниже среди случаев гриппа. У пациентов с коинфекцией риск смерти был на 5,92 (95% доверительный интервал: 3,21–10,91) выше, чем у пациентов, не страдающих ни гриппом, ни SARS-CoV-2.

  • По мере приближения сезона гриппа 2020–2021 гг. в северном полушарии стратегии тестирования должны включать тестирование как на грипп, так и на SARS-CoV-2, а также максимальное использование вакцинации против гриппа, особенно в группах повышенного риска обоих заболеваний.

В Великобритании сезон гриппа 2019–2020 гг. достиг своего пика рано, при этом активность значительно снизилась по сравнению с январем 2020 г. 13 В этом сезоне активность была ниже, а преобладающим штаммом был грипп A(h4N2). 13 Первое заражение SARS-CoV-2 произошло в конце января 2020 г. в результате завозного случая, и распространение SARS-CoV-2 выросло с устойчивой передачей среди населения с начала марта в Великобритании, достигнув пика 7 апреля 2020 г., когда было зарегистрировано 4493 случая. а 21 апреля общее число ежедневных смертей от SARS-CoV-2 достигло пика в 1172 человека. 14 Таким образом, между циркуляцией вируса гриппа и циркуляцией SARS-CoV-2 наблюдался лишь ограниченный период времени. В этом исследовании мы изучаем взаимодействие между гриппом и SARS-CoV-2 на последних этапах сезона гриппа 2019–2020 гг. в Англии.

Исследование преследует две цели: во-первых, оценить, связана ли инфекция гриппа со сниженным риском заражения SARS-CoV-2, и, во-вторых, оценить, связана ли коинфекция гриппом с более тяжелым течением ТОРС. Исходы -CoV-2, такие как смерть, госпитализация, госпитализация в отделение интенсивной терапии (ОИТ) или необходимость искусственной вентиляции легких.

955″> Источники данных и связь данных

SGSS (Система эпиднадзора второго поколения) и Respiratory DataMart System (RDMS) использовались для выявления всех случаев заболевания гриппом в период с 01 января 2020 г. по 2 июня 2020 г. 15 , гриппа делается почти исключительно с помощью ПЦР. Для анализа данные были ограничены периодом времени с 20 января 2020 г. по 25 апреля 2020 г., когда произошла первая коинфекция SARS-CoV-2 и гриппом и последний образец гриппа был зарегистрирован в RDMS.Также были извлечены лица, протестированные на грипп, у которых был отрицательный результат в RDMS. Обе группы были сопоставлены с результатами теста на SARS-CoV-2 (положительные и отрицательные) в SGSS по состоянию на 2 июня 2020 года. Случаи были сопоставлены с использованием действительного номера пациента NHS (Национальной службы здравоохранения) (уникальный идентификатор пациента в Англии; полный в 91,5% случаев). результатов теста) и, если это не так, дату рождения пациента, имя и фамилию (заполните для 95,1% случаев, когда номер NHS не был доступен). В исследование были включены все лица, у которых в течение 7 дней были отобраны образцы для теста на SARS-CoV-2 и грипп.Коинфекция была определена как положительный результат теста как на грипп, так и на SARS-CoV-2 в течение 7 дней после даты взятия образцов друг у друга.

Все люди, прошедшие тестирование на грипп и SARS-CoV-2 (положительные и отрицательные результаты), были связаны с демографической пакетной службой (DBS) — национальной базой данных, координируемой NHS digital, которая позволяет отслеживать информацию по личным демографическим данным — и дату смерти было извлечено. 17 Кроме того, лица с положительным результатом теста на SARS-CoV-2 были сопоставлены с набором данных о смертности от COVID-19 Public Health England, который ежедневно обновлялся на протяжении всей пандемии.Были включены случаи смерти от 6 дней до 28 дней после результата теста.

Результаты испытаний также были связаны с набором данных Службы вторичного использования (SUS) и набором данных Статистики эпизодов госпитализации (HES), которые содержат информацию о всех поступивших пациентах, амбулаторных и неотложных службах в больницах NHS. в Англии. 18 , 19 Эти наборы данных использовались для выявления пациентов в отделении интенсивной терапии, которым потребовалось использование аппарата ИВЛ в течение 14 дней до и 28 дней после самой ранней даты тестирования. 20 Наборы данных SUS и HES также использовались для извлечения информации об этнической принадлежности и сопутствующих заболеваниях. Сопутствующие заболевания были выявлены с использованием кодов Международной классификации болезней 10 -го пересмотра (МКБ-10) и сгруппированы в следующие категории: аспления или дисфункция селезенки, бронхиальная астма, хронические заболевания сердца, хронические заболевания почек, хронические заболевания печени, хронические неврологические расстройства, хронические респираторные заболевания (за исключением астмы), деменция, включая болезнь Альцгеймера, диабет, злокачественные новообразования, поражающие иммунную систему, ожирение, другие новообразования, ревматологические заболевания, трансплантации и состояния, влияющие на иммунную систему.Для связи с сопутствующими заболеваниями данные были ограничены стационарными и амбулаторными эпизодами госпитализации за последние 5 лет.

960″> Влияние инфекции гриппа на риск заражения SARS-CoV-2

Оценено общее количество положительных и отрицательных результатов тестов на SARS-CoV-2 и грипп с 1 по 17 недели в 2020 году. Процент положительных результатов был рассчитан для лиц с коинфекцией SARS-CoV-2 и гриппа, а также для лиц, не инфицированных гриппом, путем деления числа лиц с положительными результатами на SARS-CoV-2 на общее число протестированных лиц и умножения на 100.Кроме того, общее количество людей с коинфекцией SARS-CoV-2 и гриппом оценивали по типу гриппа.

Для оценки влияния недавнего заражения гриппом на риск заражения SARS-CoV-2 использовался отрицательный тест. Однофакторный и многофакторный анализ шансов на SARS-CoV-2 у тех, у кого был положительный результат на грипп, по сравнению с теми, у кого был отрицательный результат на грипп, был проведен с поправкой на возраст, пол, этническую принадлежность, регион, сопутствующие заболевания и неделю выборки.Модель была повторно запущена для людей, у которых в один и тот же день были взяты образцы на грипп и SARS-CoV-2. Наконец, чтобы определить влияние неизмеряемых смешанных факторов, таких как профессия, анализ был стратифицирован по возрасту на детей (<19 лет), взрослых трудоспособного возраста (19–65 лет) и пожилых людей (старше 65 лет).

966″> Результаты

Всего в период с 20 января 2020 г. по 25 апреля 2020 г., когда в RDMS был обнаружен последний положительный результат теста на грипп, было протестировано 19 256 человек как на грипп, так и на SARS-CoV-2. Из этих лиц у 16 764 (87,1%) были взяты образцы как на грипп, так и на SARS-CoV-2 в один и тот же день, а у остальных 2492 (12,9%) образцы были взяты в течение 7 дней друг от друга. В общей сложности 58 человек имели коинфекцию SARS-CoV-2 и грипп, 992 имели положительный результат на грипп и были отрицательными на SARS-CoV-2, 4443 имели положительный результат на SARS-CoV-2 и были отрицательными на грипп, и остальные 13 763 дали отрицательный результат как на SARS-CoV-2, так и на грипп в течение этого периода (рис. 1).Из 58 пациентов с коинфекцией SARS-CoV-2 и гриппа 32 (55,2%) случая были в возрасте ≥70  лет. Из 58 случаев коинфекции SARS-CoV-2 и гриппа у 31 человека был грипп A (без субтипа), у 8 — грипп A(h2N1), у 16 ​​— грипп B, у 1 — грипп A и B и у 2 — грипп неизвестного типа. Всех обследовали на грипп методом ПЦР. На 12-й неделе было зарегистрировано наибольшее количество коинфекций SARS-CoV-2 и гриппа (20 человек, таблица 1).

Рисунок 1

Распределение случаев SARS-CoV-2, гриппа и коинфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г. (недели 1–17)

Рисунок 1

Распространение SARS-CoV-2, гриппа и случаев коинфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г. (недели 1–17)

Таблица 1

положительных результатов на SARS-CoV-2 среди случаев гриппа и отрицательных результатов тестов на грипп по неделям выборки в Англии с 20 января 2020 г. по 25 апреля 2020 г.

9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8
9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 111 562 562 19.8 9.8
Таблица 1

SARS-COV-2 Positivivity Среди случаев гриппа и гриппа-отрицательные негативы по заказу недели в Англии с 20 января 2020 по 25 апреля 2020 г.

9 9 88
неделе . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8
9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8

При наблюдении описательных характеристик по четырем результатам теста 31,0% коинфицированных были в возрасте ≥80 лет, что было аналогично положительному тесту на SAV-CoV-2. и отрицательный на грипп (29.8%), но больше, чем у тех, кто дал отрицательный результат на оба (15,4%) или у тех, у кого был положительный результат на грипп, но отрицательный на SARS-CoV-2 (11,9%) (дополнительная таблица S1, доступная в качестве дополнительных данных на IJE онлайн). Было аналогичное распределение мужчин и женщин для всех групп, и доминирующей этнической принадлежностью были белые для всех категорий результатов теста, за которыми следовали азиатские / азиатские британцы, за исключением тех, у кого была коинфекция, для которых второй наиболее распространенной этнической принадлежностью были черные / черные британцы. (Дополнительная таблица S1, доступная в качестве дополнительных данных по адресу IJE онлайн).

В общей сложности 13 451 (69,9%) человек были связаны с записью о госпитализации в SUS в период с 1 декабря 2020 г. по 24 августа 2020 г., из которых 12 253 человека имели связанную запись в течение 14 дней до и ≤28 дней после самой ранней Дата теста на SARS-CoV-2 или грипп. Из 12 253 человек в общей сложности 1666 (13,6%) человек были госпитализированы в отделение интенсивной терапии, а 890 (7,3%) были на ИВЛ (дополнительный рисунок S1, доступный в качестве дополнительных данных на IJE онлайн). Из 19 256 особей 2469 (12.умерли 8%), из которых 25/58 (43,1%) пациентов с коинфекцией SARS-CoV-2 и гриппом умерли.

Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ . 50176 58 58 58 Phangeenza Статус отрицательный Базовый уровень Базовый уровень Базовый уровень Pложительный 0.18 (0.14-0.24) 0.42 (0.31-0.56) до 19 лет до 19 лет 5 Phangeenza Статус Отрицательный Базовый уровень Baseline 40185 (0.22-1.38) 1.07 (0.38-3.01) Рабочий эз 17 Статус гриппа Отрицательный Базовый уровень Базовый уровень Базовый уровень 4 0.12 (0.07-0.20) 0.26 (0.15-0.45) Статус пожилых 36 грипп статус 9172 отрицательный базовый уровень базовый уровень 4 0,29 (0,20–0,41) 0,52 (0,35–0,75) 9172 отрицательный 9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
58 58 58 Phangeenza статус BASELELE BASELELE
4
0.18 (0.14-0.24) 0.42 (0.31-0.56)
До 19 лет 5 Статус гриппа Отрицательный Исходный уровень Исходный уровень
7 Положительный 90.55 (0.22-1.38) 1.07 (0.38-3.01)
Рабочий век 17 грипп статус Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Пожилые люди 36 Phangeenza Статус 4 Базовый уровень Базовый уровень Базовый уровень
положительный 0.29 (0.20-0.41) 0.52 0.52 (0.35-0,75)
Таблица 2

Шансы SARS-COV-2 Инфекция статуса гриппа, стратифицированного по возрасту (Англия с 20 января 2020 по 25 апреля 2020 г.) a

9172 отрицательный 9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
58 58 58 Phangeenza статус BASELELE BASELELE
4
0.18 (0.14-0.24) 0.42 (0.31-0.56)
До 19 лет 5 Статус гриппа Отрицательный Исходный уровень Исходный уровень
7 Положительный 90.55 (0.22-1.38) 1.07 (0.38-3.01)
Рабочий век 17 грипп статус Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Пожилые люди 36 Phangeenza Статус 4 Базовый уровень Базовый уровень Базовый уровень
положительный 0.29 (0,20–0,41) 0,52 (0,35–0,75)
9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
50176 58 58 58 Phangeenza Статус отрицательный Базовый уровень Базовый уровень Базовый уровень
Pложительный 0.18 (0.14-0.24) 0.42 (0.31-0.56)
до 19 лет до 19 лет 5 Phangeenza Статус Отрицательный Базовый уровень Baseline
40185
(0.22-1.38) 1.07 (0.38-3.01)
Рабочий эз 17 Статус гриппа Отрицательный Базовый уровень Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Статус пожилых 36 грипп статус базовый уровень базовый уровень
4 0,29 (0,20–0,41) 0,52 (0,35–0,75)

Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
. Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
. Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . <5 0 0 0 — — 37 0 2 0.0 5 5.4 5-9 2 0 9 0 0.0 0.0 7 0 0 0.0 0.0 10-19 3 0 0 0.0 0.0 39 1 4 4 3 12.1 20-29 1 0 0 0.0 0.0 0.0 162 4 10 2 6.2 9 7 1 9 2 14.3 28.6 295 5 33 1.7 11.2 11.2 40-49 2 0 0 0 0.0 0.0 426 21 80207 21 4.9 18.8 18.8 50-59 5 9 9 158 158 12.3 24,0 60-69 60-69 6 3 1 50.0 16.7 670 155 160207 23.1 23.1 23.9 70-79 14 14 8 1 57.1 7.1 7.1 824 307 117 39.99 14.2 9020+ 9 12 0 66.7 0.0 1331 619 15 46.5 1,1 Всего 58 25 7 7 43.1 12.1 4443 4443 1193 581 26.9  13,1  9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0.0 0.0 0.0 7 0 0 0.0
10-19 3 0 0 0.0 0.0 33 1 4 3.0 3 12.1
20-29 1 0 0 0 0.0 0.0 162 4 10 2,5 6.2
30-39 7 1 2 14.3 28.6 295 5 3 9 33 1.7 11.2
40-49 2 2 2 2 0 0 0.0 0.0 426 21 21 80207 49 18.8
50-59
50-59 5 1 3 20.0 60.0 60.0 658 81 158 12.3
60-69 6 3 1 9 1 50,0 16.7 670 155 160 23.1 23.1 23.9
70-79 14 8 8 1 57.1 7.1 824 307 117 37.3 14.2 14.2
80+ 18 12 9 9 0.0 1331 619 9 9 46.5 1,1
Всего 58 25 7 7 43,1 12.1 4443 4443 1193 581 581 26.9 13.1
Таблица 3

SARS-COV-2 и МОЩЕННЫЙ МОИЗНЕНИЕ МОИЗНЕНИЯ И СМЕРТЬ CoV-2 без летальных исходов и смертности от гриппа (%) по возрастным группам в Англии с 20 января 2020 г. по 25 апреля 2020 г.

9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0 0 0,0 0,0 7 0 0 0.0 0 0.0
10-19 3 0 0 0.0 0.0 33 1 4 3 9 3.0 12.1
20-29 1 0 0 0.0 0.0 162 4 10207 4 10 29 6.2 6.2
30-39 7 1 2 14.3 28.6 28.6 295 5 9 85
40-49 2 0 0 0.0 0.0 426 21 80 49 18.9 18.8
50-59 5 9 3 20,0 60,0 658 81 158 12.3 24.0
60-69 6 9 1 50.0 16.7 670 155 155 160 23.1 23.9
70-79 70-79 14 8 8 1 57.1 7.1 924 307 907 117 37.99 14.2
80+ 18 12 0 66.7 0.0 0.0 1331 619 15 1,1 58 9 7 43.1 12.1 4443 1193 581 26,9 13,1
9 9 9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0 0 0.0 0.0 7 0 0 0 0.0 0.0
10-19
10-19 3 0 0 0.0 0.0 0.0 33 1 4 3.0 12.1
1 0 0 0.0 0.0 162 4 10 2.5 2.5 6.2
30-39 7 1 2 9 2 14.39 9 28.6 295 5 5 33 1.7 11.2
40-49 2 0 0 0.0 426 21 80207 18.8
50-59 5 5 1 3 20.0 60.0 60.0 658 81 158 12.3 12.3 24.0
60185
60-69 6 3 1 50.0 16.7 670 670 155 160 23.9
70-79 14 8 1 57.1 7.1 924 307 117 37.099 14.2 14.2
80+ 18 12 0 12 0 66,7 0.0 1331 619 15 46.5 1.1 1.1
Всего 58 9 7 9 12.1 4443 1193 581 581 26.9 13.1

Метуварительный анализ , пол, этническая принадлежность, сопутствующие заболевания (0 или 1+) и статус коинфекции (грипп-отрицательный/SARS-CoV-2-отрицательный; грипп-отрицательный/SARS-CoV-2-положительный; грипп-положительный/SARS-CoV- 2-отрицательный; грипп-положительный/SARS-CoV-2-положительный) означало, что вероятность смерти равнялась 5.92 (95% ДИ: 3,21–10,91) раз выше среди лиц с коинфекцией SARS-CoV-2 и гриппа, чем среди лиц, не страдающих ни гриппом, ни SARS-CoV-2, и выше, чем среди лиц только с SARS-CoV-2, где вероятность смерти была в 2,61 (95% ДИ: 2,36–2,88) раза выше по сравнению с теми, у кого не было SARS-CoV-2 или гриппа. У пациентов с коинфекцией SARS-CoV-2 и гриппа вероятность смерти была примерно в два раза выше (ОШ 2,27, 95% ДИ: 1,23–4,19) по сравнению с пациентами, инфицированными только SARS-CoV-2. Для тех, у кого был только положительный результат на грипп, было несколько сниженный риск смертности (ОШ 0.64, 95% ДИ: 0,47–0,89) (рис. 2) по сравнению с лицами без инфекций. Чтобы формально проверить взаимодействие между гриппом и SARS-CoV-2, была подобрана та же модель, но с отдельными терминами для гриппа, SARS-CoV-2 и взаимодействия гриппа и SARS-CoV-2, что дало эффект взаимодействия (). P  ≤ 0,001) на дополнительные 3,60 шанса смерти (95% ДИ: 1,83–7,11) по сравнению с ожидаемым, если бы грипп и SARS-CoV-2 действовали независимо.

Рис. 2

Вероятность и 95% доверительные интервалы* смерти, использования ИВЛ и госпитализации в ОИТ по статусу гриппа/SARS-CoV-2 по сравнению с лицами без инфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г.

При сочетании использования ИВЛ или смерти в составную переменную, шансы равнялись 6.в 43 раза выше среди лиц с коинфекцией (95% ДИ: 3,61–11,47). Композитный показатель госпитализации или смерти в ОИТ имел в 6,33 раза больше среди лиц с коинфекцией (95% ДИ: 3,57–11,23) (рис. 2). Пациенты с коинфекцией SARS-CoV-2 и гриппом примерно в два раза чаще находились на ИВЛ при поступлении (ОШ 2,15, 95% ДИ: 1,20–3,84) или попадали в отделение интенсивной терапии (ОШ 2,08, 95% ДИ: 1,17). –3,70) по сравнению с теми, у кого был только SARS-CoV-2. Тест на взаимодействие как для композита вентилятора, так и для композита ICU дал эффект ( P  ≤ 0.001) с дополнительными шансами коинфекции на 3,38 (95% ДИ: 1,81–6,34) и 3,39 шансами коинфекции (95% ДИ: 1,83–6,29) соответственно по сравнению с ожидаемым, если бы грипп и SARS-CoV-2 действовали независимо.

995″> Дополнительные данные

Дополнительные данные доступны по адресу IJE онлайн.

999″> Финансирование

Работа выполнена при поддержке авторов из Public Health England в рамках рутинных функций эпиднадзора и контроля за инфекционными заболеваниями. Департамент общественного здравоохранения Англии, Национальная инфекционная служба, Отдел иммунизации и противодействия, предоставил производителям вакцин отчеты о пострегистрационном надзоре, которые держатели регистрационных удостоверений должны представлять в лицензирующий орган Великобритании в соответствии со своей Стратегией управления рисками.За эти отчеты взимается плата за возмещение затрат.

003″> Авторские вклады

J.L.B., E.T., J.S. и Н.А. разработали протокол исследования. Х.З., Р.Г., Дж.С., Э.Т. и Б.М.П. извлек данные, и J.S., И.Т., Дж.Л.Б. и Н.А. провели статистический анализ. В интерпретации данных участвовали следующие авторы: Е.Т., Дж.С., Н.А., Дж.Л.Б., М.Р., Б.М.П., ​​Р.Г., Х.З., М.З. и Э.Т. J.S., N.A., J.L.B., M.R., B.M.P. и Х.З. написал первый черновик статьи, и все авторы внесли свой вклад в последующие исправления и утвердили окончательную версию.

007″ data-legacy-id=»ref1″> Каталожные номера

1

Антоний

С

,

Альмаглут

N

,

Хайдеманн

Э.

Сопутствующие инфекции COVID-19 и гриппа являются низкими или заниженными? Обсервационное исследование, изучающее текущую опубликованную литературу, включая три новых неопубликованных случая

.

J Med Virol

2020

;

92

:

2489

97

.2

Лэнсбери

L

,

Лим

Б

,

Баскаран

В

,

Лим

WS.

Коинфекции у людей с COVID-19: систематический обзор и метаанализ

.

J Заразить

2020

;

81

:

266

75

.3

Никбахш

S

,

Майр

С

,

Мэтьюз

Л

и другие.

Взаимодействия между вирусами влияют на популяционную динамику гриппа и простуды

.

Proc Natl Acad Sci USA

2019

;

116

:

27142

50

.4

Кожух

BJ

,

Клык

ВЖ

,

Нисиура

Х

и другие.

Повышенный риск негриппозных респираторных вирусных инфекций, связанный с получением инактивированной противогриппозной вакцины

.

Clin Infect Dis

2012

;

54

:

1778

83

.5

Айзекс

А

,

Берк

округ Колумбия.

Вирусная интерференция и интерферон

.

Br Med Bull

1959

;

15

:

185

88

.6

Синджо

М

,

Омоэ

К

,

Сайто

N

,

Мацуо

Н

,

Нероме

К.

Профили роста респираторно-синцитиального вируса in vitro в присутствии вируса гриппа

.

Акта Вирол

2000

;

44

:

91

97

.7

Li

W

,

Ли

М

,

Оу

Г.

COVID-19, реснички и запах

.

Фев Дж

2020

;

287

:

3672

76

.8

Ву

X

,

Цай

Д

,

Хуан

X

и другие.

Коинфекция SARS-CoV-2 и вирусом гриппа А

.

Emerg Infect Dis

2020

;

26

:

1324

26

.9

Хашеми

SA

,

Сафаманеш

С

,

Гасемзаде-Могхаддам

H

,

Гафури

М

,

Амир

А.

Высокая распространенность коинфекции SARS-CoV-2 и вируса гриппа A (h2N1) среди умерших пациентов на северо-востоке Ирана

.

Дж Мед Вирол

2021

;

93

:

1008

05

.10

Хуанг

B-R

,

Лин

Y-L

,

Ван

C-K

и другие.

Коинфекция вирусом гриппа B и SARS-CoV-2: история болезни из Тайваня

.

J Microbiol Immunol Infect

2020

;S1684-182(20)30152-3.11

Юэ

Н

,

Чжан

М

,

Син

Л

и другие.

Эпидемиология и клинические характеристики коинфекции SARS-CoV-2 и вирусов гриппа у пациентов во время вспышки COVID-19

.

J Med Virol

2020

;

92

:

2870

73

.12

Хашеми

SA

,

Сафаманеш

С

,

Гафури

М

и другие.

Коинфекция COVID-19 и вируса гриппа А у двух умерших пациентов с острым респираторным синдромом, Бойнурд, Иран

.

Дж Мед Вирол

2020

;

92

:

2319

21

.13

Общественное здравоохранение Англии. Эпиднадзор за гриппом и другими респираторными вирусами в Великобритании, зима 2019–2020 гг. , Лондон: публикации PHE,

2020

.15

Zhao

H

,

Зеленый

Н

,

Лакенби

А

и другие.

Новая лабораторная система эпиднадзора (Respiratory DataMart System) за гриппом и другими респираторными вирусами в Англии: результаты и опыт с 2009 по 2012 год

. Евронаблюдение. 2014 23 января; 19:20680. doi: 10.2807/1560-7917.es2014.19.3.20680.21

Новак

MD

,

Сордильо

EM

,

Гитман

МР

,

Paniz Mondolfi

AE.

Коинфекция у пациентов, инфицированных SARS-CoV-2: где вирус гриппа и риновирус/энтеровирус?

Дж Мед Вирол

2020

;

92

:

1699

700

.22

Онестад

Г

,

Nordbø

SA.

Помехи между вспышками респираторных вирусов

.

Euro Surveill

2009

;

14

:

19359

.23

Пинки

L

,

Добровольный

ХМ.

Коинфекции SARS-CoV-2: могут ли грипп и простуда быть полезными

?

Дж Мед Вирол

2020

;

92

:

2623

28

.24

Ли

Q

,

Тан

Б

,

Брагацци

NL

,

Сяо

Y

,

Ву

Дж.

Моделирование воздействия массовой вакцинации против гриппа и мероприятий общественного здравоохранения на эпидемии COVID-19 с ограниченными возможностями обнаружения

.

Math Biosci

2020

;

325

:

108378

.25

Греч

В

,

Борг

М.

Вакцинация против гриппа в эпоху COVID-19

.

Ранний Хум Дев

2020

;

148

:

105116

.26

Финк

Г

,

Орлова-Финк

N

,

Шиндлер

Т

и другие.

Инактивированная трехвалентная вакцина против гриппа связана с более низкой смертностью среди пациентов с Covid-19 в Бразилии

.

BMJ Evid на базе Med

2020

;

111549

.27

Привор-Думм

ЛАП

,

Григорий

А

,

Баррат

Дж

и другие.

Глобальная программа иммунизации пожилых людей в эпоху COVID-19: план действий

.

Вакцина

2020

;S0264-410X(20)30885-9. doi:10.1016/j.vaccine.2020.06.082.28

Ma

S

,

Лай

X

,

Чен

Z

,

Ту

С

,

Цинь

К.

Клинические характеристики пациентов в критическом состоянии с коинфекцией SARS-CoV-2 и вирусом гриппа в Ухане, Китай

.

Int J Infect Dis

2020

;

96

:

683

87

.29

Кондо

Y

,

Миядзаки

С

,

Ямашита

Р

,

Икеда

Т.

Коинфекция SARS-CoV-2 и вирусом гриппа А

.

BMJ Case Rep

2020

;

13

:

e236812

.30

Конала

ВМ

,

Адапа

С

,

Нарамала

С

и другие.

Серия случаев пациентов с коинфекцией гриппом и COVID-19

.

J Investig Med High Impact Case Rep

2020

;

8

:

23247096204

.31

Перейти к

H

,

Ихира

Х

,

Морисита

К

и другие.

Усиленный рост вируса гриппа А при коинфекции вирусом парагриппа человека типа 2

.

Мед Микробиол Иммунол

2016

;

205

:

209

18

.32

Чжан

AJ

,

Ли

АС

,

Чан

ДЖФ

и другие.

Коинфекция коронавирусом тяжелого острого респираторного синдрома 2 и вирусом гриппа A(h2N1)pdm09 усиливает тяжесть пневмонии у золотистых сирийских хомяков

.

Clin Infect Dis

2020

20 ноября;

ciaa1747

. дои: 10.1093/cid/ciaa1747. Epub перед печатью. PMID: 33216851; PMCID: PMC7717201.33

Пебоди

R

,

Дженнад

А

,

Эллис

Дж

и другие.

Эффективность вакцины против гриппа в конце сезона у взрослых и детей в Соединенном Королевстве в 2017/18

.

2019

;

24

:

1800488

.34

Ли

N

,

Чан

ПК

,

Ю

ИТ

и другие.

Совместная циркуляция метапневмовируса человека и связанного с атипичной пневмонией коронавируса во время крупной внутрибольничной вспышки атипичной пневмонии в Гонконге

.

Дж Клин Вирол

2007

;

40

:

333

37

.35

Олдридж

R

,

Льюэр

Д

,

Катикиредди

С

и другие.

Черные, азиатские и этнические меньшинства в Англии подвергаются повышенному риску смерти от COVID-19: непрямая стандартизация данных о смертности NHS

.

Wellcome Open Res

2020

;

5

:

88

.37

Аткинс

JL

,

Масоли

JA

,

Дельгадо

Дж

, и другие. Ранее существовавшие сопутствующие заболевания, предсказывающие тяжелую форму COVID-19 у пожилых людей в когорте сообщества британского биобанка.

2020

: 2020.05.06.200.

Примечания автора

© Автор(ы) 2021.Опубликовано Oxford University Press от имени Международной эпидемиологической ассоциации.

Это статья в открытом доступе, распространяемая в соответствии с лицензией Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа цитируется правильно.

Взаимодействия между SARS-CoV-2 и гриппом и влияние коинфекции на тяжесть заболевания: отрицательный тест | Международный журнал эпидемиологии

948″> Фон

Вполне вероятно, что как SARS-CoV-2, так и сезонные респираторные патогены, в первую очередь грипп, будут совместно циркулировать по мере приближения зимы 2020/2021 в северном полушарии.Потенциальное влияние COVID-19 наряду с гриппом на заболеваемость, смертность и возможности служб здравоохранения вызывает серьезную озабоченность, хотя в настоящее время мало что известно о взаимодействии между этими двумя респираторными вирусами. 1 , 2

Имеются данные о патогенной конкуренции между респираторными вирусами, в том числе между гриппом и сезонными коронавирусами. 3 , 4 Это может происходить из-за иммунно-опосредованного вмешательства, приводящего к ослаблению некоторых вирусов во время пика активности другого вируса — явление, известное уже много десятилетий. 3 , 5 , 6 На сегодняшний день имеются некоторые свидетельства эктопического взаимодействия между белком SARS-CoV-2 и белками хозяина, 7 , хотя информации о патогенном взаимодействии между ними нет. SARS-CoV-2 и грипп, и эпидемиологическое влияние такого взаимодействия неизвестно.

Ключевые сообщения

Если люди одновременно инфицированы SARS-CoV-2 и гриппом, это может привести к более тяжелым исходам заболевания.С начала пандемии SARS-CoV-2 2020 г. был опубликован ряд сообщений о случаях коинфекции SARS-CoV-2 и гриппа с тяжелыми исходами. 1 , 8–12 Тем не менее, в отчетах о клинических случаях часто выделяются более тяжелые случаи, и не проводилось систематического анализа исходов заболевания у пациентов с коинфекцией по сравнению с контрольной группой без коинфекции.

  • Потенциальное влияние COVID-19 наряду с гриппом на заболеваемость, смертность и возможности медицинских служб вызывает серьезную озабоченность, и мало что известно о взаимодействии между этими двумя респираторными вирусами.

  • Мы оценили взаимодействие между гриппом и SARS-CoV-2 в Англии. Мы обнаружили, что SARS-CoV-2 был на 58% ниже среди случаев гриппа. У пациентов с коинфекцией риск смерти был на 5,92 (95% доверительный интервал: 3,21–10,91) выше, чем у пациентов, не страдающих ни гриппом, ни SARS-CoV-2.

  • По мере приближения сезона гриппа 2020–2021 гг. в северном полушарии стратегии тестирования должны включать тестирование как на грипп, так и на SARS-CoV-2, а также максимальное использование вакцинации против гриппа, особенно в группах повышенного риска обоих заболеваний.

В Великобритании сезон гриппа 2019–2020 гг. достиг своего пика рано, при этом активность значительно снизилась по сравнению с январем 2020 г. 13 В этом сезоне активность была ниже, а преобладающим штаммом был грипп A(h4N2). 13 Первое заражение SARS-CoV-2 произошло в конце января 2020 г. в результате завозного случая, и распространение SARS-CoV-2 выросло с устойчивой передачей среди населения с начала марта в Великобритании, достигнув пика 7 апреля 2020 г., когда было зарегистрировано 4493 случая. а 21 апреля общее число ежедневных смертей от SARS-CoV-2 достигло пика в 1172 человека. 14 Таким образом, между циркуляцией вируса гриппа и циркуляцией SARS-CoV-2 наблюдался лишь ограниченный период времени. В этом исследовании мы изучаем взаимодействие между гриппом и SARS-CoV-2 на последних этапах сезона гриппа 2019–2020 гг. в Англии.

Исследование преследует две цели: во-первых, оценить, связана ли инфекция гриппа со сниженным риском заражения SARS-CoV-2, и, во-вторых, оценить, связана ли коинфекция гриппом с более тяжелым течением ТОРС. Исходы -CoV-2, такие как смерть, госпитализация, госпитализация в отделение интенсивной терапии (ОИТ) или необходимость искусственной вентиляции легких.

955″> Источники данных и связь данных

SGSS (Система эпиднадзора второго поколения) и Respiratory DataMart System (RDMS) использовались для выявления всех случаев заболевания гриппом в период с 01 января 2020 г. по 2 июня 2020 г. 15 , гриппа делается почти исключительно с помощью ПЦР. Для анализа данные были ограничены периодом времени с 20 января 2020 г. по 25 апреля 2020 г., когда произошла первая коинфекция SARS-CoV-2 и гриппом и последний образец гриппа был зарегистрирован в RDMS.Также были извлечены лица, протестированные на грипп, у которых был отрицательный результат в RDMS. Обе группы были сопоставлены с результатами теста на SARS-CoV-2 (положительными и отрицательными) в SGSS по состоянию на 2 июня 2020 года. Случаи были сопоставлены с использованием действительного номера пациента NHS (Национальная служба здравоохранения) (уникальный идентификатор пациента в Англии; полный в 91,5% случаев). результатов теста) и, если это не так, дату рождения пациента, имя и фамилию (заполните для 95,1% случаев, когда номер NHS не был доступен). В исследование были включены все лица, у которых в течение 7 дней были отобраны образцы для теста на SARS-CoV-2 и грипп.Коинфекция была определена как положительный результат теста как на грипп, так и на SARS-CoV-2 в течение 7 дней после даты взятия образцов друг у друга.

Все люди, прошедшие тестирование на грипп и SARS-CoV-2 (положительные и отрицательные результаты), были связаны с демографической пакетной службой (DBS) — национальной базой данных, координируемой NHS digital, которая позволяет отслеживать информацию по личным демографическим данным — и дату смерти было извлечено. 17 Кроме того, лица с положительным результатом теста на SARS-CoV-2 были сопоставлены с набором данных о смертности от COVID-19 Public Health England, который ежедневно обновлялся на протяжении всей пандемии.Были включены случаи смерти от 6 дней до 28 дней после результата теста.

Результаты испытаний также были связаны с набором данных Службы вторичного использования (SUS) и набором данных Статистики эпизодов госпитализации (HES), которые содержат информацию о всех поступивших пациентах, амбулаторных и неотложных службах в больницах NHS. в Англии. 18 , 19 Эти наборы данных использовались для выявления пациентов в отделении интенсивной терапии, которым потребовалось использование аппарата ИВЛ в течение 14 дней до и 28 дней после самой ранней даты тестирования. 20 Наборы данных SUS и HES также использовались для извлечения информации об этнической принадлежности и сопутствующих заболеваниях. Сопутствующие заболевания были выявлены с использованием кодов Международной классификации болезней 10 -го пересмотра (МКБ-10) и сгруппированы в следующие категории: аспления или дисфункция селезенки, бронхиальная астма, хронические заболевания сердца, хронические заболевания почек, хронические заболевания печени, хронические неврологические расстройства, хронические респираторные заболевания (за исключением астмы), деменция, включая болезнь Альцгеймера, диабет, злокачественные новообразования, поражающие иммунную систему, ожирение, другие новообразования, ревматологические заболевания, трансплантации и состояния, влияющие на иммунную систему.Для связи с сопутствующими заболеваниями данные были ограничены стационарными и амбулаторными эпизодами госпитализации за последние 5 лет.

960″> Влияние инфекции гриппа на риск заражения SARS-CoV-2

Оценено общее количество положительных и отрицательных результатов тестов на SARS-CoV-2 и грипп с 1 по 17 недели в 2020 году. Процент положительных результатов был рассчитан для лиц с коинфекцией SARS-CoV-2 и гриппа, а также для лиц, не инфицированных гриппом, путем деления числа лиц с положительными результатами на SARS-CoV-2 на общее число протестированных лиц и умножения на 100.Кроме того, общее количество людей с коинфекцией SARS-CoV-2 и гриппом оценивали по типу гриппа.

Для оценки влияния недавнего заражения гриппом на риск заражения SARS-CoV-2 использовался отрицательный тест. Однофакторный и многофакторный анализ шансов на SARS-CoV-2 у тех, у кого был положительный результат на грипп, по сравнению с теми, у кого был отрицательный результат на грипп, был проведен с поправкой на возраст, пол, этническую принадлежность, регион, сопутствующие заболевания и неделю выборки.Модель была повторно запущена для людей, у которых в один и тот же день были взяты образцы на грипп и SARS-CoV-2. Наконец, чтобы определить влияние неизмеряемых смешанных факторов, таких как профессия, анализ был стратифицирован по возрасту на детей (<19 лет), взрослых трудоспособного возраста (19–65 лет) и пожилых людей (старше 65 лет).

966″> Результаты

Всего в период с 20 января 2020 г. по 25 апреля 2020 г., когда в RDMS был обнаружен последний положительный результат теста на грипп, было протестировано 19 256 человек как на грипп, так и на SARS-CoV-2. Из этих лиц у 16 764 (87,1%) были взяты образцы как на грипп, так и на SARS-CoV-2 в один и тот же день, а у остальных 2492 (12,9%) образцы были взяты в течение 7 дней друг от друга. В общей сложности 58 человек имели коинфекцию SARS-CoV-2 и грипп, 992 имели положительный результат на грипп и были отрицательными на SARS-CoV-2, 4443 имели положительный результат на SARS-CoV-2 и были отрицательными на грипп, и остальные 13 763 дали отрицательный результат как на SARS-CoV-2, так и на грипп в течение этого периода (рис. 1).Из 58 пациентов с коинфекцией SARS-CoV-2 и гриппа 32 (55,2%) случая были в возрасте ≥70  лет. Из 58 случаев коинфекции SARS-CoV-2 и гриппа у 31 человека был грипп A (без субтипа), у 8 — грипп A(h2N1), у 16 ​​— грипп B, у 1 — грипп A и B и у 2 — грипп неизвестного типа. Всех обследовали на грипп методом ПЦР. На 12-й неделе было зарегистрировано наибольшее количество коинфекций SARS-CoV-2 и гриппа (20 человек, таблица 1).

Рисунок 1

Распределение случаев SARS-CoV-2, гриппа и коинфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г. (недели 1–17)

Рисунок 1

Распространение SARS-CoV-2, гриппа и случаев коинфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г. (недели 1–17)

Таблица 1

положительных результатов на SARS-CoV-2 среди случаев гриппа и отрицательных результатов тестов на грипп по неделям выборки в Англии с 20 января 2020 г. по 25 апреля 2020 г.

9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8
9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 111 562 562 19.8 9.8
Таблица 1

SARS-COV-2 Positivivity Среди случаев гриппа и гриппа-отрицательные негативы по заказу недели в Англии с 20 января 2020 по 25 апреля 2020 г.

9 9
неделе . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1 88
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8
9 9 8
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
34  34  323  329 
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8

При наблюдении описательных характеристик по четырем результатам теста 31,0% коинфицированных были в возрасте ≥80 лет, что было аналогично положительному тесту на SAV-CoV-2. и отрицательный на грипп (29.8%), но больше, чем у тех, кто дал отрицательный результат на оба (15,4%) или у тех, у кого был положительный результат на грипп, но отрицательный на SARS-CoV-2 (11,9%) (дополнительная таблица S1, доступная в качестве дополнительных данных на IJE онлайн). Было аналогичное распределение мужчин и женщин для всех групп, и доминирующей этнической принадлежностью были белые для всех категорий результатов теста, за которыми следовали азиатские / азиатские британцы, за исключением тех, у кого была коинфекция, для которых второй наиболее распространенной этнической принадлежностью были черные / черные британцы. (Дополнительная таблица S1, доступная в качестве дополнительных данных по адресу IJE онлайн).

В общей сложности 13 451 (69,9%) человек были связаны с записью о госпитализации в SUS в период с 1 декабря 2020 г. по 24 августа 2020 г., из которых 12 253 человека имели связанную запись за 14 дней до и ≤28 дней после самой ранней Дата теста на SARS-CoV-2 или грипп. Из 12 253 человек в общей сложности 1666 (13,6%) человек были госпитализированы в отделение интенсивной терапии, а 890 (7,3%) были на ИВЛ (дополнительный рисунок S1, доступный в качестве дополнительных данных на сайте IJE ). Из 19 256 особей 2469 (12.умерли 8%), из которых 25/58 (43,1%) пациентов с коинфекцией SARS-CoV-2 и гриппом умерли.

Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ . 50176 58 58 58 Phangeenza Статус отрицательный Базовый уровень Базовый уровень Базовый уровень Pложительный 0.18 (0.14-0.24) 0.42 (0.31-0.56) до 19 лет до 19 лет 5 Phangeenza Статус Отрицательный Базовый уровень Baseline 40185 (0.22-1.38) 1.07 (0.38-3.01) Рабочий эз 17 Статус гриппа Отрицательный Базовый уровень Базовый уровень Базовый уровень 4 0.12 (0.07-0.20) 0.26 (0.15-0.45) Статус пожилых 36 грипп статус 9172 отрицательный базовый уровень базовый уровень 4 0,29 (0,20–0,41) 0,52 (0,35–0,75) 9172 отрицательный 9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
58 58 58 Phangeenza статус BASELELE BASELELE
4
0.18 (0.14-0.24) 0.42 (0.31-0.56)
До 19 лет 5 Статус гриппа Отрицательный Исходный уровень Исходный уровень
7 Положительный 90.55 (0.22-1.38) 1.07 (0.38-3.01)
Рабочий век 17 грипп статус Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Пожилые люди 36 Phangeenza Статус 4 Базовый уровень Базовый уровень Базовый уровень
положительный 0.29 (0.20-0.41) 0.52 0.52 (0.35-0,75)
Таблица 2

Шансы SARS-COV-2 Инфекция статуса гриппа, стратифицированного по возрасту (Англия с 20 января 2020 по 25 апреля 2020 г.) a

9172 отрицательный 9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
58 58 58 Phangeenza статус BASELELE BASELELE
4
0.18 (0.14-0.24) 0.42 (0.31-0.56)
До 19 лет 5 Статус гриппа Отрицательный Исходный уровень Исходный уровень
7 Положительный 90.55 (0.22-1.38) 1.07 (0.38-3.01)
Рабочий век 17 грипп статус Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Пожилые люди 36 Phangeenza Статус 4 Базовый уровень Базовый уровень Базовый уровень
положительный 0.29 (0,20–0,41) 0,52 (0,35–0,75)
9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
50176 58 58 58 Phangeenza Статус отрицательный Базовый уровень Базовый уровень Базовый уровень
Pложительный 0.18 (0.14-0.24) 0.42 (0.31-0.56)
до 19 лет до 19 лет 5 Phangeenza Статус Отрицательный Базовый уровень Baseline
40185
(0.22-1.38) 1.07 (0.38-3.01)
Рабочий эз 17 Статус гриппа Отрицательный Базовый уровень Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Статус пожилых 36 грипп статус базовый уровень базовый уровень
4 0,29 (0,20–0,41) 0,52 (0,35–0,75)

Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
. Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
. Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . <5 0 0 0 — — 37 0 2 0.0 5 5.4 5-9 2 0 9 0 0.0 0.0 7 0 0 0.0 0.0 10-19 3 0 0 0.0 0.0 39 1 4 4 3 12.1 20-29 1 0 0 0.0 0.0 0.0 162 4 10 2 6.2 9 7 1 9 2 14.3 28.6 295 5 33 1.7 11.2 11.2 40-49 2 0 0 0 0.0 0.0 426 21 80207 21 4.9 18.8 18.8 50-59 5 9 9 158 158 12.3 24,0 60-69 60-69 6 3 1 50.0 16.7 670 155 160207 23.1 23.1 23.9 70-79 14 14 8 1 57.1 7.1 7.1 824 307 117 39.99 14.2 9020+ 9 12 0 66.7 0.0 1331 619 15 46.5 1,1 Всего 58 25 7 7 43.1 12.1 4443 4443 1193 581 26.9  13,1  9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0.0 0.0 0.0 7 0 0 0.0
10-19 3 0 0 0.0 0.0 33 1 4 3.0 3 12.1
20-29 1 0 0 0 0.0 0.0 162 4 10 2,5 6.2
30-39 7 1 2 14.3 28.6 295 5 3 9 33 1.7 11.2
40-49 2 2 2 2 0 0 0.0 0.0 426 21 21 80207 49 18.8
50-59
50-59 5 1 3 20.0 60.0 60.0 658 81 158 12.3
60-69 6 3 1 9 1 50,0 16.7 670 155 160 23.1 23.1 23.9
70-79 14 8 8 1 57.1 7.1 824 307 117 37.3 14.2 14.2
80+ 18 12 9 9 0.0 1331 619 9 9 46.5 1,1
Всего 58 25 7 7 43,1 12.1 4443 4443 1193 581 581 26.9 13.1
Таблица 3

SARS-COV-2 и МОЩЕННЫЙ МОИЗНЕНИЕ МОИЗНЕНИЯ И СМЕРТЬ CoV-2 без летальных исходов и смертности от гриппа (%) по возрастным группам в Англии с 20 января 2020 г. по 25 апреля 2020 г.

9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0 0 0,0 0,0 7 0 0 0.0 0 0.0
10-19 3 0 0 0.0 0.0 33 1 4 3 9 3.0 12.1
20-29 1 0 0 0.0 0.0 162 4 10207 4 10 29 6.2 6.2
30-39 7 1 2 14.3 28.6 28.6 295 5 9 85
40-49 2 0 0 0.0 0.0 426 21 80 49 18.9 18.8
50-59 5 9 3 20,0 60,0 658 81 158 12.3 24.0
60-69 6 9 1 50.0 16.7 670 155 155 160 23.1 23.9
70-79 70-79 14 8 8 1 57.1 7.1 924 307 907 117 37.99 14.2
80+ 18 12 0 66.7 0.0 0.0 1331 619 15 1,1 58 9 7 43.1 12.1 4443 1193 581 26,9 13,1
9 9 9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0 0 0.0 0.0 7 0 0 0 0.0 0.0
10-19
10-19 3 0 0 0.0 0.0 0.0 33 1 4 3.0 12.1
1 0 0 0.0 0.0 162 4 10 2.5 2.5 6.2
30-39 7 1 2 9 2 14.39 9 28.6 295 5 5 33 1.7 11.2
40-49 2 0 0 0.0 426 21 80207 18.8
50-59 5 5 1 3 20.0 60.0 60.0 658 81 158 12.3 12.3 24.0
60185
60-69 6 3 1 50.0 16.7 670 670 155 160 23.9
70-79 14 8 1 57.1 7.1 924 307 117 37.099 14.2 14.2
80+ 18 12 0 12 0 66,7 0.0 1331 619 15 46.5 1.1 1.1
Всего 58 9 7 9 12.1 4443 1193 581 581 26.9 13.1

Метуварительный анализ , пол, этническая принадлежность, сопутствующие заболевания (0 или 1+) и статус коинфекции (грипп-отрицательный/SARS-CoV-2-отрицательный; грипп-отрицательный/SARS-CoV-2-положительный; грипп-положительный/SARS-CoV- 2-отрицательный; грипп-положительный/SARS-CoV-2-положительный) означало, что вероятность смерти равнялась 5.92 (95% ДИ: 3,21–10,91) раз выше среди лиц с коинфекцией SARS-CoV-2 и гриппа, чем среди лиц, не страдающих ни гриппом, ни SARS-CoV-2, и выше, чем среди лиц только с SARS-CoV-2, где вероятность смерти была в 2,61 (95% ДИ: 2,36–2,88) раза выше по сравнению с теми, у кого не было SARS-CoV-2 или гриппа. У пациентов с коинфекцией SARS-CoV-2 и гриппа вероятность смерти была примерно в два раза выше (ОШ 2,27, 95% ДИ: 1,23–4,19) по сравнению с пациентами, инфицированными только SARS-CoV-2. Для тех, у кого был только положительный результат на грипп, было несколько сниженный риск смертности (ОШ 0.64, 95% ДИ: 0,47–0,89) (рис. 2) по сравнению с лицами без инфекций. Чтобы формально проверить взаимодействие между гриппом и SARS-CoV-2, была подобрана та же модель, но с отдельными терминами для гриппа, SARS-CoV-2 и взаимодействия гриппа и SARS-CoV-2, что дало эффект взаимодействия (). P  ≤ 0,001) на дополнительные 3,60 шанса смерти (95% ДИ: 1,83–7,11) по сравнению с ожидаемым, если бы грипп и SARS-CoV-2 действовали независимо.

Рис. 2

Вероятность и 95% доверительные интервалы* смерти, использования ИВЛ и госпитализации в ОИТ по статусу гриппа/SARS-CoV-2 по сравнению с лицами без инфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г.

При сочетании использования ИВЛ или смерти в составную переменную, шансы равнялись 6.в 43 раза выше среди лиц с коинфекцией (95% ДИ: 3,61–11,47). Композитный показатель госпитализации или смерти в ОИТ имел в 6,33 раза больше среди лиц с коинфекцией (95% ДИ: 3,57–11,23) (рис. 2). Пациенты с коинфекцией SARS-CoV-2 и гриппом примерно в два раза чаще находились на ИВЛ при поступлении (ОШ 2,15, 95% ДИ: 1,20–3,84) или попадали в отделение интенсивной терапии (ОШ 2,08, 95% ДИ: 1,17). –3,70) по сравнению с теми, у кого был только SARS-CoV-2. Тест на взаимодействие как для композита вентилятора, так и для композита ICU дал эффект ( P  ≤ 0.001) с дополнительными шансами коинфекции на 3,38 (95% ДИ: 1,81–6,34) и 3,39 шансами коинфекции (95% ДИ: 1,83–6,29) соответственно по сравнению с ожидаемым, если бы грипп и SARS-CoV-2 действовали независимо.

995″> Дополнительные данные

Дополнительные данные доступны по адресу IJE онлайн.

999″> Финансирование

Работа выполнена при поддержке авторов из Public Health England в рамках рутинных функций эпиднадзора и контроля за инфекционными заболеваниями. Департамент общественного здравоохранения Англии, Национальная инфекционная служба, Отдел иммунизации и противодействия, предоставил производителям вакцин отчеты о пострегистрационном надзоре, которые держатели регистрационных удостоверений должны представлять в лицензирующий орган Великобритании в соответствии со своей Стратегией управления рисками.За эти отчеты взимается плата за возмещение затрат.

003″> Авторские вклады

J.L.B., E.T., J.S. и Н.А. разработали протокол исследования. Х.З., Р.Г., Дж.С., Э.Т. и Б.М.П. извлек данные, и J.S., И.Т., Дж.Л.Б. и Н.А. провели статистический анализ. В интерпретации данных участвовали следующие авторы: Е.Т., Дж.С., Н.А., Дж.Л.Б., М.Р., Б.М.П., ​​Р.Г., Х.З., М.З. и Э.Т. J.S., N.A., J.L.B., M.R., B.M.P. и Х.З. написал первый черновик статьи, и все авторы внесли свой вклад в последующие исправления и утвердили окончательную версию.

007″ data-legacy-id=»ref1″> Каталожные номера

1

Антоний

С

,

Альмаглут

N

,

Хайдеманн

Э.

Сопутствующие инфекции COVID-19 и гриппа являются низкими или заниженными? Обсервационное исследование, изучающее текущую опубликованную литературу, включая три новых неопубликованных случая

.

J Med Virol

2020

;

92

:

2489

97

.2

Лэнсбери

L

,

Лим

Б

,

Баскаран

В

,

Лим

WS.

Коинфекции у людей с COVID-19: систематический обзор и метаанализ

.

J Заразить

2020

;

81

:

266

75

.3

Никбахш

S

,

Майр

С

,

Мэтьюз

Л

и другие.

Взаимодействия между вирусами влияют на популяционную динамику гриппа и простуды

.

Proc Natl Acad Sci USA

2019

;

116

:

27142

50

.4

Кожух

BJ

,

Клык

ВЖ

,

Нисиура

Х

и другие.

Повышенный риск негриппозных респираторных вирусных инфекций, связанный с получением инактивированной противогриппозной вакцины

.

Clin Infect Dis

2012

;

54

:

1778

83

.5

Айзекс

А

,

Берк

округ Колумбия.

Вирусная интерференция и интерферон

.

Br Med Bull

1959

;

15

:

185

88

.6

Синджо

М

,

Омоэ

К

,

Сайто

N

,

Мацуо

Н

,

Нероме

К.

Профили роста респираторно-синцитиального вируса in vitro в присутствии вируса гриппа

.

Акта Вирол

2000

;

44

:

91

97

.7

Li

W

,

Ли

М

,

Оу

Г.

COVID-19, реснички и запах

.

Фев Дж

2020

;

287

:

3672

76

.8

Ву

X

,

Цай

Д

,

Хуан

X

и другие.

Коинфекция SARS-CoV-2 и вирусом гриппа А

.

Emerg Infect Dis

2020

;

26

:

1324

26

.9

Хашеми

SA

,

Сафаманеш

С

,

Гасемзаде-Могхаддам

H

,

Гафури

М

,

Амир

А.

Высокая распространенность коинфекции SARS-CoV-2 и вируса гриппа A (h2N1) среди умерших пациентов на северо-востоке Ирана

.

Дж Мед Вирол

2021

;

93

:

1008

05

.10

Хуанг

B-R

,

Лин

Y-L

,

Ван

C-K

и другие.

Коинфекция вирусом гриппа B и SARS-CoV-2: история болезни из Тайваня

.

J Microbiol Immunol Infect

2020

;S1684-182(20)30152-3.11

Юэ

Н

,

Чжан

М

,

Син

Л

и другие.

Эпидемиология и клинические характеристики коинфекции SARS-CoV-2 и вирусов гриппа у пациентов во время вспышки COVID-19

.

J Med Virol

2020

;

92

:

2870

73

.12

Хашеми

SA

,

Сафаманеш

С

,

Гафури

М

и другие.

Коинфекция COVID-19 и вируса гриппа А у двух умерших пациентов с острым респираторным синдромом, Бойнурд, Иран

.

J Med Virol

2020

;

92

:

2319

21

.13

Общественное здравоохранение Англии. Надзор за гриппом и другими респираторными вирусами в Великобритании, зима 2019–2020 гг. , Лондон: публикации PHE,

2020

.15

Zhao

H

,

Зеленый

Н

,

Лакенби

А

и другие.

Новая лабораторная система эпиднадзора (Respiratory DataMart System) за гриппом и другими респираторными вирусами в Англии: результаты и опыт с 2009 по 2012 год

. Евронаблюдение. 2014 23 января; 19:20680. doi: 10.2807/1560-7917.es2014.19.3.20680.21

Новак

MD

,

Сордильо

EM

,

Гитман

МР

,

Paniz Mondolfi

AE.

Коинфекция у пациентов, инфицированных SARS-CoV-2: где вирус гриппа и риновирус/энтеровирус?

Дж Мед Вирол

2020

;

92

:

1699

700

.22

Онестад

Г

,

Nordbø

SA.

Помехи между вспышками респираторных вирусов

.

Euro Surveill

2009

;

14

:

19359

.23

Пинки

L

,

Добровольный

НМ.

Коинфекции SARS-CoV-2: могут ли грипп и простуда быть полезными

?

J Med Virol

2020

;

92

:

2623

28

.24

Ли

Q

,

Тан

Б

,

Брагацци

NL

,

Сяо

Y

,

Ву

Дж.

Моделирование воздействия массовой вакцинации против гриппа и мероприятий общественного здравоохранения на эпидемии COVID-19 с ограниченными возможностями обнаружения

.

Math Biosci

2020

;

325

:

108378

.25

Греч

В

,

Борг

М.

Вакцинация против гриппа в эпоху COVID-19

.

Ранний Хум Дев

2020

;

148

:

105116

.26

Финк

Г

,

Орлова-Финк

N

,

Шиндлер

Т

и другие.

Инактивированная трехвалентная вакцина против гриппа связана с более низкой смертностью среди пациентов с Covid-19 в Бразилии

.

BMJ Evid на базе Med

2020

;

111549

.27

Привор-Думм

ЛАП

,

Григорий

А

,

Баррат

Дж

и другие.

Глобальная программа иммунизации пожилых людей в эпоху COVID-19: план действий

.

Вакцина

2020

;S0264-410X(20)30885-9. doi:10.1016/j.vaccine.2020.06.082.28

Ma

S

,

Лай

X

,

Чен

Z

,

Ту

С

,

Цинь

К.

Клинические характеристики пациентов в критическом состоянии с коинфекцией SARS-CoV-2 и вирусом гриппа в Ухане, Китай

.

Int J Infect Dis

2020

;

96

:

683

87

.29

Кондо

Y

,

Миядзаки

С

,

Ямашита

Р

,

Икеда

Т.

Коинфекция SARS-CoV-2 и вирусом гриппа А

.

BMJ Case Rep

2020

;

13

:

e236812

.30

Конала

ВМ

,

Адапа

С

,

Нарамала

С

и другие.

Серия случаев пациентов с коинфекцией гриппом и COVID-19

.

J Investig Med High Impact Case Rep

2020

;

8

:

23247096204

.31

Перейти к

H

,

Ихира

Х

,

Морисита

К

и другие.

Усиленный рост вируса гриппа А при коинфекции вирусом парагриппа человека типа 2

.

Мед Микробиол Иммунол

2016

;

205

:

209

18

.32

Чжан

AJ

,

Ли

АС

,

Чан

ДЖФ

и другие.

Коинфекция коронавирусом тяжелого острого респираторного синдрома 2 и вирусом гриппа A(h2N1)pdm09 усиливает тяжесть пневмонии у золотистых сирийских хомяков

.

Clin Infect Dis

2020

20 ноября;

ciaa1747

. дои: 10.1093/cid/ciaa1747. Epub перед печатью. PMID: 33216851; PMCID: PMC7717201.33

Пебоди

R

,

Дженнад

А

,

Эллис

Дж

и другие.

Эффективность вакцины против гриппа в конце сезона у взрослых и детей в Соединенном Королевстве в 2017/18

.

2019

;

24

:

1800488

.34

Ли

N

,

Чан

ПК

,

Ю

ИТ

и другие.

Совместная циркуляция метапневмовируса человека и связанного с атипичной пневмонией коронавируса во время крупной внутрибольничной вспышки атипичной пневмонии в Гонконге

.

Дж Клин Вирол

2007

;

40

:

333

37

.35

Олдридж

R

,

Льюэр

Д

,

Катикиредди

С

и другие.

Черные, азиатские и этнические меньшинства в Англии подвергаются повышенному риску смерти от COVID-19: непрямая стандартизация данных о смертности NHS

.

Wellcome Open Res

2020

;

5

:

88

.37

Аткинс

JL

,

Масоли

JA

,

Дельгадо

Дж

, и другие. Ранее существовавшие сопутствующие заболевания, предсказывающие тяжелую форму COVID-19 у пожилых людей в когорте сообщества британского биобанка.

2020

: 2020.05.06.200.

Примечания автора

© Автор(ы) 2021.Опубликовано Oxford University Press от имени Международной эпидемиологической ассоциации.

Это статья в открытом доступе, распространяемая в соответствии с лицензией Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа цитируется правильно.

Взаимодействия между SARS-CoV-2 и гриппом и влияние коинфекции на тяжесть заболевания: отрицательный тест | Международный журнал эпидемиологии

948″> Фон

Вполне вероятно, что как SARS-CoV-2, так и сезонные респираторные патогены, в первую очередь грипп, будут совместно циркулировать по мере приближения зимы 2020/2021 в северном полушарии.Потенциальное влияние COVID-19 наряду с гриппом на заболеваемость, смертность и возможности служб здравоохранения вызывает серьезную озабоченность, хотя в настоящее время мало что известно о взаимодействии между этими двумя респираторными вирусами. 1 , 2

Имеются данные о патогенной конкуренции между респираторными вирусами, в том числе между гриппом и сезонными коронавирусами. 3 , 4 Это может происходить из-за иммунно-опосредованного вмешательства, приводящего к ослаблению некоторых вирусов во время пика активности другого вируса — явление, известное уже много десятилетий. 3 , 5 , 6 На сегодняшний день имеются некоторые свидетельства эктопического взаимодействия между белком SARS-CoV-2 и белками хозяина, 7 , хотя информации о патогенном взаимодействии между ними нет. SARS-CoV-2 и грипп, и эпидемиологическое влияние такого взаимодействия неизвестно.

Ключевые сообщения

Если люди одновременно инфицированы SARS-CoV-2 и гриппом, это может привести к более тяжелым исходам заболевания.С начала пандемии SARS-CoV-2 2020 г. был опубликован ряд сообщений о случаях коинфекции SARS-CoV-2 и гриппа с тяжелыми исходами. 1 , 8–12 Тем не менее, в отчетах о клинических случаях часто выделяются более тяжелые случаи, и не проводилось систематического анализа исходов заболевания у пациентов с коинфекцией по сравнению с контрольной группой без коинфекции.

  • Потенциальное влияние COVID-19 наряду с гриппом на заболеваемость, смертность и возможности медицинских служб вызывает серьезную озабоченность, и мало что известно о взаимодействии между этими двумя респираторными вирусами.

  • Мы оценили взаимодействие между гриппом и SARS-CoV-2 в Англии. Мы обнаружили, что SARS-CoV-2 был на 58% ниже среди случаев гриппа. У пациентов с коинфекцией риск смерти был на 5,92 (95% доверительный интервал: 3,21–10,91) выше, чем у пациентов, не страдающих ни гриппом, ни SARS-CoV-2.

  • По мере приближения сезона гриппа 2020–2021 гг. в северном полушарии стратегии тестирования должны включать тестирование как на грипп, так и на SARS-CoV-2, а также максимальное использование вакцинации против гриппа, особенно в группах повышенного риска обоих заболеваний.

В Великобритании сезон гриппа 2019–2020 гг. достиг своего пика рано, при этом активность значительно снизилась по сравнению с январем 2020 г. 13 В этом сезоне активность была ниже, а преобладающим штаммом был грипп A(h4N2). 13 Первое заражение SARS-CoV-2 произошло в конце января 2020 г. в результате завозного случая, и распространение SARS-CoV-2 выросло с устойчивой передачей среди населения с начала марта в Великобритании, достигнув пика 7 апреля 2020 г., когда было зарегистрировано 4493 случая. а 21 апреля общее число ежедневных смертей от SARS-CoV-2 достигло пика в 1172 человека. 14 Таким образом, между циркуляцией вируса гриппа и циркуляцией SARS-CoV-2 наблюдался лишь ограниченный период времени. В этом исследовании мы изучаем взаимодействие между гриппом и SARS-CoV-2 на последних этапах сезона гриппа 2019–2020 гг. в Англии.

Исследование преследует две цели: во-первых, оценить, связана ли инфекция гриппа со сниженным риском заражения SARS-CoV-2, и, во-вторых, оценить, связана ли коинфекция гриппом с более тяжелым течением ТОРС. Исходы -CoV-2, такие как смерть, госпитализация, госпитализация в отделение интенсивной терапии (ОИТ) или необходимость искусственной вентиляции легких.

955″> Источники данных и связь данных

SGSS (Система эпиднадзора второго поколения) и Respiratory DataMart System (RDMS) использовались для выявления всех случаев заболевания гриппом в период с 01 января 2020 г. по 2 июня 2020 г. 15 , гриппа делается почти исключительно с помощью ПЦР. Для анализа данные были ограничены периодом времени с 20 января 2020 г. по 25 апреля 2020 г., когда произошла первая коинфекция SARS-CoV-2 и гриппом и последний образец гриппа был зарегистрирован в RDMS.Также были извлечены лица, протестированные на грипп, у которых был отрицательный результат в RDMS. Обе группы были сопоставлены с результатами теста на SARS-CoV-2 (положительными и отрицательными) в SGSS по состоянию на 2 июня 2020 года. Случаи были сопоставлены с использованием действительного номера пациента NHS (Национальная служба здравоохранения) (уникальный идентификатор пациента в Англии; полный в 91,5% случаев). результатов теста) и, если это не так, дату рождения пациента, имя и фамилию (заполните для 95,1% случаев, когда номер NHS не был доступен). В исследование были включены все лица, у которых в течение 7 дней были отобраны образцы для теста на SARS-CoV-2 и грипп.Коинфекция была определена как положительный результат теста как на грипп, так и на SARS-CoV-2 в течение 7 дней после даты взятия образцов друг у друга.

Все люди, прошедшие тестирование на грипп и SARS-CoV-2 (положительные и отрицательные результаты), были связаны с демографической пакетной службой (DBS) — национальной базой данных, координируемой NHS digital, которая позволяет отслеживать информацию по личным демографическим данным — и дату смерти было извлечено. 17 Кроме того, лица с положительным результатом теста на SARS-CoV-2 были сопоставлены с набором данных о смертности от COVID-19 Public Health England, который ежедневно обновлялся на протяжении всей пандемии.Были включены случаи смерти от 6 дней до 28 дней после результата теста.

Результаты испытаний также были связаны с набором данных Службы вторичного использования (SUS) и набором данных Статистики эпизодов госпитализации (HES), которые содержат информацию о всех поступивших пациентах, амбулаторных и неотложных службах в больницах NHS. в Англии. 18 , 19 Эти наборы данных использовались для выявления пациентов в отделении интенсивной терапии, которым потребовалось использование аппарата ИВЛ в течение 14 дней до и 28 дней после самой ранней даты тестирования. 20 Наборы данных SUS и HES также использовались для извлечения информации об этнической принадлежности и сопутствующих заболеваниях. Сопутствующие заболевания были выявлены с использованием кодов Международной классификации болезней 10 -го пересмотра (МКБ-10) и сгруппированы в следующие категории: аспления или дисфункция селезенки, бронхиальная астма, хронические заболевания сердца, хронические заболевания почек, хронические заболевания печени, хронические неврологические расстройства, хронические респираторные заболевания (за исключением астмы), деменция, включая болезнь Альцгеймера, диабет, злокачественные новообразования, поражающие иммунную систему, ожирение, другие новообразования, ревматологические заболевания, трансплантации и состояния, влияющие на иммунную систему.Для связи с сопутствующими заболеваниями данные были ограничены стационарными и амбулаторными эпизодами госпитализации за последние 5 лет.

960″> Влияние инфекции гриппа на риск заражения SARS-CoV-2

Оценено общее количество положительных и отрицательных результатов тестов на SARS-CoV-2 и грипп с 1 по 17 недели в 2020 году. Процент положительных результатов был рассчитан для лиц с коинфекцией SARS-CoV-2 и гриппа, а также для лиц, не инфицированных гриппом, путем деления числа лиц с положительными результатами на SARS-CoV-2 на общее число протестированных лиц и умножения на 100.Кроме того, общее количество людей с коинфекцией SARS-CoV-2 и гриппом оценивали по типу гриппа.

Для оценки влияния недавнего заражения гриппом на риск заражения SARS-CoV-2 использовался отрицательный тест. Однофакторный и многофакторный анализ шансов на SARS-CoV-2 у тех, у кого был положительный результат на грипп, по сравнению с теми, у кого был отрицательный результат на грипп, был проведен с поправкой на возраст, пол, этническую принадлежность, регион, сопутствующие заболевания и неделю выборки.Модель была повторно запущена для людей, у которых в один и тот же день были взяты образцы на грипп и SARS-CoV-2. Наконец, чтобы определить влияние неизмеряемых смешанных факторов, таких как профессия, анализ был стратифицирован по возрасту на детей (<19 лет), взрослых трудоспособного возраста (19–65 лет) и пожилых людей (старше 65 лет).

966″> Результаты

Всего в период с 20 января 2020 г. по 25 апреля 2020 г., когда в RDMS был обнаружен последний положительный результат теста на грипп, было протестировано 19 256 человек как на грипп, так и на SARS-CoV-2. Из этих лиц у 16 764 (87,1%) были взяты образцы как на грипп, так и на SARS-CoV-2 в один и тот же день, а у остальных 2492 (12,9%) образцы были взяты в течение 7 дней друг от друга. В общей сложности 58 человек имели коинфекцию SARS-CoV-2 и грипп, 992 имели положительный результат на грипп и были отрицательными на SARS-CoV-2, 4443 имели положительный результат на SARS-CoV-2 и были отрицательными на грипп, и остальные 13 763 дали отрицательный результат как на SARS-CoV-2, так и на грипп в течение этого периода (рис. 1).Из 58 пациентов с коинфекцией SARS-CoV-2 и гриппа 32 (55,2%) случая были в возрасте ≥70  лет. Из 58 случаев коинфекции SARS-CoV-2 и гриппа у 31 человека был грипп A (без субтипа), у 8 — грипп A(h2N1), у 16 ​​— грипп B, у 1 — грипп A и B и у 2 — грипп неизвестного типа. Всех обследовали на грипп методом ПЦР. На 12-й неделе было зарегистрировано наибольшее количество коинфекций SARS-CoV-2 и гриппа (20 человек, таблица 1).

Рисунок 1

Распределение случаев SARS-CoV-2, гриппа и коинфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г. (недели 1–17)

Рисунок 1

Распространение SARS-CoV-2, гриппа и случаев коинфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г. (недели 1–17)

Таблица 1

положительных результатов на SARS-CoV-2 среди случаев гриппа и отрицательных результатов тестов на грипп по неделям выборки в Англии с 20 января 2020 г. по 25 апреля 2020 г.

9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8
9 9
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1 88
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 111 562 562 19.8 9.8
Таблица 1

SARS-COV-2 Positivivity Среди случаев гриппа и гриппа-отрицательные негативы по заказу недели в Англии с 20 января 2020 по 25 апреля 2020 г.

9 9 88
неделе . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8
9 9 88
Неделя . Положительный на грипп
.
Грипп-отрицательный
.
SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) . SARS-CoV-2-отрицательный . SARS-CoV-2-положительный . Итого . Положительный результат на SARS-CoV-2 (%) .
1 1 0 9 9 9 9 9 9 9 9 9
2 0 0 0 1 0 1 0
3 9 9 9 0 9 0 4 0 9 4 0 0
4 12 0 12 0 39 0 9 9 9 9 5 11 9 9 11 0 60207 0 0 60 0
6 34 0 34 0 323 6 329 1
7 58 0 58 0 583 2 585 585 0.3
8 53 0 53 0 329 9 338 338 29
9 9 189 0 189 0 1471 22 1493 1.5
10 125 11 9.1 113 80207 9
11 330 12 342 35 2957 483 4440 3440 14.0
12 145 20 9 165 12.1 2322 783 3105 25.2
13 25 6 6 31 1342 1092 2434 44.9
14 4 9 8 9 8 12 66.7 908 1072 1022 1022 2094 4894
15 4 4 1 5 5 20,0 839 496 1335 37.2
16 0 0 0 958 303 958 303 958 28.6 28.6
17 1 0 1 0 451 111 562 19,8

При наблюдении описательных характеристик по четырем результатам теста 31,0% коинфицированных были в возрасте ≥80 лет, что было аналогично положительному тесту на SAV-CoV-2. и отрицательный на грипп (29.8%), но больше, чем у тех, кто дал отрицательный результат на оба (15,4%) или у тех, у кого был положительный результат на грипп, но отрицательный на SARS-CoV-2 (11,9%) (дополнительная таблица S1, доступная в качестве дополнительных данных на IJE онлайн). Было аналогичное распределение мужчин и женщин для всех групп, и доминирующей этнической принадлежностью были белые для всех категорий результатов теста, за которыми следовали азиатские / азиатские британцы, за исключением тех, у кого была коинфекция, для которых второй наиболее распространенной этнической принадлежностью были черные / черные британцы. (Дополнительная таблица S1, доступная в качестве дополнительных данных по адресу IJE онлайн).

В общей сложности 13 451 (69,9%) человек были связаны с записью о госпитализации в SUS в период с 1 декабря 2020 г. по 24 августа 2020 г., из которых 12 253 человека имели связанную запись за 14 дней до и ≤28 дней после самой ранней Дата теста на SARS-CoV-2 или грипп. Из 12 253 человек в общей сложности 1666 (13,6%) человек были госпитализированы в отделение интенсивной терапии, а 890 (7,3%) были на ИВЛ (дополнительный рисунок S1, доступный в качестве дополнительных данных на сайте IJE ). Из 19 256 особей 2469 (12.умерли 8%), из которых 25/58 (43,1%) пациентов с коинфекцией SARS-CoV-2 и гриппом умерли.

Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ . 50176 58 58 58 Phangeenza Статус отрицательный Базовый уровень Базовый уровень Базовый уровень Pложительный 0.18 (0.14-0.24) 0.42 (0.31-0.56) до 19 лет до 19 лет 5 Phangeenza Статус Отрицательный Базовый уровень Baseline 40185 (0.22-1.38) 1.07 (0.38-3.01) Рабочий эз 17 Статус гриппа Отрицательный Базовый уровень Базовый уровень Базовый уровень 4 0.12 (0.07-0.20) 0.26 (0.15-0.45) Статус пожилых 36 грипп статус 9172 отрицательный базовый уровень базовый уровень 4 0,29 (0,20–0,41) 0,52 (0,35–0,75) 9172 отрицательный 9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
58 58 58 Phangeenza статус BASELELE BASELELE
4
0.18 (0.14-0.24) 0.42 (0.31-0.56)
До 19 лет 5 Статус гриппа Отрицательный Исходный уровень Исходный уровень
7 Положительный 90.55 (0.22-1.38) 1.07 (0.38-3.01)
Рабочий век 17 грипп статус Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Пожилые люди 36 Phangeenza Статус 4 Базовый уровень Базовый уровень Базовый уровень
положительный 0.29 (0.20-0.41) 0.52 0.52 (0.35-0,75)
Таблица 2

Шансы SARS-COV-2 Инфекция статуса гриппа, стратифицированного по возрасту (Англия с 20 января 2020 по 25 апреля 2020 г.) a

9172 отрицательный 9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
58 58 58 Phangeenza статус BASELELE BASELELE
4
0.18 (0.14-0.24) 0.42 (0.31-0.56)
До 19 лет 5 Статус гриппа Отрицательный Исходный уровень Исходный уровень
7 Положительный 90.55 (0.22-1.38) 1.07 (0.38-3.01)
Рабочий век 17 грипп статус Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Пожилые люди 36 Phangeenza Статус 4 Базовый уровень Базовый уровень Базовый уровень
положительный 0.29 (0,20–0,41) 0,52 (0,35–0,75)
9172 отрицательный
Возрастная группа . Подсчет коинфекции . Характеристика . Нескорректированное отношение шансов . 95% ДИ . Скорректированное отношение шансов . 95% ДИ .
50176 58 58 58 Phangeenza Статус отрицательный Базовый уровень Базовый уровень Базовый уровень
Pложительный 0.18 (0.14-0.24) 0.42 (0.31-0.56)
до 19 лет до 19 лет 5 Phangeenza Статус Отрицательный Базовый уровень Baseline
40185
(0.22-1.38) 1.07 (0.38-3.01)
Рабочий эз 17 Статус гриппа Отрицательный Базовый уровень Базовый уровень Базовый уровень
4 0.12 (0.07-0.20) 0.26 (0.15-0.45)
Статус пожилых 36 грипп статус базовый уровень базовый уровень
4 0,29 (0,20–0,41) 0,52 (0,35–0,75)

Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
. Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
. Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . <5 0 0 0 — — 37 0 2 0.0 5 5.4 5-9 2 0 9 0 0.0 0.0 7 0 0 0.0 0.0 10-19 3 0 0 0.0 0.0 39 1 4 4 3 12.1 20-29 1 0 0 0.0 0.0 0.0 162 4 10 2 6.2 9 7 1 9 2 14.3 28.6 295 5 33 1.7 11.2 11.2 40-49 2 0 0 0 0.0 0.0 426 21 80207 21 4.9 18.8 18.8 50-59 5 9 9 158 158 12.3 24,0 60-69 60-69 6 3 1 50.0 16.7 670 155 160207 23.1 23.1 23.9 70-79 14 14 8 1 57.1 7.1 7.1 824 307 117 39.99 14.2 9020+ 9 12 0 66.7 0.0 1331 619 15 46.5 1,1 Всего 58 25 7 7 43.1 12.1 4443 4443 1193 581 26.9  13,1  9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0.0 0.0 0.0 7 0 0 0.0
10-19 3 0 0 0.0 0.0 33 1 4 3.0 3 12.1
20-29 1 0 0 0 0.0 0.0 162 4 10 2,5 6.2
30-39 7 1 2 14.3 28.6 295 5 3 9 33 1.7 11.2
40-49 2 2 2 2 0 0 0.0 0.0 426 21 21 80207 49 18.8
50-59
50-59 5 1 3 20.0 60.0 60.0 658 81 158 12.3
60-69 6 3 1 9 1 50,0 16.7 670 155 160 23.1 23.1 23.9
70-79 14 8 8 1 57.1 7.1 824 307 117 37.3 14.2 14.2
80+ 18 12 9 9 0.0 1331 619 9 9 46.5 1,1
Всего 58 25 7 7 43,1 12.1 4443 4443 1193 581 581 26.9 13.1
Таблица 3

SARS-COV-2 и МОЩЕННЫЙ МОИЗНЕНИЕ МОИЗНЕНИЯ И СМЕРТЬ CoV-2 без летальных исходов и смертности от гриппа (%) по возрастным группам в Англии с 20 января 2020 г. по 25 апреля 2020 г.

9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0 0 0,0 0,0 7 0 0 0.0 0 0.0
10-19 3 0 0 0.0 0.0 33 1 4 3 9 3.0 12.1
20-29 1 0 0 0.0 0.0 162 4 10207 4 10 29 6.2 6.2
30-39 7 1 2 14.3 28.6 28.6 295 5 9 85
40-49 2 0 0 0.0 0.0 426 21 80 49 18.9 18.8
50-59 5 9 3 20,0 60,0 658 81 158 12.3 24.0
60-69 6 9 1 50.0 16.7 670 155 155 160 23.1 23.9
70-79 70-79 14 8 8 1 57.1 7.1 924 307 907 117 37.99 14.2
80+ 18 12 0 66.7 0.0 0.0 1331 619 15 1,1 58 9 7 43.1 12.1 4443 1193 581 26,9 13,1
9 9 9
Возраст (лет) . Коинфекция (положительная по гриппу и положительная по SARS-CoV-2) n  = 58
.
Единичная инфекция (SARS-CoV-2-положительный и грипп-отрицательный)
.
Всего . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) . Итого . Умер . Поступление в отделение интенсивной терапии . Смертность (%) . Уровень интенсивной терапии (%) .
<5 0 0 0 37 0 2 0.0 5.4
5-9 2 2 0 0 0.0 0.0 7 0 0 0 0.0 0.0
10-19
10-19 3 0 0 0.0 0.0 0.0 33 1 4 3.0 12.1
1 0 0 0.0 0.0 162 4 10 2.5 2.5 6.2
30-39 7 1 2 9 2 14.39 9 28.6 295 5 5 33 1.7 11.2
40-49 2 0 0 0.0 426 21 80207 18.8
50-59 5 5 1 3 20.0 60.0 60.0 658 81 158 12.3 12.3 24.0
60185
60-69 6 3 1 50.0 16.7 670 670 155 160 23.9
70-79 14 8 1 57.1 7.1 924 307 117 37.099 14.2 14.2
80+ 18 12 0 12 0 66,7 0.0 1331 619 15 46.5 1.1 1.1
Всего 58 9 7 9 12.1 4443 1193 581 581 26.9 13.1

Метуварительный анализ , пол, этническая принадлежность, сопутствующие заболевания (0 или 1+) и статус коинфекции (грипп-отрицательный/SARS-CoV-2-отрицательный; грипп-отрицательный/SARS-CoV-2-положительный; грипп-положительный/SARS-CoV- 2-отрицательный; грипп-положительный/SARS-CoV-2-положительный) означало, что вероятность смерти равнялась 5.92 (95% ДИ: 3,21–10,91) раз выше среди лиц с коинфекцией SARS-CoV-2 и гриппа, чем среди лиц, не страдающих ни гриппом, ни SARS-CoV-2, и выше, чем среди лиц только с SARS-CoV-2, где вероятность смерти была в 2,61 (95% ДИ: 2,36–2,88) раза выше по сравнению с теми, у кого не было SARS-CoV-2 или гриппа. У пациентов с коинфекцией SARS-CoV-2 и гриппа вероятность смерти была примерно в два раза выше (ОШ 2,27, 95% ДИ: 1,23–4,19) по сравнению с пациентами, инфицированными только SARS-CoV-2. Для тех, у кого был только положительный результат на грипп, было несколько сниженный риск смертности (ОШ 0.64, 95% ДИ: 0,47–0,89) (рис. 2) по сравнению с лицами без инфекций. Чтобы формально проверить взаимодействие между гриппом и SARS-CoV-2, была подобрана та же модель, но с отдельными терминами для гриппа, SARS-CoV-2 и взаимодействия гриппа и SARS-CoV-2, что дало эффект взаимодействия (). P  ≤ 0,001) на дополнительные 3,60 шанса смерти (95% ДИ: 1,83–7,11) по сравнению с ожидаемым, если бы грипп и SARS-CoV-2 действовали независимо.

Рис. 2

Вероятность и 95% доверительные интервалы* смерти, использования ИВЛ и госпитализации в ОИТ по статусу гриппа/SARS-CoV-2 по сравнению с лицами без инфекции в Англии с 20 января 2020 г. по 25 апреля 2020 г.

При сочетании использования ИВЛ или смерти в составную переменную, шансы равнялись 6.в 43 раза выше среди лиц с коинфекцией (95% ДИ: 3,61–11,47). Композитный показатель госпитализации или смерти в ОИТ имел в 6,33 раза больше среди лиц с коинфекцией (95% ДИ: 3,57–11,23) (рис. 2). Пациенты с коинфекцией SARS-CoV-2 и гриппом примерно в два раза чаще находились на ИВЛ при поступлении (ОШ 2,15, 95% ДИ: 1,20–3,84) или попадали в отделение интенсивной терапии (ОШ 2,08, 95% ДИ: 1,17). –3,70) по сравнению с теми, у кого был только SARS-CoV-2. Тест на взаимодействие как для композита вентилятора, так и для композита ICU дал эффект ( P  ≤ 0.001) с дополнительными шансами коинфекции на 3,38 (95% ДИ: 1,81–6,34) и 3,39 шансами коинфекции (95% ДИ: 1,83–6,29) соответственно по сравнению с ожидаемым, если бы грипп и SARS-CoV-2 действовали независимо.

995″> Дополнительные данные

Дополнительные данные доступны по адресу IJE онлайн.

999″> Финансирование

Работа выполнена при поддержке авторов из Public Health England в рамках рутинных функций эпиднадзора и контроля за инфекционными заболеваниями. Департамент общественного здравоохранения Англии, Национальная инфекционная служба, Отдел иммунизации и противодействия, предоставил производителям вакцин отчеты о пострегистрационном надзоре, которые держатели регистрационных удостоверений должны представлять в лицензирующий орган Великобритании в соответствии со своей Стратегией управления рисками.За эти отчеты взимается плата за возмещение затрат.

003″> Авторские вклады

J.L.B., E.T., J.S. и Н.А. разработали протокол исследования. Х.З., Р.Г., Дж.С., Э.Т. и Б.М.П. извлек данные, и J.S., И.Т., Дж.Л.Б. и Н.А. провели статистический анализ. В интерпретации данных участвовали следующие авторы: Е.Т., Дж.С., Н.А., Дж.Л.Б., М.Р., Б.М.П., ​​Р.Г., Х.З., М.З. и Э.Т. J.S., N.A., J.L.B., M.R., B.M.P. и Х.З. написал первый черновик статьи, и все авторы внесли свой вклад в последующие исправления и утвердили окончательную версию.

007″ data-legacy-id=»ref1″> Каталожные номера

1

Антоний

С

,

Альмаглут

N

,

Хайдеманн

Э.

Сопутствующие инфекции COVID-19 и гриппа являются низкими или заниженными? Обсервационное исследование, изучающее текущую опубликованную литературу, включая три новых неопубликованных случая

.

J Med Virol

2020

;

92

:

2489

97

.2

Лэнсбери

L

,

Лим

Б

,

Баскаран

В

,

Лим

WS.

Коинфекции у людей с COVID-19: систематический обзор и метаанализ

.

J Заразить

2020

;

81

:

266

75

.3

Никбахш

S

,

Майр

С

,

Мэтьюз

Л

и другие.

Взаимодействия между вирусами влияют на популяционную динамику гриппа и простуды

.

Proc Natl Acad Sci USA

2019

;

116

:

27142

50

.4

Кожух

BJ

,

Клык

ВЖ

,

Нисиура

Х

и другие.

Повышенный риск негриппозных респираторных вирусных инфекций, связанный с получением инактивированной противогриппозной вакцины

.

Clin Infect Dis

2012

;

54

:

1778

83

.5

Айзекс

А

,

Берк

округ Колумбия.

Вирусная интерференция и интерферон

.

Br Med Bull

1959

;

15

:

185

88

.6

Синджо

М

,

Омоэ

К

,

Сайто

N

,

Мацуо

Н

,

Нероме

К.

Профили роста респираторно-синцитиального вируса in vitro в присутствии вируса гриппа

.

Акта Вирол

2000

;

44

:

91

97

.7

Li

W

,

Ли

М

,

Оу

Г.

COVID-19, реснички и запах

.

Фев Дж

2020

;

287

:

3672

76

.8

Ву

X

,

Цай

Д

,

Хуан

X

и другие.

Коинфекция SARS-CoV-2 и вирусом гриппа А

.

Emerg Infect Dis

2020

;

26

:

1324

26

.9

Хашеми

SA

,

Сафаманеш

С

,

Гасемзаде-Могхаддам

H

,

Гафури

М

,

Амир

А.

Высокая распространенность коинфекции SARS-CoV-2 и вируса гриппа A (h2N1) среди умерших пациентов на северо-востоке Ирана

.

Дж Мед Вирол

2021

;

93

:

1008

05

.10

Хуанг

B-R

,

Лин

Y-L

,

Ван

C-K

и другие.

Коинфекция вирусом гриппа B и SARS-CoV-2: история болезни из Тайваня

.

J Microbiol Immunol Infect

2020

;S1684-182(20)30152-3.11

Юэ

Н

,

Чжан

М

,

Син

Л

и другие.

Эпидемиология и клинические характеристики коинфекции SARS-CoV-2 и вирусов гриппа у пациентов во время вспышки COVID-19

.

J Med Virol

2020

;

92

:

2870

73

.12

Хашеми

SA

,

Сафаманеш

С

,

Гафури

М

и другие.

Коинфекция COVID-19 и вируса гриппа А у двух умерших пациентов с острым респираторным синдромом, Бойнурд, Иран

.

J Med Virol

2020

;

92

:

2319

21

.13

Общественное здравоохранение Англии. Надзор за гриппом и другими респираторными вирусами в Великобритании, зима 2019–2020 гг. , Лондон: публикации PHE,

2020

.15

Zhao

H

,

Зеленый

Н

,

Лакенби

А

и другие.

Новая лабораторная система эпиднадзора (Respiratory DataMart System) за гриппом и другими респираторными вирусами в Англии: результаты и опыт с 2009 по 2012 год

. Евронаблюдение. 2014 23 января; 19:20680. doi: 10.2807/1560-7917.es2014.19.3.20680.21

Новак

MD

,

Сордильо

EM

,

Гитман

МР

,

Paniz Mondolfi

AE.

Коинфекция у пациентов, инфицированных SARS-CoV-2: где вирус гриппа и риновирус/энтеровирус?

Дж Мед Вирол

2020

;

92

:

1699

700

.22

Онестад

Г

,

Nordbø

SA.

Помехи между вспышками респираторных вирусов

.

Euro Surveill

2009

;

14

:

19359

.23

Пинки

L

,

Добровольный

НМ.

Коинфекции SARS-CoV-2: могут ли грипп и простуда быть полезными

?

J Med Virol

2020

;

92

:

2623

28

.24

Ли

Q

,

Тан

Б

,

Брагацци

NL

,

Сяо

Y

,

Ву

Дж.

Моделирование воздействия массовой вакцинации против гриппа и мероприятий общественного здравоохранения на эпидемии COVID-19 с ограниченными возможностями обнаружения

.

Math Biosci

2020

;

325

:

108378

.25

Греч

В

,

Борг

М.

Вакцинация против гриппа в эпоху COVID-19

.

Ранний Хум Дев

2020

;

148

:

105116

.26

Финк

Г

,

Орлова-Финк

N

,

Шиндлер

Т

и другие.

Инактивированная трехвалентная вакцина против гриппа связана с более низкой смертностью среди пациентов с Covid-19 в Бразилии

.

BMJ Evid на базе Med

2020

;

111549

.27

Привор-Думм

ЛАП

,

Григорий

А

,

Баррат

Дж

и другие.

Глобальная программа иммунизации пожилых людей в эпоху COVID-19: план действий

.

Вакцина

2020

;S0264-410X(20)30885-9. doi:10.1016/j.vaccine.2020.06.082.28

Ma

S

,

Лай

X

,

Чен

Z

,

Ту

С

,

Цинь

К.

Клинические характеристики пациентов в критическом состоянии с коинфекцией SARS-CoV-2 и вирусом гриппа в Ухане, Китай

.

Int J Infect Dis

2020

;

96

:

683

87

.29

Кондо

Y

,

Миядзаки

С

,

Ямашита

Р

,

Икеда

Т.

Коинфекция SARS-CoV-2 и вирусом гриппа А

.

BMJ Case Rep

2020

;

13

:

e236812

.30

Конала

ВМ

,

Адапа

С

,

Нарамала

С

и другие.

Серия случаев пациентов с коинфекцией гриппом и COVID-19

.

J Investig Med High Impact Case Rep

2020

;

8

:

23247096204

.31

Перейти к

H

,

Ихира

Х

,

Морисита

К

и другие.

Усиленный рост вируса гриппа А при коинфекции вирусом парагриппа человека типа 2

.

Мед Микробиол Иммунол

2016

;

205

:

209

18

.32

Чжан

AJ

,

Ли

АС

,

Чан

ДЖФ

и другие.

Коинфекция коронавирусом тяжелого острого респираторного синдрома 2 и вирусом гриппа A(h2N1)pdm09 усиливает тяжесть пневмонии у золотистых сирийских хомяков

.

Clin Infect Dis

2020

20 ноября;

ciaa1747

. дои: 10.1093/cid/ciaa1747. Epub перед печатью. PMID: 33216851; PMCID: PMC7717201.33

Пебоди

R

,

Дженнад

А

,

Эллис

Дж

и другие.

Эффективность вакцины против гриппа в конце сезона у взрослых и детей в Соединенном Королевстве в 2017/18

.

2019

;

24

:

1800488

.34

Ли

N

,

Чан

ПК

,

Ю

ИТ

и другие.

Совместная циркуляция метапневмовируса человека и связанного с атипичной пневмонией коронавируса во время крупной внутрибольничной вспышки атипичной пневмонии в Гонконге

.

Дж Клин Вирол

2007

;

40

:

333

37

.35

Олдридж

R

,

Льюэр

Д

,

Катикиредди

С

и другие.

Черные, азиатские и этнические меньшинства в Англии подвергаются повышенному риску смерти от COVID-19: непрямая стандартизация данных о смертности NHS

.

Wellcome Open Res

2020

;

5

:

88

.37

Аткинс

JL

,

Масоли

JA

,

Дельгадо

Дж

, и другие. Ранее существовавшие сопутствующие заболевания, предсказывающие тяжелую форму COVID-19 у пожилых людей в когорте сообщества британского биобанка.

2020

: 2020.05.06.200.

Примечания автора

© Автор(ы) 2021.Опубликовано Oxford University Press от имени Международной эпидемиологической ассоциации.

Это статья в открытом доступе, распространяемая в соответствии с лицензией Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа цитируется правильно.

Еженедельный отчет США по эпиднадзору за гриппом

FluSurv-NET

В период с 1 октября 2021 г. по 26 марта 2022 г. сайты FluSurv-NET сообщили о 2122 лабораторно подтвержденных госпитализациях, связанных с гриппом.Общий кумулятивный показатель госпитализации составил 7,2 на 100 000 населения. Этот совокупный показатель госпитализаций выше, чем совокупный показатель госпитализаций в течение сезона, наблюдаемый на 12-й неделе сезона 2020–2021 гг. (0,7 на 100 000), но ниже, чем показатели в течение сезона, наблюдаемые на 12-й неделе в течение 4 сезонов, предшествующих пандемии COVID-19. 19 пандемии (они колебались от 52,5 до 96,1 на 100 000 в течение сезонов 2016–17–2019–20).

При изучении показателей по возрасту самый высокий уровень госпитализации на 100 000 населения был среди взрослых в возрасте 65 лет и старше (19.5). Среди взрослых в возрасте 65 лет и старше самые высокие показатели были среди взрослых в возрасте 85 лет и старше (38,9). Среди лиц в возрасте до 65 лет уровень госпитализации на 100 000 населения был самым высоким среди детей в возрасте 0–4 лет (10,3), за которыми следуют взрослые в возрасте 50–64 лет (6,7). При изучении показателей по расе и этнической принадлежности самый высокий уровень госпитализации на 100 000 населения был среди неиспаноязычных американских индейцев или коренных жителей Аляски (10,3), за которыми следуют неиспаноязычные чернокожие (8,8).

Среди 2122 госпитализаций 2013 (94.9%) были связаны с вирусом гриппа А, 96 (4,5%) с вирусом гриппа В, 4 (0,2%) с коинфекцией вируса гриппа А и вируса гриппа В и 9 (0,4%) с вирусом гриппа, для которого тип не определялся. Среди 537 госпитализаций с информацией о подтипе гриппа A 530 (98,7%) были A(h4N2) и 7 (1,3%) — A(h2N1)pdm09. По предварительным данным, из 2122 лабораторно подтвержденных госпитализаций, связанных с гриппом, 3,3% также дали положительный результат на SARS-CoV-2.

Среди 1013 госпитализированных взрослых, у которых была информация об основных заболеваниях, 93% имели по крайней мере одно сообщенное основное заболевание, наиболее часто сообщаемыми были гипертония, сердечно-сосудистые заболевания, нарушение обмена веществ и ожирение.Среди 133 госпитализированных детей, у которых была информация об основных заболеваниях, у 75,9% было хотя бы одно сообщенное основное заболевание; наиболее часто сообщаемым состоянием была астма.

Просмотр в полноэкранном режиме


Дополнительная информация по наблюдению за госпитализацией FluSurv-NET для текущего и прошлого сезонов и дополнительных возрастных групп:
Методы наблюдения |FluView Interactive: Показатели по возрасту, полу и расе/этнической принадлежности или данные о характеристиках пациентов

Данные

FluSurv-Net используются для получения национальных оценок общего числа случаев гриппа, обращений за медицинской помощью, госпитализаций и смертей.В этом сезоне CDC сообщает о предварительных совокупных оценках за сезон, которые доступны по адресу https://www.cdc.gov/flu/about/burden/preliminary-in-season-estimates.htm

.

Повышение летальности при коинфекции гриппа и SARS-CoV-2 предотвращается иммунитетом к гриппу, но не иммунитетом к SARS-CoV-2

Клетки

Клетки Vero E6 (ATCC® CRL-1586TM) и клетки почки собаки Madin-Darby (MDCK) (ATCC® CCL-34™) содержали в модифицированной Дульбекко среде Игла (DMEM) с добавлением 10% эмбриональной бычьей сыворотки (FBS), заменимых аминокислот MEM, 2 нМ L-глутамина, 100 единиц/мл пенициллина, 0.1 мг/мл стрептомицина и 12,5 ЕД/мл нистатина (Biological Industries, Израиль). Клетки культивировали при 37 °C в атмосфере 5% CO 2 и 95% воздуха.

Вирусы

Изолят SARS-CoV-2 Человеческий штамм 2019-nCoV ex China BavPat1/2020 был любезно предоставлен профессором доктором Кристианом Дростеном (Charité, Берлин) через Европейский архив вирусов – Глобальный (EVAg Ref-SKU: 026 В-03883). Вирусные запасы размножали (4 пассажа) и титровали в клетках Vero E6. Последовательность генома была депонирована в базе данных платформы GISAID EpiCoV коронавируса SARS-CoV-2 под идентификатором EPI_ISL_3838266.

Штамм IAV A/Puerto Rico/8/1934 (h2N1) (PR8) размножали путем инъекции 0,1  мл разведенного 1:100 вирусного раствора (2048 единиц гемагглютинации, HAU) в аллантоисный мешок 11-дневных эмбрионов. куриные яйца. После инкубации в течение 72 ч при 37°С было собрано ~9 мл богатой вирусом аллантоисной жидкости. Значение HAU определяли с использованием куриных эритроцитов, а титры вируса определяли с помощью анализа бляшек с использованием монослоев клеток MDCK 26 .

Ad-GFP-hACE2 (код ADV-200183) был приобретен у Vector Biosystems Inc.(Малверн, Пенсильвания, США).

Все вирусы разделяли на аликвоты и хранили при температуре -80 °C до использования.

Эксперименты на животных

Все эксперименты на животных с участием SARS-CoV-2 проводились в помещении с уровнем биобезопасности 3 (BSL3). Обращение с животными осуществлялось в соответствии с правилами, изложенными в Законе о защите животных Министерства сельского хозяйства США (USDA), и условиями, указанными в Руководстве по уходу и использованию лабораторных животных (Национальные институты здравоохранения, 2011 г.). Исследования на животных были одобрены этическим комитетом по экспериментам на животных Израильского института биологических исследований (IIBR) (номера протоколов M-29-20, M-39-20, M-40-20, M-41-20, M -36-21 и М-37-21).Самок трансгенных мышей K18-hACE2 (B6. Cg-Tg(K18-ACE2)2Prlmn/J; #034860), а также самок и самцов мышей C57BL/6J (Jackson Laboratory) (возраст 6–8 недель) содержали при температуре 20–22°С. C и относительной влажности 50 ± 10% при 12-часовом цикле свет/темнота. Животных кормили коммерческим кормом для грызунов (Koffolk Inc.) и давали водопроводную воду без ограничений. До заражения мышей содержали группами по 10 особей. Мышей случайным образом распределяли в экспериментальные группы.

Для инфекции PR8 и SARS-CoV-2 вирусы разводили в фосфатно-солевом буфере (PBS) с добавлением 2% FBS (Biological Industries, Израиль).Наркотизированных животных (кетамин 75 мг/кг и ксилазин 7,5 мг/кг в PBS) заражали внутривенно. закапывание 20 мкл (PR8: 80 БОЕ/мышь, SARS-CoV-2: 10 БОЕ/мышь).

Для заражения Ad-GFP-hACE2 25 мышам C57BL/6J внутрибрюшинно (ip) вводили 2  ​​мг моноклонального антитела (mAb) против IFNAR (рецептор интерферона-α/β) (LEINCO Technologies, Inc., Сент-Луис, Миссури, США, код I-401-100) по 0,5 мл. Через 24 часа наркотизированным мышам вводили 20 мкл Ad-GFP-hACE2.Через 3 дня мышей лечили внутривенно. с 80 БОЕ PR8, а через 2 дня мышей лечили внутривенно. с 10 5 БОЕ SARS-CoV-2 (все внутривенные введения проводились под наркозом).

Иммунизация животных

Для иммунизации против SARS-CoV-2, i.n. закапывание 2 PFU/мышь или в/м была проведена инъекция 10 3 , 10 4 , 10 5 или 10 6  БОЕ/мышь SARS-CoV-2. Для иммунизации против IAV мышей вакцинировали i.м. с 10 6  БОЕ/мышь. Иммунизированных мышей заражали через 30 дней после иммунизации.

Определение вирусной нагрузки в органах

Вирусную нагрузку определяли на 2 и 4 dpi или 4 и 6 dpi. В коинфицированной группе вирусная нагрузка определялась на 4 и 6 dpi (2 и 4 dpi). Каждая группа включала по 10 мышей, за исключением экспериментов по исследованию мозга при 2 dpSi, в которых участвовала группа из 4 животных K18-hACE2. Легкие, NT и головной мозг собирали и хранили при температуре -80 °C до дальнейшей обработки.Органы обрабатывали для титрования в 1,5 мл охлажденного льдом PBS. Ткани гомогенизировали (ULTRA-TURAX® IKA R104) в течение 30 с в 1,5 мл охлажденного льдом PBS с последующим центрифугированием (270 g , 10 мин, 4°C) и сбором супернатантов для титрования вируса. Обработанные гомогенаты тканей разделяли для немедленной экстракции РНК для определения РНК IAV и анализа экспрессии генов или хранили при температуре -80 °C до дальнейшей обработки для титрования вируса (используется для анализа БОЕ SARS-CoV-2).

Вирусная нагрузка SARS-CoV-2 определялась с помощью анализа БОЕ 27 .Серийные разведения извлеченных гомогенатов органов от мышей, инфицированных SARS-CoV-2 или коинфицированных IAV и SARS-CoV-2, готовили в инфекционной среде (MEM, содержащей 2% FBS) и использовали для заражения монослоев Vero E6 в двух повторностях (200 мкл/мкл). хорошо). Планшеты инкубировали в течение 1 ч при 37°С, чтобы обеспечить адсорбцию вируса. Затем в каждую лунку добавляли 2 мл покрытия (MEM, содержащего 2% FBS и 0,4% трагаканта; Merck, Израиль) и планшеты инкубировали при 37 °C в атмосфере 5% CO 2 в течение 48 часов.Затем среду отсасывали, клетки фиксировали и окрашивали 1 мл/лунка раствором кристаллического фиолетового (Biological Industries, Израиль). Определяли количество бляшек на лунку и рассчитывали титр БОЕ SARS-CoV-2.

Уровень РНК ВГА определяли с помощью ОТ-ПЦР в реальном времени (см. ниже).

Количественная ОТ-ПЦР в режиме реального времени

РНК экстрагировали с помощью мини-набора вирусной РНК (Qiagen, Германия) в соответствии с инструкциями производителя. РНК IAV загружается в легкие и N.Т. определяли с помощью количественной ОТ-ПЦР (qRT-PCR). ОТ-ПЦР в реальном времени проводили с помощью набора SensiFAST™ Probe Lo-ROX One-Step Kit (Bioline, 78005) и анализировали с помощью системы ПЦР в реальном времени 7500 (Applied Biosystems). Эквивалент PFU на орган (pfuE/орган) рассчитывали по стандартной кривой, полученной из штаммов вируса. Праймеры и зонды для количественной ПЦР (кПЦР), использованные для обнаружения PR8, представляли собой PR8-PA-FW: CGGTCCAAATTCCTGCTGA; PR8-PA-RW: CATTGGGTTTCCTTCCATCCA; и PR8-PA-зонд: CCAAGTCATGAAGGAGAGGGAATACCGCT.

Суммарная РНК, выделенная из легких мышей, инфицированных IAV или SARS-CoV-2 или коинфицированных при 2 dpSi и 4 dpIi, использовалась для измерения дифференциальной экспрессии генов с помощью qRT-PCR с использованием соответствующих специфических праймеров, напечатанных на 96-луночных планшетах (Индивидуальные планшеты TaqMan Array, Applied Biosystems TM ), как описано ранее 28 . Вкратце, 1 мкг кДНК синтезировали из РНК с использованием набора для синтеза кДНК Verso (Thermo Fisher Scientific, Уолтем, Массачусетс, США) в соответствии с инструкциями производителя.Образцы подвергали количественной ПЦР с TaqMan® Fast Advanced Master Mix (Система ПЦР в реальном времени 7500, Applied Biosystems, Thermo Fisher Scientific). Ген домашнего хозяйства GAPDH использовали для нормализации кратности изменения каждого гена по сравнению с ложно инфицированным контролем в тот же момент времени, что рассчитывали как ∆∆CT.

Гистопатология

Для общей гистопатологической оценки гематоксилина и эозина (H&E) 6 мышей dpIi (4 dpSi) ( n  = 5 на группу) были анестезированы, а затем транскардиально перфузированы PBS, а затем 4% параформальдегидом.Легкие и головной мозг выделяли и фиксировали в 4% параформальдегиде при комнатной температуре в течение 2 недель. Фиксированные ткани были отправлены в «Patho-Logica» (Реховот, Израиль) для обработки и анализа. Были получены серийные корональные срезы толщиной 4 мкм, а выбранные срезы были окрашены H&E для исследования под световой микроскопией. Снимки были сделаны с использованием микроскопа Olympus (BX60, серийный номер 7D04032), оснащенного камерой для микроскопа (Olympus DP73, серийный номер OH05504) при увеличениях объектива в 4 и 10 раз.

Тест нейтрализации уменьшения зубного налета

Уровни антител, нейтрализующих SARS-CoV-2, определяли с помощью теста нейтрализации уменьшения зубного налета (PRNT) 27 . Вкратце, все сыворотки инактивировали нагреванием при 60 °C в течение 30 минут, затем серийно разводили в два раза в 400 мкл инфекционной среды, смешивали с 400 мкл 300 БОЕ/мл SARS-CoV-2 и инкубировали при 37 °C в атмосфере. 5% CO 2 в течение 1 ч. Затем 200 мкл каждой смеси сыворотки/вируса дважды добавляли к монослоям клеток Vero E6 и клетки инкубировали в течение 1 ч при 37°С.В качестве контроля использовали смесь вирусов без сыворотки. В каждую лунку добавляли два миллилитра верхнего слоя и планшеты инкубировали при 37°C в атмосфере 5% CO 2 в течение 48 часов. Затем среду отсасывали, клетки фиксировали и окрашивали 1 мл/лунка раствором кристаллического фиолетового. Определяли количество бляшек на лунку и рассчитывали разведение сыворотки, которое нейтрализовало 50% вирионов (NT 50 ), используя программное обеспечение Prism (GraphPad Software Inc.).

Анализы ELISpot

Для обнаружения клеток, секретирующих IFNγ, у мышей, иммунизированных SARS-CoV-2 или IAV, мышей умерщвляли через 7 или 25 дней после иммунизации соответственно.Селезенки диссоциировали в С-пробирках GentleMACS (Miltenyi Biotec), фильтровали, разделяли на Ficoll-Paque (GE) и промывали средой. Затем по 4 × 10 5 клеток из каждого образца высевали в 96-луночные планшеты ELISpot в двух повторностях в присутствии пептидов, представляющих иммунодоминантные эпитопы H-2Kb, в конечной концентрации 2 мкг/мл и инкубировали при 37 °С в течение 24 часов. час Наивные образцы состояли из пулов от 2 мышей. Частоту IFN-γ-секретирующих клеток определяли с помощью набора Mouse IFN-γ Single-Color ELISpot (Cellular Technology Limited, Германия) в соответствии с инструкциями производителя.Частоту клеток, секретирующих цитокины, определяли количественно с помощью ридера ImmunoSpot S6 Ultimate и анализировали с помощью программного обеспечения ImmunoSpot (Cellular Technology Limited, Германия). Для стимуляции использовали следующие Db-рестриктированные антигены:

Пептид, производный от PR8 гриппа: NP366–374 ASNENMETM

Пептид, производный от SARS-CoV-2: Spike 539-546 VNFNFNGL

с добавлением среды использовали в качестве отрицательного контроля.

Иммуноферментный анализ

Планшеты Nunc MaxiSorp для иммуноферментного анализа (ELISA) (Thermo Fisher Scientific, США) покрывали вирусом PR8 (цельный вирус, очищенный от сахарозы) в карбонатно-бикарбонатном растворе (Sigma, Израиль, кат.C3041) при 4 °C в течение ночи. Планшеты блокировали буфером TSTA (50 мМ Tris, pH 7,6 + 140 мМ NaCl + 0,05% Tween 20 + + 2% BSA) в течение 60 минут при 37 °C. После блокирования и промывания буфером PBST (PBS + 0,05% Tween 20) планшеты инкубировали с сывороткой наивных или преиммунных мышей PR8, разбавленной от 1:400 до 1:52800, в течение 1 часа при 37 °C. После промывания в качестве вторичного антитела использовали конъюгированный со щелочной фосфатазой антимышиный IgG (разведение 1:1000) (Sigma, Израиль, кат. A5153). Субстрат п-нитрофенилфосфат (Sigma, Израиль, кат.N2770) добавляли после промывки и измеряли оптическую плотность (считыватель микропланшетов SpectraMax 190, Molecular Devices, Саннивейл, Калифорния, оптическая плотность при 405 нм) через 60 мин инкубации при комнатной температуре. Значения анти-PR8 IgG определяли путем вычитания удвоенного значения контроля (сыворотка от неинфицированных мышей) из исследуемого образца.

Истощение Т-клеток in vivo

Крысиные антитела против мышиных CD4 (клон GK1.5, ATCC TIB-207) и CD8 (клон 2.43, ATCC TIB-210) были получены и очищены в нашей лаборатории.Анти-CD4 или анти-CD8 антитела вводили (200 мкг на внутрибрюшинную инъекцию) мышам K18-hACE2 за 1 день (-1 день) до вирусной инфекции и каждые 2-3 дня в течение первых 12 дней эксперимента. Истощение CD4 или CD8 было подтверждено с помощью проточной цитометрии (дополнительная рис. 7).

Проточная цитометрия

Спленоциты собирали, как описано для анализа ELISpot. Клетки окрашивали красителем Aqua Live/Dead Cell Stain (Thermo Fisher, L34966), блокировали антителом против CD16/32 FcγR в течение 15 минут и затем окрашивали флуоресцентно меченными антителами в течение 30 минут.Использовали следующие антитела от e-Bioscience (Thermo Fisher Scientific): PE анти-CD3ε (клон 145-2C11, разведение 1:200), Alexa Fluor 700 анти-CD4 (клон RM4-5, разведение 1:800) и APC анти-CD8 (клон 56–6,7, разведение 1:800). Все процедуры промывки выполняли с использованием проточного буфера, состоящего из PBS, 2% FBS и 0,05% NaN 3 . Образцы собирали с помощью проточного цитометра Fortessa (BD Biosciences) и анализировали с помощью программного обеспечения FlowJo (TreeStar).

Пассивная иммунизация

Самок мышей K18-hACE2 в возрасте от шести до восьми недель иммунизировали против IAV с помощью i.м. инъекция PR8 (10 6  БОЕ/мышь). Четыре недели спустя сыворотки собирали и объединяли, и определяли уровни антител IgG против PR8 в сыворотках против IAV. Сыворотки вводили (внутрибрюшинно 200 мкл/мышь) за 1 день до заражения IAV. Мышей коинфицировали, как описано выше.

Сводка отчета

Дополнительная информация о дизайне исследования доступна в Кратком отчете об исследовании природы, связанном с этой статьей.

Сезонный грипп во время пандемии COVID-19 в Бангладеш

Реферат

Введение

Во время пандемии нового коронавирусного инфекционного заболевания (COVID-19) в 2020 году ограниченные данные из нескольких стран свидетельствуют о снижении циркуляции вирусов сезонного гриппа.Это было связано с мерами по смягчению последствий, принятыми сообществом для борьбы с пандемией тяжелого острого респираторного синдрома коронавируса 2 (SARS-CoV-2). Мы использовали данные дозорного эпиднадзора, чтобы выявить изменения в сезоне гриппа 2020 г. по сравнению с предыдущими сезонами в Бангладеш.

Методы

Мы использовали данные больничного эпиднадзора за гриппом (HBIS) в Бангладеш, которые собираются круглый год и представляют собой репрезентативные для населения данные о тяжелых острых респираторных инфекциях (ТОРИ) для всех возрастных групп из семи государственных и двух частных больниц третичного уровня за 2016 г. до 2019 года.Мы применили метод движущейся эпидемии (MEM) с использованием языка R (v4.0.3) и веб-приложений MEM (v2.14) к еженедельно собираемым показателям положительных на грипп случаев ТОРИ, чтобы оценить среднюю сезонную кривую гриппа и установить эпидемические пороги.

Результаты

Средний сезон 2016–2019 гг. начался на 18-й неделе эпидемии (95% ДИ: 15–25) и продолжался 12,5 недель (95% ДИ: 12–14 недель) до 30,5 недели. Сезон гриппа 2020 года начался на 36-й неделе эпидемии и закончился на 41-й неделе эпидемии, продлившись всего пять недель.Таким образом, эпидемия гриппа началась на 18 недель позже, была на 7,5 недель короче и была менее интенсивной, чем в среднем за четыре предыдущих года. Сезон гриппа 2020 года начался на той же неделе, когда были остановлены меры по борьбе с COVID-19, и через 13 недель после того, как меры были ослаблены.

Заключение

Наши результаты показывают, что циркуляция сезонного гриппа в Бангладеш в 2020 г. была отсроченной и менее интенсивной, чем в предыдущие годы. Меры по смягчению воздействия на местном уровне, возможно, способствовали снижению передачи сезонного гриппа.Эти результаты дополняют ограниченный, но растущий объем данных о том, что в 2020 году сезоны гриппа изменились во всем мире.

Образец цитирования: Ахтар З., Чоудхури Ф., Рахман М., Гош П.К., Ахмед М.К., Ислам М.А. и др. (2021) Сезонный грипп во время пандемии COVID-19 в Бангладеш. ПЛОС ОДИН 16(8): е0255646. https://doi.org/10.1371/journal.pone.0255646

Редактор: Мухаммад Адриш, BronxCare Health System, филиал Медицинской школы Икана на горе Синай, штат Нью-Йорк, США, США

Получено: 28 марта 2021 г .; Принято: 14 июля 2021 г .; Опубликовано: 3 августа 2021 г.

Эта статья находится в открытом доступе, свободна от каких-либо авторских прав и может свободно воспроизводиться, распространяться, передаваться, изменяться, дополняться или иным образом использоваться кем угодно в любых законных целях.Работа доступна в качестве общественного достояния Creative Commons CC0.

Доступность данных: В соответствии с институциональной политикой данных icddr,b (Международный центр исследований диарейных заболеваний, Бангладеш), только сводные данные могут быть опубликованы или доступны для общественности. Для защиты прав интеллектуальной собственности на первичные данные icddr,b не может делать первичные данные общедоступными. Однако по запросу Комитет по доступу к институциональным данным icddr,b может предоставить доступ к первичным данным любому лицу после изучения характера и потенциального использования данных.Запросы на данные можно направлять: г-же Армане Ахмед, руководителю Управления исследований, icddr,b, Дакка, Бангладеш, электронная почта: [email protected], телефон: +88 02

01-10 (доб. 3200).

Финансирование: Этот стационарный эпиднадзор за гриппом финансировался Отделом гриппа Центров по контролю и профилактике заболеваний (CDC), Атланта, в соответствии с соглашением о сотрудничестве (6 NU51IP000852-05-01). icddr,b выражает благодарность правительствам Бангладеш, Канады, Швеции и Великобритании за предоставление основной/неограниченной поддержки.У спонсоров не было конфликта интересов с содержанием рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

В начале 2020 г. Соединенные Штаты и несколько азиатских стран [1–4] в Северном полушарии сообщили о резком снижении числа случаев сезонного гриппа, который обычно наблюдается в этих странах в период с октября по апрель. В Южном полушарии Австралия, Чили, Южная Африка и Новая Зеландия сообщали об аналогичных наблюдениях в течение сезона гриппа, который в этих странах обычно приходится на период с апреля по сентябрь [5–7].Предыдущие исследования показали, что снижение активности вируса сезонного гриппа могло быть связано с широко распространенными мерами по смягчению последствий, принятыми в обществе для борьбы с пандемией коронавируса тяжелого острого респираторного синдрома 2 (SARS-CoV-2) [1, 5, 7]. Дальнейшее изучение сезонности гриппа в контексте вмешательств в отношении SARS-CoV-2 может улучшить наше понимание того, как эти вмешательства могут повлиять на передачу сезонного гриппа.

Бангладеш — тропическая страна в Северном полушарии, и ее ежегодная эпидемия сезонного гриппа обычно происходит в сезон дождей, с мая по сентябрь, что отражает характерную для Южного полушария картину [8].Вирус SARS-CoV-2 появился в Бангладеш на эпидемиологической (эпи) неделе 11 2020 г. (08 марта 2020 г.), а меры по борьбе с пандемией были инициированы 16 марта 2020 г. (эпи неделя 12) путем закрытия всех образовательных учреждений и 3 марта 2020 г. 26 сентября 2020 г. (эпинеделя 13) путем приостановки всех политических, религиозных, социальных и культурных собраний, включая государственные публичные программы и мероприятия; закрытие транспортных услуг, включая внутренние и международные рейсы, и закрытие всех государственных и частных офисов, кроме больниц, кухонных рынков, аптек и служб экстренной помощи [9].Социальное дистанцирование, ношение масок для лица и соблюдение гигиены рук стали обязательными после 30 мая 2020 г. (с 23-й недели эпидемии) [10]. Применение некоторых мер было ослаблено после 30 мая 2020 г. (с 23-й недели эпидемии), когда возобновилось движение общественного транспорта (наземного и воздушного), а торговые центры/сферы услуг открылись в ограниченном масштабе [10]. Все меры контроля применялись до 31 августа 2020 г. (36-я эпинеделя) [11].

Мы использовали данные дозорного эпиднадзора, чтобы выявить изменения в сезоне гриппа 2020 г. по сравнению с предыдущими сезонами в Бангладеш.

Методы

Система эпиднадзора за гриппом на базе больниц (HBIS) в Бангладеш обеспечивает получение круглогодичных репрезентативных данных о населении для всех возрастных групп из семи государственных и двух частных больниц третичного уровня благодаря сотрудничеству между Институтом эпидемиологии, контроля заболеваний и исследований (IEDCR) правительства Бангладеш, Международного центра исследований диарейных заболеваний, Бангладеш (icddr,b) и Центров США по контролю и профилактике заболеваний (US CDC) [12].Участвующие больницы:

Эта система эпиднадзора была описана в другом месте, и ее результаты включают количество случаев тяжелой острой респираторной инфекции (ТОРИ) (определяемых как лихорадка в анамнезе или измеренная температура ≥38°C с кашлем, начавшаяся в течение предшествующих 10 дней и госпитализации) каждую неделю и процент тех случаев, которые дали положительный результат на вирусы гриппа с помощью полимеразной цепной реакции с обратной транскрипцией в реальном времени (рОТ-ПЦР) [12, 13]. Протокол эпиднадзора за гриппом в больницах Бангладеш был рассмотрен и одобрен IRB на icddr,b.Кроме того, Управление по защите исследований человека Центра по контролю и профилактике заболеваний рассмотрело и одобрило дальнейшее использование icddr,b IRB. § Участники или законные опекуны предоставили письменное информированное согласие до того, как данные и сбор биологических образцов, а также полностью анонимные данные были доступны для анализа

Мы использовали язык R (версия 4.0.3) и веб-приложения MEM (версия 2.14) для создания средней сезонной кривой гриппа с использованием данных о положительных на грипп случаях ТОРИ, еженедельно собираемых HBIS с января 2016 г. по декабрь 2019 г. [14].Вкратце, с помощью этого программного обеспечения были построены эпидемические кривые процента случаев ТОРИ с положительным результатом на грипп для каждого сезона данных эпиднадзора в Бангладеш за период с 2016 по 2019 год. Затем программа MEM совместила кривые для получения средней кривой и установила пороговые значения для определения предэпидемического, эпидемического и постэпидемического периодов, а также пороговые значения средней, высокой и очень высокой интенсивности для активности сезонного гриппа [14, 15]. ]. Для определения эпидемического порога программное обеспечение MEM вычисляет верхнюю границу 95-процентного доверительного интервала вокруг 30 самых высоких недельных значений до эпидемического периода, а пороги интенсивности рассчитываются таким образом, чтобы примерно 60 % сезонов превышали порог средней интенсивности10. % преодолеет верхний порог, а 2.5% преодолеют очень высокий порог. Модель оценивает чувствительность (правильно определяя эпидемический период выше эпидемического порога) и специфичность (правильно определяя неэпидемический период ниже эпидемического порога) модели, а также вычисляет 95% доверительные интервалы для средней даты начала и продолжительности сезона. 14]. Мы применили средние сезонные пороговые значения, чтобы определить начало, конец и интенсивность сезона гриппа 2020 года.

Результаты

С 2016 по 2019 год HBIS регистрировал от 2714 до 5001 случаев ТОРИ в год; От 15% до 26% из них были положительными на грипп.В HBIS были включены случаи за каждый месяц 2020 г., хотя их общее количество составило 2361, что меньше, чем в предыдущие годы, при этом в среднем за год положительный результат на грипп составил 8% (рис. 1).

Программное обеспечение MEM построило кривые сезонной эпидемии гриппа для 2016–2020 гг. (рис. 2) и среднюю кривую для сезонов 2016–2019 гг. (рис. 3). На основе средней кривой MEM определила пороговые значения для начала сезона сезонного гриппа (21% случаев ТОРИ с положительным результатом на грипп), конца сезона (27% положительных результатов) и сезонной интенсивности (средний: 47%, высокий: 60%). , очень высокий: 67% положительных результатов) (рис. 1 и 2).Чувствительность этой модели составила 78% при специфичности 96%; то есть для каждого сезона, использованного для построения модели (2016–2019 гг.), 78% недель выше эпидемического порога приходились на прогнозируемый моделью эпидемический сезон, а 96% недель ниже эпидемического порога приходились на прогнозируемый моделью не- эпидемический порог. сезон эпидемии.

Сезон 2019 г. был наиболее интенсивным (пик 72% положительных результатов), в то время как сезоны 2016 и 2018 гг. превысили порог высокой интенсивности (пики 61 и 65% положительных результатов соответственно).Сезон 2017 г. превысил порог средней интенсивности (пик при 57% положительных результатов), а сезон 2020 г. превысил порог «начала сезона», но не достиг порога средней интенсивности (пик при 43% положительных результатов, рис. 2). Сезоны 2016–2019 гг. 91 673 начались на 21 неделе 91 674, 91 673 27 91 674, 91 673 30 и 23 соответственно 91 674, а средний сезон начался на 18-й неделе эпидемии (95% ДИ: 15–25) и длился 12,5 недель (95% ДИ: 12–14 недель) до 30,5 недели (рис. 2 и 3). Сезон гриппа 2020 г. начался на 36-й неделе эпидемии (при исходном эпидемическом пороге 21%) и закончился на 41-й неделе эпидемии (при постэпидемическом пороге 27%), таким образом, продлившись всего 5 недель (рис. 4).Сезон гриппа 2020 года начался на той же неделе, когда были остановлены меры по борьбе с COVID-19, и через 13 недель после того, как меры были смягчены.

Обсуждение

В Бангладеш в течение 2020 г. осуществлялся эпиднадзор за гриппом. Данные показали, что начало эпидемии гриппа в 2020 г. было отложено на 18 недель по сравнению со средним показателем за четыре предыдущих сезона, и она длилась менее половины (5 недель против 12,5 недель) продолжительности предыдущих сезонов. Аналогичное заметное снижение циркуляции гриппа также было зарегистрировано в Сингапуре, Таиланде, Китае, Тайване, Австралии, Южной Африке и Чили во время пандемии COVID-19; в этих отчетах в качестве потенциальной причины упоминается побочный эффект мер по борьбе с пандемией [1–6].

Начало сезона гриппа 2020 г. началось после завершения большинства мер по смягчению последствий SARS-CoV-2. Меры по контролю общественного здравоохранения, предпринятые для борьбы с пандемией COVID-19 в Бангладеш, были предприняты за пять недель до среднего начала сезонов гриппа за предыдущие четыре года и, возможно, способствовали задержке эпидемии сезонного гриппа в стране в 2020 году. В конечном итоге меры по борьбе с пандемией применялись до 36-й недели эпидемии, но после 23-й недели эпидемии они были ослаблены [11].Сезон гриппа 2020 г. начался на 36-й неделе эпидемии. Поскольку и вирусы SARS-CoV-2, и вирусы гриппа имеют сходные способы передачи через контактный, воздушно-капельный и воздушно-капельный пути [16], усилия по борьбе с пандемией могли также ограничить передачу вируса гриппа, менее заразный вирус в пик сезона в Бангладеш. Поэтому вполне вероятно, что усилия по смягчению последствий SARS-CoV-2 способствовали задержке сезона гриппа 2020 года в Бангладеш.

Сильные стороны этого отчета включают использование данных надежной системы эпиднадзора, действовавшей на протяжении всей пандемии COVID-19 в 2020 г., а также использование общепризнанного метода моделирования для определения сроков и пороговых значений эпидемии сезонного гриппа [7].Важным ограничением является снижение числа случаев ТОРИ, выявленных эпиднадзором в 2020 г., на 42% по сравнению со средним показателем за четыре предыдущих сезона. Это снижение могло быть вызвано снижением частоты обращений за медицинской помощью, незадокументированными изменениями в выборке пациентов с ТОРИ, ограниченным наличием средств индивидуальной защиты и реагентов для отбора проб и тестирования, а также логистическими проблемами операций эпиднадзора. Все эти проблемы, возможно, были связаны с пандемией SARS-CoV-2 и способствовали тому, что меньшее количество пациентов с ТОРИ обращались и проверялись на грипп, а также снижали точность связи с гриппом.Кроме того, представленные здесь данные включают только наблюдения в больницах. Менее тяжелые случаи гриппа — те, которые не требовали госпитализации — не учитывались в этом анализе, и вполне возможно, что тенденции госпитализации в стационар или обращения за медицинской помощью могли измениться из-за пандемии COVID-19 и смешать показатели положительных результатов гриппа. Другое ограничение заключается в том, что мы использовали данные только за четыре сезона для построения средней эпидемической кривой; учитывая значительную изменчивость сезонности гриппа, больше данных позволит получить более точные даты начала и окончания среднего сезона.

В заключение, наши результаты показывают, что циркуляция сезонного гриппа в Бангладеш была отсроченной и менее интенсивной в 2020 г. по сравнению с предыдущими годами. Меры по смягчению воздействия на местном уровне, возможно, способствовали снижению передачи сезонного гриппа.

Каталожные номера

  1. 1. Soo RJJ, Chiew CJ, Ma S, Pung R, Lee V. Снижение заболеваемости гриппом благодаря мерам контроля COVID-19, Сингапур. Возникающие инфекционные заболевания. 2020; 26(8):1933. пмид:32339092
  2. 2.Сунтронвонг Н., Тонгпан И., Чучаона В., Буди Лестари Ф., Вичайваттана П., Йорсенг Р. и др. Влияние мер общественного здравоохранения в связи с COVID-19 на заболеваемость гриппом в Таиланде. Патогены и глобальное здоровье. 2020: 1–3. пмид:32521210
  3. 3. Lei H, Xu M, Wang X, Xie Y, Du X, Chen T и другие. Немедикаментозные вмешательства, используемые для борьбы с COVID-19, снизили передачу сезонного гриппа в Китае. Журнал инфекционных болезней. 2020; 222(11):1780–3. пмид:328

  4. 4.Куо С.К., Ши С.М., Чиен Л.Х., Сюн КА. Сопутствующее влияние мер контроля COVID-19 на активность гриппа, Тайвань. Возникающие инфекционные заболевания. 2020;26(8):1928. пмид:32339091
  5. 5. Олсен С.Дж., Аззиз-Баумгартнер Э., Бадд А.П., Браммер Л., Салливан С., Пинеда Р.Ф. и др. Снижение активности гриппа во время пандемии covid-19 — США, Австралия, Чили и Южная Африка, 2020 г. Еженедельный отчет о заболеваемости и смертности. 2020;69(37):1305. пмид:32

    5

  6. 6.Салливан С.Г., Карлсон С., Ченг А.С., Чилвер М.Б., Дуайер Д.Е., Ирвин М. и др. Куда делся весь грипп? Влияние COVID-19 на циркуляцию гриппа и других респираторных вирусов, Австралия, март-сентябрь 2020 г. Евронадзор. 2020;25(47):2001847.
  7. 7. Хуан К.С., Вуд Т., Джелли Л., Дженнингс Т., Джеффрис С., Дэниэллс К. и др. Влияние немедикаментозных вмешательств в связи с COVID-19 на грипп и другие респираторные вирусные инфекции в Новой Зеландии.Связь с природой. 2021;12(1):1–7. пмид:333

  8. 8. Заман Р., Аламгир А.С.М., Рахман М., Аззиз-Баумгартнер Э., Герли Э., Шаркер Ю. и др. Грипп у амбулаторных пациентов с ГПЗ в рамках национального больничного эпиднадзора, Бангладеш, 2007–2008 гг. ПлоС один. 2009;4:e8452. пмид:20041114
  9. 9. Организация ВХ. Коронавирусное заболевание (COVID-2019) Отчет о ситуации в Бангладеш № 4, 2020 г. [обновлено 24 марта 2020 г. Доступно по адресу: https://www.who.int/docs/default-source/searo/bangladesh/covid-19-who-bangladesh-situation-reports/who-ban-covid-19-sitrep-04.pdf?sfvrsn=69b6d931_8.
  10. 10. Организация ВХ. Коронавирусное заболевание (COVID-2019) Отчет о ситуации в Бангладеш № 14, 2020 г. [обновлено 06.01.2020. Доступно по адресу: https://www.who.int/docs/default-source/searo/bangladesh/covid-19-who-bangladesh-situation-reports/who-ban-covid-19-sitrep-14-20200601.pdf ?sfvrsn=657b0f1b_4.
  11. 11. Организация ВХ. ВОЗ определение случая COVID-19. Всемирная организация здоровья; 2020.
  12. 12. Заман Р.У., Аламгир А., Рахман М., Аззиз-Баумгартнер Э., Герли Э.С., Шаркер МЕЙ и др.Грипп у амбулаторных пациентов с ГПЗ в рамках национального больничного эпиднадзора, Бангладеш, 2007–2008 гг. ПлоС один. 2009;4(12):e8452. пмид:20041114
  13. 13. Ахмед М., Алим М.А., Рогуски К., Абедин Дж., Ислам А., Алам К.Ф. и др. Оценки смертности от сезонного гриппа в Бангладеш, 2010–2012 гг. Грипп и другие респираторные вирусы. 2018;12(1):65–71. пмид:274
  14. 14. Vega T, Lozano JE, Meerhoff T, Snacken R, Mott J, Ortiz de Lejarazu R, et al.Эпиднадзор за гриппом в Европе: установление эпидемических порогов методом движущейся эпидемии. Грипп и другие респираторные вирусы. 2013;7(4):546–58. пмид:228

  15. 15. Vega T, Lozano JE, Meerhoff T, Snacken R, Beauté J, Jorgensen P, et al. Надзор за гриппом в Европе: сравнение уровней интенсивности, рассчитанных с использованием метода движущейся эпидемии. Грипп и другие респираторные вирусы. 2015;9(5):234–46. пмид:26031655
  16. 16. Куадрадо-Паян Э., Монтагуд-Маррахи Э., Торрес-Элорса М., Бодро М., Бласко М., Поч Э. и др.Коинфекция SARS-CoV-2 и вируса гриппа. Ланцет (Лондон, Англия). 2020;395(10236):e84. пмид:32423586
.

Добавить комментарий

Ваш адрес email не будет опубликован.