Как готовится к фгс желудка: Подготовка к гастроскопии желудка с утра и во второй половине дня

Содержание

Подготовка к ФГДС

Минимум за 2 дня до проведения процедуры постараться не есть острой еды, семечек, орехов и шоколада, не употреблять алкогольные напитки.

Отказ от курения хотя бы за день до ЭГДС.

Последний прием пищи накануне исследования не позднее 18.00. Блюда должны быть из легко усваиваемых продуктов — каша, бульон с курицей и кусочком хлеба белого, рыба, творожный пудинг, запеканка, омлет.

После ужина до сна воду можно пить в любом количестве, если появилось чувство голода можно выпить 1\2 стакана кефира или йогурта.

В день проведения исследования

  • Процедура проводится до 12.00. Полный отказ от еды и питья.
  • Исследование проводится после 12.00. Можно выпить 1\2 стакана чая.
  • ЭФГДС запланировано во второй половине дня (после 15.00). Завтрак не позднее 7.00 — можно съесть творожок, кусочек белого хлеба с маслом, выпить стакан чая. Допустимо выпить небольшое количество воды за 4 часа до начала процедуры.

Рекомендации для отдельных групп пациентов

Пациенты с установленным диагнозом — злокачественное новообразование желудка, либо с оперированным желудком.

  • за 24 часа до исследования принимать пищу легко усвояемую и максимально измельченную
  • последний прием пищи за 12-16 часов до исследования
  • утром в день исследования ничего не пить и не есть, независимо от времени процедуры.

Пациенты с сахарным диабетом.

  • эзофагогастродуаденоскопию проводят под четким контролем эндокринолога
  • перед процедурой воздержаться от инъекций инсулина

Как правило, этим пациентам делают процедуру строго в первую очередь.

От приема каких лекарственных препаратов лучше отказаться перед ЭФГДС?

  • За 7-14 дней, по возможности, отменить прием ингибиторов протонной помпы (омепрозол), препаратов висмута (де-нол), антибиотиков, так как они могут повлиять на результаты теста на хеликобактер пилори, сделав их ложноотрицательным.

Отменить данные препараты:

  • За 1-2 дня до исследования целесообразно отменить кроверазжижающие препараты.
  • В день исследования воздержаться от приема лекарственных средств в виде капсул или таблеток, чтобы ничего не помешало тщательному обследованию.

О чем необходимо предупредить врача перед проведением ЭФГДС?

  • Об отклонениях в клиническом анализе крови. Необходимо принести его врачу перед исследованием.
  • О сердечно-сосудистых заболеваниях.

Подготовка к ФГДС: несколько важных рекомендаций

ФГДС – это эндоскопическое вмешательство аппаратом – гастроскопом. Современные аппараты выполнены по последнему слову техники. Они более тонкие, гибкие. Благодаря этому пациенты легче переносят неприятную процедуру. Врачам для постановки правильного диагноза, а также для выполнения лечебных манипуляций стало намного удобнее.

Как проводится?

Пациент ложится на левый бок, при помощи глотательных движений вводят гастродуоденоскоп в пищевод через рот. Затем его проталкивают при помощи глотательных движений, вводят гибкий зонд гастроскопа в пищевод, а затем его проталкивают в желудок и двенадцатиперстную кишку.

Благодаря этому исследованию возможна визуальная оценка состояния слизистых оболочек органов. Во время процедуры выявляются язвы, эрозии, воспаления слизистой, а также полипы и опухоли. Допускается забор для гистологического исследования биологического материала.

Процедуру эту можно делать как в стационарных условиях, так и амбулаторно.

Достоинства процедуры

Существует целый ряд преимуществ, которые дает ФГДС:

  • появляется возможность определить причину болезненной симптоматики;
  • рассмотреть конкретные отделы ЖКТ, а также процессы, происходящие в них;
  • выполняется остановка кровотечения (язвенного) при помощи наложения специальных швов или тампонирования;
  • забор тканей для гистологического исследования;
  • прицельно, на места повреждения слизистой, вводятся специальные лекарства;
  • иногда требуется удаление инородных тел, а также полипов и конкрементов из панкреатического протока двенадцатиперстной кишки.

Все это можно выполнить, благодаря ФГДС:

  • устранить сужения, различные препятствия на входе в двенадцатиперстную кишку желчного протока;
  • избавиться от сужений пищевода;
  • провести PH-метрию (кислотность желудка).

Выполнение этой процедуры при имеющихся показаниях допускается для любого возраста.

Важна в ФГДС подготовка к обследованию. Этот аспект очень актуален, так как при неправильном ее проведении врач просто не сможет выполнить необходимые манипуляции. Пациент должен четко соблюдать все необходимые рекомендации. Как правило, перед исследованием проводится беседа о важности в ФГДС подготовки к процедуре.

Показания, при которых необходимо проведение ФГДС

Такая процедура назначается в следующих случаях:

  • не исчезающие самостоятельно боли в животе;
  • явления диспепсии;
  • трудности с процессом глотания из-за проблем в пищеводе;
  • анемия неизвестной этиологии, особенно в случаях, когда проведены различные исследования, но причина не выявлена;
  • резкое похудение за маленький срок;
  • осмотр слизистых ЖКТ в динамике лечения;
  • исключение онкологических патологий.

Противопоказания

Существуют определенные ситуации, при которых проводить исследование не рекомендуется:

  1. Если пациент не согласен на проведение манипуляции (перед ФГДС подписывается соглашение — без этой подписи врач не может проводить исследование).
  2. При ФГДС желудка, подготовка к процедуре обязательна. Если человек не успел выполнить перед манипуляцией все рекомендации, то ФГДС отменяется.
  3. Больным, только что перенесшим инфаркт миокарда, находящимся в гипертоническом кризе – не рекомендуется ФГДС.
  4. Если у человека есть нарушения в процессах свертывания крови.
  5. При ожогах, рубцах, деформациях пищевода.
  6. Аневризма аорты.
  7. Аллергические реакции на анестезирующие препараты, тяжелое течение бронхиальной астмы.
  8. Если у пациента имеется расстройство психики в острой стадии.
  9. Тяжелое состояние больного, не позволяющее провести подготовку к ФГДС желудка.

Особенности подготовки

Как и к любому серьезному исследованию, к этой процедуре необходимо относиться ответственно. Если не соблюдать все необходимые условия перед манипуляцией, то врач просто не сможет выполнить свою работу, а значит – помочь пациенту. Приведем для подготовки к ФГДС желудка несколько важных рекомендаций, которые пациент в своих же интересах должен учитывать:

  1. Процедура проводится натощак. Принимать пищу можно за восемь часов до манипуляции. При проблемах же с пищеварением — все 12-13 часов.
  2. Если пациенту назначено обследование утром, ужинать ему вечером необходимо за три-четыре часа до сна. Иными словами, если человеку назначено прийти в 8 часов утра, ужин должен состояться не позже 8 часов вечера. Если это правило нарушить, к моменту исследования в желудке останется не переваренная пища, а во время процедуры у пациента случится приступ рвоты. Кроме того, оставшаяся в желудке пища помешает визуальному осмотру, затруднит диагностику. Не исключено, что придется повторить манипуляцию снова.
  3. Если назначен прием вечером, разрешается легкий завтрак в 08:30 утра.
  4. С осторожностью отнестись во время ФГДС подготовки к приему антибиотиков. Обязательно проконсультироваться заблаговременно с гастроэнтерологом.
  5. Во время процедуры врачу могут помешать зубные протезы. Поэтому для ФГДС подготовка пациента включает в себя также снятие зубных протезов.
  6. Перед процедурой стоит также отказаться от курения, так как оно может вызвать воспаление слизистой оболочки ЖКТ, ощущения тошноты, рвоту.
  7. На прием следует приходить одетым в свободную одежду, которую при необходимости можно будет легко расстегнуть.
  8. Важен психологический настрой. Необходимо успокоиться, отбросить все волнения. Для проведения процедуры необходимо, чтобы пациент слышал врача и четко выполнял все его рекомендации.
  9. На этапе подготовки к ФГДС обязательно надо информировать врача обо всех сопутствующих заболеваниях. Этот вопрос касается любых проблем со здоровьем, в том числе и хронических, а также о возможных аллергических реакциях. Это облегчит и обезопасит проведение исследования, а также поможет правильно определиться с анестетиками.
  10. С собой на прием обязательно нужно принести направление на ФГДС. Если были проведены обследования ранее, то показать врачу их результаты. Иметь при себе полотенце.
  11. Подготовкой к ФГДС является информирование гастроэнтеролога обо всех принимаемых средствах.
  12. Подготовка к гастроскопии предполагает также соблюдение специальной диеты за несколько дней до исследования. Это способствует нормализации работы ЖКТ, снятию болезненных симптомов, снижению воспаления при неосложненных гастритах и гастродуоденитах. Таким образом, вырисовывается более реальная картина происходящих процессов в ЖКТ.

Нельзя употреблять в пищу

Исключаются из рациона за три дня до исследования следующие продукты:

  • Тяжелые для переваривания продукты: сырые яблоки, груши, вишни, сливы.
  • Кислые продукты: персики, помидоры, абрикосы, яблоки, сливы.
  • Нельзя категорически перед манипуляцией употреблять в пищу жирное, соленое, копченое и острое: копченая колбаса, сало, шашлык, жирная рыба, лук, чеснок, пряности и прочее.
  • Маринованные блюда.
  • Очень жидкую пищу: борщ, манная каша, суп.
  • Газированную воду, а также соки и алкоголь.
  • Холодную пищу: холодец, желе, мороженое.
  • Кофе, шоколад.
  • Орехи, семечки (тыквы, подсолнечника).
  • Бобовые продукты (фасоль, чечевица, горох).
  • Сладкие булочки, хлеб (особенно – серый).
  • Молочная продукция.

Людям, страдающим язвенной болезнью или гастритом, надо соблюдать диету, не кушать вредную еду в течение всего обострения, а также в период между исследованиями в обязательном порядке. Это дает возможность адекватно оценить происходящие в желудочно-кишечном тракте процессы, а также наблюдать динамику лечения.

Что входит в диету

Перед ФГДС подготовкой является следующая диета:

  • Гречневая каша, также допускаются овсяная, перловая и пшеничная. Разрешено употребление с молоком и сахаром. Главное – чтобы каши был хорошо проварены.
  • Можно съесть запеченные овощи, фрукты (яблоки, кабачки, капусту).
  • Сухари из белого хлеба.
  • Нежирную отварную или запеченную рыбу.
  • Вареную курицу (филе, лучше — белое).
  • Творог (обезжиренный).
  • Омлет или отварное яйцо.
  • Минеральная вода, травяной чай, компот, просто водопроводная вода. Их желательно употреблять без меда и сахара.

Если на какие-то из перечисленных продуктов у человека возникают боли в эпигастрии, то от них тоже нужно отказаться. Принимать пищу лучше чаще, но по чуть-чуть. Оптимально – 6-разовое питание.

Если наблюдается повышенное образование газов, об этом необходимо информировать гастроэнтеролога. В таких случаях применяют ферментные лекарства во время всей подготовки к ФГДС.

Чего категорически нельзя делать накануне манипуляции

Что не рекомендуется делать:

  1. Принимать лекарственные средства (таблетки, капсулы, сиропы).
  2. Употреблять алкогольные продукты.
  3. Чистить зубы. Это может способствовать выработке слизи в ЖКТ.
  4. При подготовке к ФГДС желудка и двенадцатиперстной кишки нельзя курить и жевать жевательную резинку за три часа до исследования.
  5. Пользоваться парфюмерией.

Допускается перед процедурой:

  1. Делать инъекции лекарственных препаратов.
  2. Проводить физиотерапию.
  3. Пить воду, чай.
  4. Исследования, не предусматривающие инвазивных вмешательств (УЗИ).

Утром за три–четыре часа до манипуляции допускается выпить стакан минералки без газов, чай с молоком. Но объем выпитой жидкости не должен превышать 150 миллилитров.

Последствия ФГДС

После проведенной манипуляции может остаться неприятное ощущение в горле, оно пройдет через два-три дня. Поэтому полчаса после манипуляции рекомендовано не есть. Пищу после процедуры употребляют мягкую, не травмирующую желудок. Обычно это каши, йогурты, пюре, легкие супы, простая вода.

Исследование очень информативно, а иногда просто незаменимо в лечебных целях. Поэтому ради получения положительного результата стоит немного потерпеть. Если пациент соблюдал диету, ответственно подошел к обследованию, то процедура пройдет гладко, с минимальным количеством неприятных последствий и воспоминаний.

Гастроскопия в Москве


Гастроскопия (эзофагогастродуоденоскопия, ФГДС желудка) – исследование пищевода, желудка и двенадцатиперстной кишки с помощью гастроскопа – резиновой трубочки с камерой. Исследование позволяет врачу визуально изучить состояние пищевода и желудка в высоком разрешении и заметить малейшие отклонения от нормы.

Гастроскопия позволяет диагностировать на раннем этапе:

  • Гастрит
  • Дуоденит
  • Язвенную болезнь
  • Гастроэзофагеальный рефлюкс
  • Варикозное расширение вен желудка или пищевода
  • Полипы
  • Доброкачественные и злокачественные опухоли желудка и пищевода.

Даже если пораженная область очень мала – врач увидит её на экране и сможет поставить точный диагноз.

Три причины сделать гастроскопию желудка в «Поликлинике.ру»

1. Процедура длится 5-10 минут

Этого времени хватает, чтобы изучить состояние органов пищеварения и поставить точный диагноз.

2. Сверхтонкий гастроскоп

Мы используем оборудование последнего поколения, чтобы сделать процедуру комфортнее.

3. Опытные специалисты

Наши специалисты провели более 7000 гастроскопических исследований.

Боитесь гастроскопии?

Многие люди откладывают обследования желудка из-за страха перед процедурой. Поэтому часто человек приходит на обследование только тогда, когда у него уже есть серьезные проблемы, которые невозможно игнорировать.

Наши врачи провели несколько тысяч исследований. В клиниках установлены современные гастроскопы с миниатюрными зондами. При введении зонда используется местная анестезия.
Поэтому гастроскопия желудка в «Поликлинике.ру» проходит абсолютно безболезненно!

Гастроскопия во сне

Волнуетесь из-за предстоящей процедуры? Пройдите гастроскопию под наркозом!

Гастроскопия под наркозом гарантирует, что исследование пройдет для вас абсолютно незаметно. Вас погрузят в легкий медикаментозный сон и проведут необходимые манипуляции. Через 20-30 минут вы проснетесь, и врач расскажет вам о результатах.

Уже через полчаса после процедуры вы сможете вернуться к повседневным делам. Управление транспортным средством возможно уже через час после пробуждения.

Подготовка к гастроскопии

  • Исследование проводится строго натощак! Последний прием пищи — накануне вечером не позднее 19:00.
  • Если пациент постоянно принимает какие-либо препараты, их нужно при­нять за три часа до исследования, запив небольшим количеством воды.
  • Если пациент принимает препараты, влияющие на свертываемость крови (антикоагулянты: гепарин, натрия гидроцитрат, неодикумарин, синкумар, антиагрегзнтные средства: ацетилсалициловая кислота, дипиридамол, пентоксифиллин, и тд), необходимо накануне проконсультиро­ваться с врачом, назначившим эти лекарственные средства, с решением вопроса о предстоящем исследовании с возможной биопсией
  • За 5 дней до процедуры пациенту необходимо избегать приема железосодер­жащих препаратов, активированного угля, висмут содержащих препаратов.

Важно: пациентам с эпилепсией выполнение ЭГДС показано только в условиях внутривенной седации! Пациентам с аритмией, перенесенным инфарктом миокарда, инсультом следует накануне проконсультиро­ваться с кардиологом и неврологом. Пациентам с сахарным диабетом необходимо записаться на ЭГДС в утренние часы и взять принимаемые лекарственные препараты с собой (тэблегировзнные формы, инсулин). Обязательно проконтролировать уровень глюкозы перед исследова­нием. Проверить уровень глюкозы крови утром перед исследованием. Пациентам с бронхиальной астмой необходимо взять с собой ингалятор.

Если вы решили сделать гастроскопию под наркозом – потребуется дополнительная подготовка к наркозу. Подробнее о ней вам расскажет врач.

Пройти гастроскопию Вы можете в «Поликлинике.ру» на «Красных воротах».

как сделано, все подробности. Перестань бояться!

Фиброгастроскопия, или ФГС – это эндоскопический способ исследования внутренних органов с помощью эндоскопического оборудования. Это очень простая процедура, при которой подготовка к ФГС является залогом успеха и постановки правильного диагноза, а также лечения. Во время осмотра врач может определить состояние стенок пищевода, желудка и двенадцатиперстной кишки.

ФГС желудка: как это делается. Знакомимся с оборудованием

Вся процедура проводится с помощью эндоскопа.Устройство состоит из линзы и длинной трубки. Благодаря особому устройству аппарата шансы повредить внутренние органы пациента во время обследования крайне малы. Во время осмотра состояния пищеварительного тракта врач может вывести полученное изображение на монитор. Вас, конечно же, интересует ФГС желудка, как делается эта процедура. Но сначала разберем подготовку к нему.

Готовимся правильно!

Неважно, какой диагноз вам поставили и по какой причине врач направил вас на обследование.Подготовка к КФС должна быть предпринята в любом случае. Во-первых, сообщите специалистам, какие лекарства вы принимаете и страдаете от аллергической реакции. Сообщите о хронических заболеваниях, если таковые имеются. Во-вторых, перед ФГС нельзя принимать пищу в течение 10 часов, так как остатки пищи в пищеварительном тракте значительно затрудняют диагностику.

ФГС желудка как делается?

Процедура неприятная, поэтому врачи сделают все, чтобы вы чувствовали себя комфортно. Во время осмотра тщательно следят за состоянием пациента, и если пациент нервничает, врачи могут «подлечить» успокоительными препаратами для облегчения ФГС.Подготовка к процедуре в большинстве случаев предполагает использование местного анестетика. Между зубами пациента вставляется специальная прокладка, а трубка эндоскопа плавно вводится в пищевод. Специалист попросит вас сначала расслабить мышцы горла, а затем сделать большой глоток. Именно в этот момент устройство вставляется внутрь. В течение всего периода движения трубки по органам пищеварительного тракта эндоскоп под слабым напором подает воздух для их расправления.Не бойтесь, что вы задохнетесь — это невозможно! Специалист осматривает внутренние стенки желудка и при необходимости может взять биопсию, вылечить язву или удалить полипы.

Возможные осложнения

Теперь вы больше знаете о такой процедуре как ФГС желудка, как она делается и чем. А теперь поговорим о возможных нежелательных последствиях. Не бояться! Как показывает практика, ФГС является абсолютно безопасной и безболезненной процедурой, проводимой с целью диагностики и лечения.Осложнения крайне редки. Максимум, что может произойти, это повреждение эндоскопом стенки внутреннего органа. В этом случае может открыться кровотечение и больному потребуется хирургическое вмешательство. Однако еще раз подчеркнем, что этого практически не происходит. В любом случае нужно сохранять спокойствие и слушать врача. После ФГС больной может ощущать дискомфорт в горле, могут быть отрыжки. Но все эти симптомы проходят уже через день и даже раньше. Стоит подождать 5-7 минут, пока врач поставит правильный диагноз.Быть здоровым!

р>>

Расшифровка ФГС. Обследование ФГС

Метод исследования, применяемый для точной диагностики заболеваний, осмотра слизистых оболочек и выявления воспалительных изменений в желудочно-кишечном тракте с помощью специального аппарата — эндоскопа (гибкая трубка с волоконной оптикой, снабженная специальным каналом и возможностью помещение в него инструментов для биопсии) называется ГФГ желудка. Расшифровка ФГС звучит как «фиброгастроскопия» (от греческого «живот» и «смотреть», «смотреть»).Этот метод желудочно-кишечных исследований является наиболее достоверным, быстрым (проводится под местной анестезией в течение нескольких минут) и позволяет установить точный диагноз, при необходимости дает возможность проведения биопсии (взятия образца ткани для более детального исследования в бактериологической лаборатории).

Показания к обследованию ФГС

В последнее время этот метод исследования очень активно используется врачами. Обследование желудка, ФГС для этого идеала, точно дает ответы на все вопросы, связанные с пищеварительным трактом, от простого дискомфорта до симптомов, вызывающих беспокойство: кровотечение, постоянное снижение гемоглобина, подозрение на инородное тело.

Как подготовиться к ФГС

Подготовка к ФГС не представляет особой сложности. Главным аспектом для хорошего результата является наличие положительного психологического настроя пациента и его полное доверие к врачу-эндоскописту. Врач должен быть в курсе всех сопутствующих заболеваний больного и тех препаратов, которые он принимает в это время.

ФГС — обследование, которое проводится натощак в специально оборудованном кабинете больницы или поликлиники.В день процедуры запрещается курить, есть, пить и жевать жвачку. За пару дней до обследования больному рекомендуется не употреблять тяжелую для желудка и вызывающую газообразование пищу (бобовые, различные молочные продукты, рыба, мясо). Последний ужин накануне экзаменационного дня должен быть не позднее 18 часов.

Как технически работает процедура ФГС?

Подготовленному пациенту с помощью специальной местной анестезии замораживают гортань. После этого, чтобы челюсть не смыкалась во время процедуры, с зубами зажимает специальный ротор-скребок, через который будет проходить эндоскоп.

В положении сидя пациент под руководством врача выполняет глотательные движения до достижения аппаратом нужной глубины обследуемого участка. После этого больного укладывают на бок и под низким давлением в желудок вводят кислород (для расправления стенок). Врач, исследуя слизистую, может взять анализ содержимого желудка (желудочный сок), удалить опухоль, пройти курс лечения или провести биопсию.

Что показывают результаты ФГС

Эндоскопия – единственный метод, с помощью которого на самой ранней стадии можно увидеть структурные изменения слизистой оболочки.Лечащий врач-гастроэнтеролог, назначая такую ​​процедуру, уточняет диагноз с помощью дополнительных методов исследования организма больного. Результаты ФГС желудка помогут подтвердить или опровергнуть наличие таких заболеваний, как рак желудка или пищевода, эзофагит, доброкачественная опухоль, гастрит повышенной или пониженной кислотности, язвенная болезнь желудка, полипы, дисфункция желудка и другие заболевания ЖКТ. С помощью ФГС можно отслеживать динамику лечения заболевания.

По результатам биопсии можно говорить о сущности процессов, происходящих в тканях организма, о наличии в них раковых клеток или обычном воспалении. Гистологическое исследование способствует выявлению патологий на ранних стадиях развития.

Чего ожидать при ФГС

Сам процесс введения зонда в пищеварительный тракт может сопровождаться рвотными рефлексами или срыгиванием. Стыдиться незачем, ведь такая реакция – показатель нормально функционирующего организма.Такие ответы организма на ФГС возникают от воздуха, который с помощью эндоскопа нагнетается в желудок и расправляет его стенки для лучшего обзора. Это зависит от последующей интерпретации FGS. Врач тщательно изучает слизистую оболочку и при необходимости удаления полипа ликвидирует его, а если нужно взять часть материала на биопсию, то берет его безболезненно.

Возможные осложнения после ФГС

Применение этой серьезной диагностической процедуры зарекомендовало себя в медицинской практике как одно из самых безопасных исследований.Осложнения после ФГС сведены к нулю. Эндоскоп является очень дорогим многоразовым инструментом, и перед каждой манипуляцией он обрабатывается согласно медицинским предписаниям, поэтому заражение каким-либо заболеванием или инфекцией исключено.

Но, как известно, в медицине всегда есть небольшой процент осложнений, даже от самых безобидных процедур. В данном случае этот показатель очень мал и зависит напрямую от больного. Больной должен быть надлежащим образом подготовлен физически и психологически, а во время проведения ФГС соблюдать рекомендации врача-эндоскописта.Возможными осложнениями в результате ФГС являются перфорация стенки исследуемого органа или незначительное кровотечение вследствие защемления небольшого участка стенки пищевода, желудка или двенадцатиперстной кишки для биопсии.

После процедуры пациент может некоторое время чувствовать дискомфорт при глотании. Обычное состояние наступает в течение суток. Полная расшифровка ФГС и необходимые рекомендации по корректировке диеты в первые дни пациенту будет предоставлена ​​сразу после завершения исследования.

Чем ФГС отличается от других методов исследования желудка

Каждый метод исследования имеет особенности в зависимости от анализируемой области. Некоторые имена кажутся похожими, но на практике процедуры очень разные. Врач-эндоскопист прекрасно ориентируется в том, что показывает ФГС, а что такое ФГДС или ЭГДС. Всем этим методам можно дать одно определение – фиброгастроскопия. Даже если эндоскопист делает ФГС с акцентом на полость желудка, он все равно будет смотреть на двенадцатиперстную кишку, как и при ФГДС (фиброгастродуоденоскопия), и на пищевод, который исследуется при ЭГДС (эзофагогастродуоденоскопия).Также при исследовании всех отделов желудочно-кишечного тракта может применяться метод видеогастроскопии, во время которого происходит видеозапись с помощью эндоскопической камеры.

Каждый пациент должен понимать, что такое процедура эндоскопии, насколько она важна и что от него зависит, здоров он или нет.

Этот метод исследования, благодаря высокой эффективности и малой вероятности возникновения возможных осложнений, широко практикуется и применяется в лечебной работе.Расшифровка ФГС опытными специалистами поможет поставить правильный диагноз и назначить соответствующее лечение.

Бюллетень по продовольствию и питанию, том 16, номер 1, март 1995 г.

Бюллетень по продовольствию и питанию, том 16, номер 1, март 1995 г.

Содержание Предыдущий Следующий

Это старый веб-сайт Университета Организации Объединенных Наций. Посетите новый сайт по адресу http://unu.edu

.

Толерантность железа плазмы к глицину железа сульфат и сульфат железа у женщин

К.Мадхаван Наир, Л. Раман, Б. А. Рамалакшми и Д. Шрирамулу

Реферат

Кривые толерантности к железу плазмы для глицинсульфата железа (ФГС) таблетки, содержащие 60 и 120 мг элементарного железа. по сравнению с аналогичными дозами таблеток сульфата железа (FS) с использованием двойного слепого перекрестного исследования у шести женщин-добровольцев. Кривые толерантности к железу плазмы, полученные с обеими дозами ФГС были аналогичны дозам ФС. Относительная биодоступность ФГС была близка к 1, что идентично биодоступности ФС.Таким образом, таблетки, содержащие сульфат глицина железа в качестве источника элементарное железо для профилактики дефицита железа не предлагают какие-либо преимущества перед менее дорогими и более доступными железный купорос.

Примечание редактора

Выводы, изложенные в следующей статье, не новы. Как авторы признают, что более точные исследования [ссылка 8] уже подтвердили, что железо в железном купоросе (FS) и двухвалентном Сульфат глицина (FGS) также доступен.Однако чем больше Дорогой FGS по-прежнему пользуется популярностью из-за его предположительно лучшего качества. поглощение. В этой статье сообщается об исследованиях in vivo в развивающихся страны, подтверждает, что FS по-прежнему является предпочтительным соединением для эффективной добавки по самой низкой цене.

Введение

Основной причиной анемии в Индии является дефицит железа. Частота анемии относительно высока среди женщин репродуктивного возраста и детей дошкольного возраста [1], а также различные приняты корректирующие меры по борьбе с железом дефицит в этих двух группах [2].Несмотря на существование национальная программа профилактики анемии за последние 20 лет, однако распространенность анемии остается высокой.

Помимо других логистических и административных проблем, было высказано предположение, что количество элементарного железа, присутствующего в 60 мг Таблетки сульфата железа (FS) могут оказаться недостаточными для контроля и предотвратить анемию той величины, которая существует. Альтернативно, плохой ответ может быть связан с низкой доступностью железа в форма таблетки.

На основании результатов исследований in vitro , он было высказано предположение, что глицинсульфат железа (FGS) может быть лучший источник железа в программах пищевых добавок.ФГС – это органическая форма элементарного железа, которая, как предполагается, лучше доступность и повышенная переносимость. Недавнее исследование в vitro биодоступность железа из соли, обогащенной ФГС заметил, что около 80% его железа находится в ионизируемой форме. [3]. Поэтому было проведено исследование с участием женщин-добровольцев. оценить относительную биодоступность FGS и FS in vivo .

 

Материалы и методы

Фармацевтические препараты ФГС получены от Medcell Лаборатории, Мадрас и FS от Indian Drugs and Pharmaceuticals ООО, Хайдарабад. Они содержали 60 мг элементарного железа и 500 мг г фолиевой кислоты.

субъекта

Двенадцать женщин-добровольцев (18-30 лет), четыре из которых беременных, были набраны для исследований биодоступности. Они попеременно вводили 60 и 120 мг элементарного железа в пустой желудок с использованием двойного слепого перекрестного дизайна. К определить толерантность к железу плазмы, образцы крови натощак собранные у всех субъектов перед каждой дозой, и образцы собирали через 2, 3, 4 и 6 часов после введения дозы. испытуемым разрешалось есть только после того, как последний образец был нарисовано. Второй препарат был дан после четырехлетнего перерыва. дней.

ТАБЛИЦА 1. Клинико-кинетические данные железа у субъектов после пероральная доза 60 и 120 мг ФС и ФГС

       

Сульфат железа

Сульфат железа глицин

 
Тема

Возраст (год)

Hb (г/дл)

Базал СИ

Время достижения пика

Пик SI

АУК

Время достижения пика

Пик SI

АУК

Относительная биодоступность

60 элементарное железо

1

22 (П)

7.8

74

3

238

1 018

2

232

1 135

1.11

2

18

145

3

312

1 535

3

230

1 104

0.70

3

21 (П)

10,0

140

3

285

1 375

4

238

1 323

0.96

4

22

12,5

220

3

635

2 253

4

419

2 219

0.98

5

22

11.1

130

3

201

971

4

223

1 075

1.11

6

22

12,0

128

4

278

1 195

3

231

1 085

0.91

Среднее

21,7

10,7

140

3,2

325

1 391

3,3

262

1 324

0.96

SD

2,25

1,87

46,9

0,41

156,9

473

0,82

76,9

448

0.152

120 мг элементарного железа

7

24

10,9

182

3

420

1 987

3

477

2 330

1.17

8

30

12,8

146

3

493

2 141

3

545

2 767

1.29

9

16 (П)

10,9

150

4

402

1 887

4

495

2 234

1.18

10

26 (П)

11,5

151

4

449

1 869

4

214

1 062

0.57

11

20

12,5

140

4

429

1 717

4

297

1 518

0.88

12

24

13,4

149

4

449

1 819

4

321

1 421

0.78

Среднее

23,3

12,0

153

3,7

440

1 903

3,7

392

1 905

0.98

SD

4,84

1,05

14,8

052

31,4

146

052

131,9

663

0.279

P = беременная женщина.
SI = сывороточное железо г/дл.
AUC = площадь под кривой.

 

Анализ

Концентрация гемоглобина оценивалась по цианметовый метод [4] и железо плазмы батофенантролином. метод [5]. Площадь под кривой толерантности к железу плазмы составила рассчитывается по методу, описанному Гибальди и Перрье [6]. Данные были проанализированы после расшифровки, и статистические были применены тесты для проверки различий, если таковые имеются, между приготовления.

 

Результаты

В таблице 1 показаны отдельные детали субъектов, базальное сывороточное железо, кинетические данные и их среднее значение значения.

Рис. 1. Среднее увеличение сыворотки железо после приема 60 и 120 мг ФС и ФГС

Наблюдались широкие вариации пиковых значений и площадь под кривой. Однако обе группы имели сопоставимые концентрации гемоглобина и базального уровня железа в плазме.

Идентичные кривые толерантности к железу плазмы были полученные как с дозами 60, так и с 120 мг ФС и ФГС (рис.1). Пиковые уровни железа наблюдались между третьим и четвертым часами. после введения и затем медленно снижалась. Нет корреляция была замечена либо между базальным железом плазмы концентрации или гемоглобина и пиковых уровней железа в плазме. средние пиковые уровни железа в плазме были 325 и 262 г/дл для 60 мг FS и FGS соответственно и 440 и 392 г/дл в течение 120 мА. Эти различия не были статистически значимыми. В то время как было широкие индивидуальные различия в абсорбции железа от обоих препаратов, толерантность к железу плазмы была практически одинаковой. средние отношения плазменной толерантности железа от FGS к таковой от FS для 60 мг и 120 мг соответственно 0,96 и 0,98. Несмотря ни на что доз, у беременных не было различий в плазме крови. толерантность к железу, площадь под кривой и пиковая концентрация по сравнению с небеременными женщинами.

 

Обсуждение

Из-за своей органической природы он был предположили, что ФГС переносится лучше, чем ФС. Кроме того, его стабильность при кислых рН хорошая [7].Биодоступность in vitro поваренной соли, обогащенной ФГС, была очень высокой, почти 80% элементарного железа находилось в ионизируемой форме [3]. Тем не менее, Было обнаружено, что биодоступность таблетки FS in vivo идентичный. Аналогичные результаты были получены при сравнении всасываемость различных соединений железа, в том числе ФГС, с использованием радиоактивное железо, более точный метод [8].

Более высокая биодоступность, отмеченная при использовании FGS был основан на тесте in vitro, примененном в чистых системах.Однако, in vivo многие факторы, в том числе pH желудка, наличие пища, подвижность желудка и целостность слизистой оболочки влияют на всасывание железа из желудочно-кишечного тракта. в пробирке проведенное ранее исследование не учитывало эти факторы рассмотрение.

Таким образом, ввиду сходной биодоступности железо в двух формах и более высокая стоимость FGS, это не подготовка выбора для крупномасштабных программ общественного здравоохранения направлена ​​на профилактику железодефицитной анемии.

 

Благодарности

Мы благодарим доктора.Винодини Редди, директор Национальный институт питания, Хайдарабад, за ее поддержку в этом исследовании. Мы также благодарим г-жу Судха Сринвасан за печатание рукопись. Таблетки были предоставлены компанией M/s. Медселл Лаборатории, Мадрас.

 

Каталожные номера

1. Виджаярагхаван К., Брахмам ГНВ, Мадхаван Наир К., Акбар Д., Прахлад Рао Н. Оценка национальных программа профилактики анемии. Индиан Дж. Пед 1990; 57: 183–90.

2.Дана Р.Н., Гальдер К., Кришнамурти К.А. и др. Использование поваренной соли, обогащенной железом, в контроле и профилактика анемии: совместное исследование. Am J Clin Nutr 1982; 35:1442-51.

3. ИКМР. Годовой отчет Национального института Питание. Хайдарабад, AP: Индийский совет медицинских исследований, 1991-92:60-61.

4. Вонг С.Ю. Колориметрическое определение железа и гемоглобина в крови. J Biol Chem 1928;77:409-12.

5. Bothwell TA, Conral ME, Cook JD et al. Предлагаемые рекомендации по измерению сывороточного железа у человека кровь.Международный комитет по стандартизации в гематологии. Бр Дж. Хэматол 1971; 20:451-4.

6. Гибальди М., Перье Д. Кинетика абсорбции. и биодоступность. В: Лекарства и фармацевтические науки. Том. 151, Фармакокинетика. 2-е изд. Нью-Йорк: Марсель Деккер, 1982; 145-98.

7. Субба Рао К., Нарасинга Рао Б.С. В пробирке исследования хелатирующих агентов как потенциального поглощения железа промоутеры. Food Chem 1985;17:13-23.

8. Brise H, Hallberg L. Поглощаемость различные соединения железа.Акта Мед Сканд 1962; 171: (доп. 376) 2337.


Содержимое Предыдущий Следующий

Частота обнаружения HBsAg в жидкости, прилипшей к эндоскопу, желудочном соке и слюне, собранной во время эндоскопии у пациентов с положительным результатом на HBsAg

Korean J Intern Med. 1986 июль; 1(2): 194–197.

Кафедра внутренних болезней, Медицинский колледж, Пусанский национальный университет, Пусан, Корея

Адрес для запросов на перепечатку: Bang-Hyun Liu, M.D. Кафедра внутренних болезней, Медицинский колледж Пусанского национального университета, Пусан.

Авторские права © Корейская ассоциация внутренних болезней, 1986. Это статья в открытом доступе, распространяемая в соответствии с условиями некоммерческой лицензии Creative Commons Attribution (http://creativecommons.org/licenses/by-nc/3.0/), которая разрешает неограниченную некоммерческую использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

Abstract

Желудочный сок, слюна и жидкость, прилипшие к эндоскопу, были собраны у 50 пациентов, которые были серопозитивными в отношении поверхностного антигена гепатита В (HBsAg) во время эндоскопического исследования верхних отделов желудочно-кишечного тракта и исследованы на HBsAg с помощью радиоиммуноанализа.Положительный тест был получен в 42,0% образцов слюны, в 32,0% образцов желудочного сока и в 31,3% жидкости, прилипшей к эндоскопу. Эти результаты следует воспринимать как предупреждение, требующее более тщательного обследования пациентов и дезинфекции эндоскопа.

Ключевые слова: HBsAg, эндоскоп, желудочный сок, слюна, дезинфекция агенты, такие как вирус гепатита В (НВ).Glouberman 1) и Whalen 2) предположили, что передача антигена HB с помощью оптоволоконного эндоскопа вполне возможна, но это еще не доказано окончательно. Поверхностный антиген HB (HBsAg) обнаруживается во всех видах секрета человека, и документально подтверждена передача HB непарентеральными путями, такими как слюна, желудочный сок, моча и стул. 3–5)

Стоматолог, 6) хирург, 7) врач-онколог 8) и врач отделения диализа 9) имеют более высокий уровень положительного HBsAg в сыворотке, чем врачи другие специальности.Это говорит о том, что частый контакт с HBsAg является важным путем передачи.

МАТЕРИАЛЫ И МЕТОДЫ

Пятьдесят пациентов, все из которых были серопозитивными в отношении HBsAg по данным метода РПГА (обратной пассивной гемагглютинации), прошли обследование верхних отделов желудочно-кишечного тракта с помощью гибкого оптоволоконного эндоскопа. Диагнозы этих больных: вирусный гепатит 19 (38,0%), гастрит 14 (28,0%), цирроз печени 11 (22,0), язвенная болезнь желудка 4 (8,0%), гепатоцеллюлярная карцинома 2 (4,0%).0%) ().

Таблица 1

Заболевания и цифры пациентов изучали

Конечный диагноз Количество случаев %
B Вирусный гепатит 19 38,0
Гастрит
14 280138 28.0
Печень цирроз 11 22,0 22,0 22,0
Живера желудка 4 8,0
Гепатоцеллюлярная карцинома 2 4.0

  Всего 50 100,0

В качестве подготовки к эндоскопии пациенты не принимали пищу с вечера перед днем ​​исследования до эндоскопической процедуры. За 15–30 мин до процедуры внутримышечно вводили 1,0 мг атропина. Перед исследованием проводилась фарингеальная анестезия 2% раствором ксилокаина. Для осмотра использовали эндоскопы Olympus GIF-D, K типа.

Мы собрали жидкость, прилипшую к эндоскопу (желудочный сок и слюна), втирая ее непосредственно в маленькие стеклянные пробирки.Все образцы были проверены на HBsAg методом РИА (радиоиммуноанализ). В RIA мы использовали набор Austria II-123 Abbott Laboratories, Чикаго, процедура анализа B. Пороговое значение представляет собой чистый CpM среднего отрицательного контроля (NCx), умноженный на коэффициент 2,1.

РЕЗУЛЬТАТЫ

Желудочный сок, аспирированный через эндоскоп у 50 пациентов, был положительным на HBsAg в 16 случаях (32,0%) (). Слюна была положительной на HBsAg у 21 (42,0%) пациента. Выделения, прилипшие к эндоскопу после экстубации, были положительными в 15 из 48 случаев, в которых проводились исследования (31.3%) (). В качестве контроля аналогичным образом исследовали 10 пациентов с отрицательным результатом на HBsAg. Желудочный сок, слюна и жидкость, прилипшие к эндоскопу, отобранные во время эндоскопического исследования, были отрицательными на HBsAg во всех 10 случаях ().

Таблица 2

HBSAG Positivitive в желудочном соке, собранном во время FGS среди сывородок HBSAG (-) пациентов

Количество пациентов № HBSAG (-) в желудочном соке %
50 16 320

Таблица 3У пациентов

№ HBSAG (+) в Saliva % 50 21 21

1

Таблица 4

HBSAG Positivity в жидкости привержена к ФГС после вымирания среди сыворотых HBS Пациенты Ag (+)

№ пациентов № HBSAG (+) в жидкости %
48 15 31.0

Таблица 5

HBsAg-позитивность в желудочном соке и слюне при ФГС среди пациентов с HBsAg(-) в сыворотке

5
№Пациентов Количество HBSAG (+) в % % Saliva желудочный сок
10 0 0 0

обсуждение

Многие следователи предположили возможность того, что HB иногда передается через эндоскопию, но доказательства этого отсутствуют. Мы исследовали слюну и желудочный сок, собранные во время эндоскопических исследований, проведенных на 50 носителях ГВ, и материал, прилипший к эндоскопу.Было показано, что HBsAg-положительная сыворотка является инфекционной при разведении 1:10 7 при парентеральном введении, 10) , и сообщалось, что 0,5 мл положительной сыворотки могут передавать HB пероральным путем, 11) , но точная пероральная доза, способная передать заболевание, неизвестна.

Имеются эпидемиологические данные о наличии большого количества частиц HBsAg в слюне, достаточного для передачи инфекции HB. 5) В этих сообщениях предполагается, что даже минимальное количество HBsAg в слюне, желудочном соке и крови может способствовать передаче инфекции.В нашем исследовании тест на HBsAg был положительным в 42,0% образцов слюны, в 32,0% образцов желудочного сока и в 31,3% материала, прилипшего к эндоскопу.

Моррис и др. 12) провел эндоскопию у 32 пациентов по неосторожности после экстренной эндоскопии у пациента, у которого позже был обнаружен HBsAg. Они наблюдали за этими пациентами и обнаружили, что ни у кого из них не было желтухи или биохимических отклонений. McDonald and Silverstein 13) также сообщили об отсутствии клинических и биохимических признаков заболевания печени у 4 пациентов, которым была проведена эндоскопия с помощью эндоскопа, который использовался у пациентов, серопозитивных к HBsAg.Аналогичное наблюдение было сообщено Axon et al. 14)

Моррис и др. 12) и McDonald and Silverstein 13) тщательно промывали эндоскоп для удаления прилипших материалов и очищали его 70% спиртом перед каждым эндоскопическим исследованием и предположили, что эта процедура сводит к минимуму возможность передачи ГБ. Напротив, есть много пессимистичных врачей, которые сомневаются в том, что эта процедура дезинфекции полностью предотвратит передачу гепатита при эндоскопии. 12–15) Несмотря на то, что случаев эндоскопически передающегося ГВ не было, Morris et al. 12) начал использовать 2% глутаровый альдегид в качестве дезинфицирующего средства. McDonald and Silverstein 13) пытались не проводить эндоскопию у пациентов с положительным результатом на HBsAg и желтухой. Точно так же Аксон и др. по телефону 11) предположили, что возможна передача гепатита при эндоскопии. Bond and Moncada 15) рекомендуют 2% глутаровый альдегид или 8% формалин, поскольку спирт не полностью инактивирует вирус HB.Согласно Glouberman, 1) 2% глутаровый альдегид не может разрушить инфекционные частицы, но кровь, обработанная 2% глутаровым альдегидом, не будет передавать вирус, даже если HBsAg все еще должен присутствовать в продезинфицированной крови, потому что нет никакой связи между вирусной инфекционностью и его иммунологическая активность, которая даст положительный результат теста. 16) Он также предположил, что HBsAg можно разрушить, подвергая его воздействию газообразного этиленоксида в течение 16 часов. Помимо газообразного оксида этилена, влажный нагрев до 90°C в течение 2 часов.Влажное тепло 85°C в течение 1 часа или 100°C в течение 10 минут может уничтожить инфекционность. Этот метод не может быть применен к волоконно-оптическим инструментам, поскольку максимальная термостойкость волоконной оптики Olympus или ACMI составляет 50–60°C.

Из газообразного этиленоксида и 2% глутарового альдегида. Аксон и др. 14) предпочитает последнее и предлагает 15 минут замачивания в нем, потому что первое требует больше времени и дороже.

В эндоскопическом кабинете нашей больницы мы используем следующую процедуру дезинфекции: оптоволоконные эндоскопы тщательно промывают проточной водой и очищают их 70% спиртом после удаления прилипших материалов.

Вильярехос и др. 17) и Almeida et al. 18) подчеркнул, что вирус HB может передаваться воздушно-капельным путем, и что медицинский персонал, контактирующий с секретами больных, может заразиться в небольшом эндоскопическом кабинете. Сообщалось, что бактерии в ротовой полости пациента обнаруживаются в воздухе, 19) , и некоторые эндоскописты предлагают, чтобы эндоскопист и его/ее коллеги носили маски, чтобы защитить себя. 2) Чалмерс и др. 20) предположил, что HBsAg-положительные врачи, медсестры, стоматологи и другой медицинский персонал могут передавать вирус HB пациентам, основываясь на вспышке гепатита, переданного таким человеком. 21) Сульц и др. 22) также отметил, что вирус HB был передан пациентам через раненые руки HBsAg-положительного врача при проведении инъекций, манипуляциях с медицинскими устройствами или интубации эндоскопа.

Хотя мы не исследовали эндоскопические биопсийные щипцы и цитологические щетки, если они загрязнены кровью в желудке пациента с положительным результатом на HBsAg, они могут быть средством передачи вирусной инфекции HB.Бонд и др. 15) предложил, чтобы эндоскопические принадлежности были либо одноразовыми, либо подвергались воздействию газообразного этилена в течение необходимого времени после каждого использования, а Whalen 2) предположил, что температура 250°C при 15 1 бар, давление в течение 15 мин. обеспечить адекватную защиту от вируса HB.

Таким образом, необходимость убедиться, что эндоскоп не заражен вирусом HB, является реальной, особенно с учетом того факта, что эндоскопическая холангиопанкреатография в настоящее время широко используется у пациентов с желтухой.

ЛИТЕРАТУРА

1. Глоуберман С. Дезинфекция эндоскопического инструментария. Гастроинтестинальная эндоскопия. 1975; 22:48. [Google Академия]2. Уэлен Г.Э. Риски гепатита: что можно сделать? Гастроинтестинальная эндоскопия. 1975; 22:40. [Google Академия]3. Уорд Р., Борхерт П., Райт А., Клайн Э. Антиген гепатита В в слюне для полоскания рта. Ланцет. 1974; 1:71. [Google Академия]4. Хиткот Дж., Кэмерон С.М., Дэнд Д.С. Антиген гепатита В в слюне и сперме. Ланцет. 1974; 1:71. [PubMed] [Google Scholar]5. Огро пл.Иммунологические аспекты антигена и антител, ассоциированных с гепатитом, в жидкостях организма человека. Джей Иммуно. 1973; 110:1197. [PubMed] [Google Scholar]6. Фельдман Р.Э., Шифф Э.Р. Гепатиты у стоматологов. ДЖАМА. 1975; 232:1228. [PubMed] [Google Scholar]7. Розенберг Дж. Р., Джонс Д. П., Липиц Л. Р. Вирусный гепатит, профессиональный вред хирурга. ДЖАМА. 1973; 223:395. [PubMed] [Google Scholar]8. Wands JR, Walker JA, Davis TT, Water-burg LA, Owens AH, Carpenter CC. Гепатит В в онкологическом отделении. N Engl J Med. 1974; 291:1371.[PubMed] [Google Scholar]9. Лондон В.Т., Дифиглия М., Сатник А.И., Блумберг Б.С. Эпидемия гепатита в отделении хронического гемодиализа: австралийский антиген и разница в реакции хозяина. N Engl J Med. 1969; 281:571. [PubMed] [Google Scholar] 10. Бейкер Л.Ф. Передача сывороточного гепатита. ДЖАМА. 1970; 211:1079. [Google Академия] 11. Кругман С., Джайлз Дж. П. Вирусный гепатит, Новый свет на старую болезнь. ДЖАМА. 1970; 212:1019. [PubMed] [Google Scholar] 12. Моррис И.М., Крупный рогатый скот Д.С., Смитс Б.Дж. Эндоскопия и передача гепатита В.Ланцет. 1975; 2:1152. [PubMed] [Google Scholar] 13. Макдональд ГБ, Сильверстайн Ф.Э. Может ли эндоскопия желудочно-кишечного тракта передать гепатит В пациентам? Гастроинтестинальная эндоскопия. 1976; 22:168. [PubMed] [Google Scholar] 14. Axon ATR, Philis I, Cotton PE, Avery SA. Дезинфекция желудочно-кишечного эндоскопа. Ланцет. 1974; 1:656. [PubMed] [Google Scholar] 15. Bond WW, Moncada E. Риск заражения вирусным гепатитом B при гибкой волоконно-оптической эндоскопии. Гастроинтестинальная эндоскопия. 1978; 24:235. [PubMed] [Google Scholar] 16.Кругман С., Джайлз Дж. П. Вирусный гепатит типа В (штаммы MS-2): дальнейшее наблюдение за анамнезом и профилактика. N Engl J Med. 1973; 288:755. [PubMed] [Google Scholar] 17. Вильярехос В.М., Висона К.А., Кутьеррес А., Родригес А. Роль слюны, мочи и кала в передаче гепатита типа В. N Engl J Med. 1974; 291:1375. [PubMed] [Google Scholar] 18. Алмейда Д.Д., Чисхолм Г.Д., Кулазилаке А.Е., МакГрегор А.Б., Макки Д.Х., О’Донахью Э.П.Н., Шакман Р., Уотерсон А.П. Возможное воздушно-капельное распространение вируса сывороточного гепатита в отделении гемодиализа.Ланцет. 1971; 2:849. [PubMed] [Google Scholar] 20. Чалмерс TC, Alter HJ. Ведение бессимптомного носительства антигена, ассоциированного с гепатитом. N Engl J Med. 1971; 285:613. [PubMed] [Google Scholar] 21. Гарибальди Р.А., Расмуссен К.М., Холмс А.В., Грегг М.Б. Больничный сывороточный гепатит Сообщение о вспышке. ДЖАМА. 1972; 219:1577. [PubMed] [Google Scholar]

Урогенитальный шистосомоз и влияние на сексуальное и репродуктивное здоровье

Генитальный шистосомоз – опасное последствие шистосомных инфекций, резко снижающее качество жизни, причиняющее страдания и боль, приводящее к воспалению органов малого таза, бесплодию и повышающее вероятность заражения другими опасными заболеваниями, такими как ВИЧ.Исследователи работают над определением генитального шистосомоза у женщин и мужчин, разработкой практических диагностических тестов и улучшением платформ и результатов лечения.

Анук Гуврас

Карманный атлас ВОЗ по ФГС. Изображение справа ВОЗ

Шистосомы и шистосомоз

Шистосомы живут в системе крови млекопитающих, они производят от сотен до тысяч яиц в день, которые преодолевают барьер между системой крови и мочевыводящими или кишечными путями (в зависимости от вида шистосом) и покидают тело, когда хозяин мочится или испражняется.Но подсчитано, что по крайней мере треть яиц не выходит из организма, а вместо этого попадает в органы. Вот где опасность. Захваченные яйца приводят к повреждению тканей, повреждению органов и увеличению риска тяжелых и опасных для жизни состояний.

Ущерб, причиняемый этими паразитами, серьезен, но хронический характер, спектр проявлений заболевания и сложные эпидемиологические условия создают проблемы для его диагностики, контроля и ликвидации в условиях ограниченных ресурсов, где он распространен.

Яйца S. haematobium , окруженные интенсивными инфильтратами эозинофилов в ткани мочевого пузыря 1973
Dr. Edwin P. Ewing, Jr.

Мочеполовой шистосомоз

Яйца шистосом распространяются по венозной системе и могут оседать в различных органах, что приводит к гранулемам и повреждению тканей. Яйца S. haematobium часто попадают в мочевыводящие и репродуктивные органы, вызывая воспаление и повреждения. Когда яйца попадают в половые пути, они вызывают форму заболевания, называемую генитальным шистосомозом.У женщин, где воздействие более очевидно, это называется женским генитальным шистосомозом (FGS). У мужчин это называется мужским генитальным шистосомозом (MGS).

По оценкам ВОЗ около 56 миллионов женщин страдают от СГС.

Симптомы генитального шистосомоза включают:

  • Кровь в моче (гематурия)
  • Абдоминальная и тазовая боль
  • Боль при половом акте (диспареуния)
  • Посткоитальное и контактное кровотечение
  • Выделения из влагалища
  • Дизурия (боль или затрудненное мочеиспускание)
  • Воспаление шейки матки, эндометрия и/или фаллопиевых труб
  • Воспаление кожи вокруг яичек (эпидидимит)
  • Синдром хронической тазовой боли у мужчин
  • Болезненная эрекция и эякуляция
  • Кровь в сперме (герматоспермия)
  • Железистые опухоли около предстательной железы (аденомкарцинома)

Потенциальные осложнения генитального шистосомоза включают выкидыши, внематочную беременность и бесплодие.Они не только несут огромный риск для женщин, но и их влияние на психическое здоровье и социальный статус нельзя недооценивать. Бесплодие может быть табуированной темой во многих культурах и может привести к более широкому кругу проблем, таких как стигматизация, экономические трудности, социальная изоляция и изоляция.

Фертильность имеет первостепенное значение в большинстве культур, а бесплодие/субфертильность может вызвать широкий спектр медицинских и социально-экономических проблем у пострадавших

Связь с ВИЧ

Исследователи показали, что существует сильная связь между FGS и ВИЧ-инфекцией, фактически женщины с шистосомными инфекциями потенциально гораздо более восприимчивы и подвержены повышенному риску заражения ВИЧ.Причинно-следственная связь еще не установлена, но доказательства убедительны, и проводятся дальнейшие исследования в виде клинических испытаний (см. ниже в разделе Профилактика )

Патология генитального шистосомоза похожа на многие заболевания, передающиеся половым путем, и когда пациенты обращаются в местное медицинское учреждение с этими симптомами, медицинские работники часто ставят им неправильный диагноз из-за отсутствия осведомленности и четкой диагностики. Таким образом, пациенты часто получают неправильное лечение, и говорят, что они не реагируют на лечение или страдают «хронической болью».В любом случае их страдания не облегчаются.

Проблемы диагностики

Проблема диагностики генитального шистосомоза связана с общей проблемой диагностики шистосомных инфекций. Мы по-прежнему полагаемся на микроскопическую идентификацию яиц шистосом в образцах мочи и стула как на золотой стандарт. Мы уже знаем, что это не идеальная диагностика, поскольку существует изменчивость яйценоскости и экскреции, а легкие инфекции часто пропускают. Осложнением генитального шистосомоза является то, что однажды установленные поражения и повреждение тканей продолжаются после того, как глистные инфекции были разрешены (будь то путем лечения празиквантелом (PZQ), который убивает взрослых гельминтов, или в результате естественной гибели самих гельминтов).

Благодаря исследователям и ВОЗ у нас теперь есть Атлас ВОЗ для ФГС, справочное руководство на основе изображений для диагностики ФГС в клинических условиях.

Карманный атлас ВОЗ по ФГС. Image Right WHO

Однако этот метод необходимо использовать с другими методами скрининга, чтобы исключить другие инфекции и заболевания (ИППП, урогенитальный туберкулез, скрининг рака). Кроме того, этот атлас, основанный на изображениях, может диагностировать шистосомоз только в нижней части половых органов женской репродуктивной системы и может пропустить повреждение фаллопиевых труб.

Еще одна проблема заключается в том, что эти методы клинической диагностики требуют использования специализированного оборудования, такого как кольпоскоп, и высококвалифицированного персонала, что может быть затруднительно в условиях ограниченных ресурсов, где процветает шистосомоз.

Другой возможностью является использование молекулярных методов, основанных на идентификации ДНК шистосом в половых путях. Исследование, проводимое в настоящее время в Замбии, направлено на изучение потенциального домашнего теста на выявление S.haematobium в качестве прокси для диагностики FGS. Также проверяется применимость доступного по месту лечения кольпоскопа размером со смартфон, с которым может работать неквалифицированный персонал. Это устройство уже развернуто для диагностики рака шейки матки в условиях ограниченных ресурсов.

Необходимы дальнейшие исследования для уточнения и разработки практических и масштабируемых методов диагностики генитального шистосомоза в условиях ограниченных ресурсов. Это необходимо сочетать с дальнейшими исследованиями патологических путей шистосомных инфекций в репродуктивном тракте человека.

Лечение

Что, если бы у нас был простой в использовании диагностический тест или высококвалифицированная клиническая медсестра использовала атлас FGS ВОЗ для успешного диагностирования женского генитального шистосомоза? Мы бы, конечно, лечили их известным доступным препаратом, эффективным против всех видов шистосом, празиквантелом. Но вот плохие новости. Имеющиеся данные указывают на то, что назначение PZQ в рекомендуемой в настоящее время дозировке 40 мг/кг не является эффективным методом лечения FGS. Он может убивать живых взрослых червей, все еще находящихся в кровеносных сосудах, но он не эффективен для устранения уже существующих поражений и повреждений тканей.

Это разрушительная новость для миллионов женщин, у которых уже есть FGS. Нам срочно нужно эффективное лечение, чтобы обратить вспять поражения FGS и повреждение тканей. Потенциальное решение может быть найдено в самом PZQ. В конце концов, он обладает противовоспалительными свойствами, поэтому, возможно, в более высокой концентрации он может обратить вспять некоторые повреждения, уже установленные FGS.

Безусловно, это необходимо сделать быстро, чтобы оказать некоторое облегчение больным генитальным шистосомозом.

Профилактика

Хорошая новость: мы можем предотвратить развитие FGS и MGS! И мы делаем. Поперечные исследования показали, что у женщин, прибывающих из районов, где проводились программы борьбы с шистосомозом с использованием профилактической химиотерапии с PZQ, вероятность исходов FGS значительно ниже, а лечение PZQ в возрасте до 20 лет в значительной степени связано с отсутствием FGS.

Школьники, получающие лечение празиквантелом и альбендазолом – авторское право на изображение Штеффи Кнопп

В настоящее время в Южной Африке проводятся клинические испытания, чтобы выяснить, может ли регулярное лечение PZQ у девочек в препубертатном и постпубертатном возрасте предотвратить FGS и ВИЧ-инфекцию.

С нетерпением ждем результатов!

Шистосомоз мужских половых органов

FGS в настоящее время привлекает немного внимания, хотя, по скромному мнению этого автора, не так много, как должно! Тем не менее, MGS серьезно игнорируется. Поперечные исследования показали, что яйца шистосом присутствуют в сперме, что указывает на то, что большое количество яиц может располагаться вдоль репродуктивных путей мужчин, вызывая повреждение тканей и проблемы. Ведутся дополнительные исследования, но нам нужно больше опросов и клинических испытаний, чтобы лучше понять влияние генитального шистосомоза на мужчин.

Следующие шаги

ВОЗ и ЮНЭЙДС призывают к проведению дополнительных исследований по диагностике, связи с ВИЧ и широкомасштабному охвату лечением шистосомоза.

Объединение для борьбы с ЗТБ, группа по защите интересов всех 10 ЗТБ, на которые направлена ​​Лондонская декларация (об этом говорилось в предыдущем блоге), недавно подготовила программный документ для повышения осведомленности о FGS и о том, как программы борьбы с ЗТБ могут предотвратить развитие этого заболевания.

Но введение PZQ посредством профилактической химиотерапии в настоящее время ориентировано на начальные школы.Как насчет средних школ и детей-подростков? Что делать мамам и детям дошкольного возраста? Как насчет распространения празиквантела в клиниках сексуального и репродуктивного здоровья?

Нам нужно:

  • Исследования для улучшения практической диагностики шистосомоза женских половых органов.
  • Клинические испытания для подтверждения причинно-следственной связи между FGS и ВИЧ, чтобы помочь нам привлечь и отстаивать включение шистосомоза в уже существующие программы и клиники по ВИЧ / СПИДу и репродуктивному здоровью.
  • Эффективное лечение миллионов женщин, уже страдающих установленным генитальным шистосомозом, и
  • Исследование, направленное на лучшее понимание последствий мужского генитального шистосомоза.

Дети узнают о шистосомозе, паразитарном заболевании со множеством опасных последствий. Копірайт зображення Steffi Knopp

Кичочо (шистосомоз на суахили) День информирования в школах сайт

 

Фактор роста фибробластов 10-рецептор фактора роста фибробластов 2b Опосредованная сигнализация не требуется для гомеостаза желез желудка у взрослых

Abstract

Сигнальные пути, необходимые для желудочного органогенеза, изучены довольно подробно; однако те, которые регулируют поддержание желудочного эпителия во время гомеостаза у взрослых, остаются неясными.В этом исследовании мы исследовали роль фактора роста фибробластов 10 (FGF10) и его основного рецептора, рецептора фактора роста фибробластов 2b (FGFR2b), в железистом гомеостазе желудка взрослых. Сначала мы показали, что мышь для взрослых желудок выражена FGF10 , его рецепторы, FGFR1B и FGFR2B и FGFR2B и большинство других лигандов FGFR2B ( FGF1, FGF7, FGF22 ), за исключением FGF3 и FGF20 . Экспрессия Fgf10 была мезенхимальной, тогда как экспрессия FGFR1 и FGFR2 была в основном эпителиальной.Изучая двойных трансгенных мышей, которые допускают индуцируемую избыточную экспрессию Fgf10 у взрослых мышей, мы показали, что избыточная экспрессия Fgf10 в нормальном железистом желудке взрослых увеличивает пролиферацию эпителия, стимулирует дифференцировку клеток слизистой шеи и снижает дифференцировку париетальных и главных клеток. Хотя подобный фенотип может быть связан с развитием метаплазии, мы обнаружили, что сверхэкспрессия Fgf10 в течение короткого времени не вызывает метаплазии. Наконец, исследуя двойных трансгенных мышей, которые допускают экспрессию растворимой формы Fgfr2b, основного рецептора FGF10, который действует как доминантно-негативный, мы не обнаружили значительных изменений в пролиферации или дифференцировке желудочного эпителия у мутантов.Наша работа впервые предоставляет доказательства того, что сигнальный путь FGF10-FGFR2b не требуется для эпителиальной пролиферации и дифференцировки во время гомеостаза железистого желудка взрослых.

Образец цитирования: Спир А.Л., Алам Д.А., Сала Ф.Г., Форд Х.Р., Беллуски С., Грикшайт Т.К. (2012) Фактор роста фибробластов 10-рецептор фактора роста фибробластов 2b Опосредованная передача сигналов не требуется для гомеостаза желез желудка взрослых. ПЛОС ОДИН 7(11): е49127. https://дои.org/10.1371/journal.pone.0049127

Редактор: Хемачандра Редди, Орегонский университет здоровья и науки, Соединенные Штаты Америки

Поступила в редакцию: 6 июня 2012 г.; Принято: 4 октября 2012 г.; Опубликовано: 1 ноября 2012 г.

Авторское право: © 2012 Speer et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Эта работа была поддержана: 1) Ethicon-Society of University Surgeons: Surgery Research Fellowship Award, Allison L. Speer, http://www.susweb.org/mc/page.do?sitePageId=93045 . 2) Национальные институты здравоохранения: 1R01HD052609-01A2, 5R01HD052609-02, 5R01HD052609-03, Саверио Беллуски и Генри Р. Форд, http://projectreporter.nih.gov/project_info_history.cfm?aid=7426527&icde=12717266. 3) Калифорнийский институт регенеративной медицины: RN2-00946–1, Tracy C. Grikscheit, http://www.cirm.ca.gov/content/mechanism-tissue-engineered-small-intestine-formation. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы ознакомились с политикой журнала и имеют следующий конфликт: SB в настоящее время является редактором PLOS ONE. Авторы хотели бы подтвердить, что это не меняет приверженности авторов всем политикам PLOS ONE в отношении обмена данными и материалами.

Введение

Аденокарцинома желудка является четвертым наиболее распространенным видом рака и второй ведущей причиной смерти от рака во всем мире [1] с общей 5-летней относительной выживаемостью в большинстве стран около 20% [2]. Канцерогенез желудка чаще всего связан с инфекцией H. Pylori, но другие факторы риска включают потребление пищи (высокое потребление соли и/или низкое потребление фруктов и овощей), а также афроамериканскую этническую принадлежность и низкий социально-экономический статус [3].Потеря париетальных клеток, или оксинтическая атрофия, является наиболее надежным предраковым коррелятом у людей. Потеря париетальных клеток независимо от причины (хеликобактерная инфекция или фармакологические агенты) приводит к последующему развитию метаплазии и может ускоряться при дефиците гастрина или гистамина [4], [5]. У людей в результате атрофии оксинтов могут возникать два типа метаплазии слизистых клеток: кишечная метаплазия бокаловидных клеток (IM) или метаплазия, экспрессирующая спазмолитические полипептиды (SPEM) [4], [6].Фактор роста фибробластов (FGF), Hedgehog, трансформирующий фактор роста бета (TGFβ)/костный морфогенетический белок (BMP) и сигнальные пути Wnt являются важными и родственными морфогенетическими сетями, которые регулируют стволовые клетки, особенно в желудочно-кишечном тракте [7], [7]. 8]. Эти сигнальные пути имеют решающее значение во время эмбрионального развития, гомеостаза взрослых, восстановления и регенерации тканей и канцерогенеза. Определение роли сигнального пути FGF10-FGFR2b во время гомеостаза железистого желудка взрослых является первым шагом к определению клеточных механизмов репарации и регенерации желудочного эпителия после повреждения.

Факторы роста фибробластов (FGF) играют ключевую роль в клеточной пролиферации, дифференцировке, миграции и воспалении в некоторых органах [8]. FGF связываются с одним или несколькими тирозинкиназными трансмембранными рецепторами FGF (FGFR) [9]. Как и в случае некоторых других высококонсервативных путей передачи сигналов, передача сигналов FGF имеет тенденцию происходить паракринным образом между эпителием и мезенхимой, при этом лиганд FGF экспрессируется в ткани, прилегающей к соответствующему FGFR(s) [10]. Например, во время желудочного органогенеза Fgf10 экспрессируется в мезенхиме, тогда как его основной рецептор, Fgfr2IIIb (далее Fgfr2b ), экспрессируется в эпителии [11, 12, 13].

Ранее мы сообщали, что передача сигналов, опосредованная FGF10-FGFR2b, необходима для органогенеза желудка [13], двенадцатиперстной кишки [14], [15], слепой кишки [16], [17] и толстой кишки [18], [ 19], [20] у мыши. Атрезия толстой кишки была связана со снижением эпителиальной пролиферации и увеличением эпителиального апоптоза как у мышей Fgf10 -/- , так и у мышей Fgfr2b -/- [19], [20]. В отличие от мезенхимы, дифференцировка эпителия толстой кишки не была затронута в Fgf10 -/- [20].Во время развития эмбрионального желудка оба нокаута Fgf10 и Fgfr2b имели нарушенную эпителиальную пролиферацию, но, наоборот, демонстрировали серьезные нарушения дифференцировки желудочного эпителия с отсутствием париетальных клеток и уменьшенным количеством главных клеток [13]. Более того, эктопическая избыточная экспрессия Fgf10 во время развития желудка также выявила серьезные изменения в дифференцировке эпителия, включая уменьшение количества париетальных и эндокринных клеток и увеличение главных клеток [11].Несмотря на эти первоначальные наблюдения за развитием желудочно-кишечного тракта, роль передачи сигналов FGF10-FGFR2b в желудке во время гомеостаза у взрослых еще не исследована.

В этом исследовании мы изучаем роль передачи сигналов FGF10-FGFR2b во время гомеостаза железистого желудка взрослых. Мы впервые продемонстрировали присутствие Fgf10 и его рецепторов, Fgfr1b и Fgfr2b , в железистом желудке взрослых вместе со всеми генами, кодирующими другие лиганды FGFR2b ( Fgf-1, -3, -7, -20). , −22 ).Исследуя двойных трансгенных мышей, обеспечивающих сверхэкспрессию Fgf10 , мы показали, что сверхэкспрессия Fgf10 увеличивает эпителиальную пролиферацию, стимулирует дифференцировку клеток слизистой шеи и снижает дифференцировку париетальных и главных клеток во время гомеостаза желез желудка взрослых. Хотя потеря париетальных клеток и увеличение количества клеток, продуцирующих слизь, могут быть связаны с развитием метаплазии, мы не выявили какой-либо метаплазии у наших сверхэкспрессирующих Fgf10 мутантных мышей, как показано иммуноокрашиванием на два хорошо описанных маркера метаплазии: CDX2. (ИМ) [21] и HE4 (ИМ и СЭМ) [6].Наконец, повсеместная экспрессия доминантно-негативной растворимой формы Fgfr2b, основного рецептора FGF10, не выявила значительных изменений в пролиферации или дифференцировке желудочного эпителия у мутантов. Таким образом, это исследование демонстрирует, что передача сигналов FGF10-FGFR2b не требуется для гомеостаза железистого желудка взрослых.

Результаты

Экспрессия

Fgf10, его рецепторов, Fgfr1b и Fgfr2b и других лигандов FGFR2b в железистом желудке взрослых мышей

Чтобы изучить экспрессию Fgf10, его рецепторов, Fgfr1b и Fgfr2b и других лигандов FGFR2b в железистом желудке взрослых мышей, мы провели ОТ-ПЦР на железистом желудке взрослых мышей дикого типа (n = 3) .Оба рецептора экспрессировались в железистом желудке взрослых особей и в положительном контроле, целом эмбрионе мыши E14.5 дикого типа (рис. 1А). Гены, кодирующие все лиганды, связывающие FGFR2b ( Fgf1 , Fgf7 , Fgf10 , Fgf22 ), экспрессировались во взрослом железистом желудке, за исключением Fgf3 и Fg положительный контроль (рис. 1А). Отрицательные RT-контроли как для железистого желудка взрослого человека, так и для положительного контроля были отрицательными для Fgfr1b, Fgfr2b, всех лигандов FGFR2b и β-актина (рис. 1A).

Рисунок 1. Нормальная картина экспрессии его рецепторов Fgf10, и всех других лигандов FGFR2b в железистом желудке взрослого человека.

(A) ПЦР железистого желудка взрослого человека и целого эмбриона дикого типа E14.5 (положительный контроль). Отрицательные контроли RT для обоих были отрицательными. (B, E) Окрашивание β-галактозидазой железистого желудка взрослых мышей Fgf10 LacZ/+ (B) и мышей дикого типа Fgf10 +/+ (E). Экспрессия Fgf10 происходит только в мезенхиме.Иммуногистохимический анализ срезов железистого желудка дикого типа, окрашенных анти-FGFR1 (C) или анти-FGFR2 (D). (F, G) Окрашивание отрицательного контроля, в котором первичное антитело отсутствовало, показывает минимальный сигнал или его отсутствие. Окрашивание FGFR1 и FGFR2 является сильным по всему эпителию желудка, тогда как окрашивание мезенхимы намного слабее. Масштабная линейка составляет 50 мкм. M = мезенхима, GE = желудочный эпителий, L = просвет.

https://doi.org/10.1371/journal.pone.0049127.g001

Чтобы определить пространственный паттерн экспрессии Fgf10 , мы провели окрашивание β-галактозидазой срезов железистого желудка взрослого человека из Fgf10 LacZ/+ . репортерных мышей (n = 3), которые были ранее подтверждены [20], [22].Мы обнаружили, что экспрессия Fgf10 присутствовала в мезенхиме прямо под желудочными железами эпителия (рис. 1В). Отрицательные контроли (дикий тип Fgf10 +/+ , n = 3) не показали окрашивания LacZ (рис. 1E). Для подтверждения экспрессии рецепторов FGF10 в желудке взрослых мы провели иммуногистохимическое окрашивание на FGFR1 и FGFR2 железистого желудка взрослых мышей дикого типа (n = 3). Поскольку специфические антитела к изоформе IIIb этих рецепторов недоступны, были использованы антитела, которые реагируют как с изоформами IIIb, так и с изоформами IIIc каждого рецептора.Изоформа IIIb обычно экспрессируется в эпителии, тогда как изоформа IIIc обычно экспрессируется в мезенхиме. Как FGFR1, так и FGFR2 (рис. 1C и 1D соответственно) были идентифицированы по сильному иммуноокрашиванию эпителия желудка и более слабому окрашиванию мезенхимы. Наши отрицательные контроли не показали какого-либо специфического окрашивания (рис. 1F, 1G). Присутствие Fgf10 и его рецепторов в желудке взрослых мышей указывает на роль FGF10 в гомеостазе желудка. Следовательно, мы постулируем, что передача сигналов FGF10-FGFR2b во время гомеостаза желез взрослых, как и в предыдущих исследованиях, вероятно, является мезенхимально-эпителиальным сигналом.

Сверхэкспрессия Fgf10 во время гомеостаза изменяет гистологию желудочных желез и увеличивает эпителиальную пролиферацию в железистом желудке

Чтобы исследовать роль FGF10 во время гомеостаза железистого желудка взрослых, мы создали индуцируемых двойных трансгенных гетерозиготных мышей, которые повсеместно сверхэкспрессировали Fgf10 ( R26 rtTA/+ ; tet(O)Fgf10/+ далее). Сверхэкспрессию Fgf10 индуцировали скармливанием доксициклина взрослым (4-недельным) мутантным мышам и контрольным однопометным мышам в течение 10 дней до умерщвления.Сверхэкспрессия Fgf10 была подтверждена qRT-PCR, и мутанты показали значительное увеличение экспрессии Fgf10 по сравнению с контрольными однопометниками (рис. 2C). Мутантные мыши обычно имеют вид мокрых волос и очевидную пролиферацию кожного эпителия, включая отек век и аномально увеличенный язык.

Окрашивание гематоксилином и эозином срезов контрольного железистого желудка взрослых однопометников показало простой цилиндрический эпителий, организованный в желудочные железы, содержащие многочисленные париетальные клетки с большой эозинофильной цитоплазмой, главные клетки в основании желез с базофильной цитоплазмой, базально расположенными ядрами и апикальными секреторными клетками. гранулы и слизистые клетки шейки со слизью, видимые белым цветом в апикальной части клеток шейки желез (рис. 2А).Эта гистология была значительно изменена в железистом желудке взрослых мутантных мышей со сверхэкспрессией Fgf10 (рис. 2В). Наблюдалось видимое уменьшение популяции париетальных клеток с увеличением клеток, секретирующих слизь, и скоплением этих клеток ближе к основанию железы (черные стрелки).

Рисунок 2. Сверхэкспрессия Fgf10 во время гомеостаза изменяет гистологию желудочной железы, но не эпителиальную пролиферацию в железистом желудке.

(A–B) Окрашивание гематоксилином и эозином срезов железистого желудка взрослых особей контрольного помета ( R26 rtTA/+ ; tet(O)Fgf10/+ без dox) (A) и мутантных мышей Fgf10 со сверхэкспрессией ( R26 rtTA/+ ; tet(O)Fgf10/+ с доксом) (В).Видно уменьшение количества париетальных клеток и явное смещение клеток слизистой шейки с просветной стороны в сторону основания желудочной железы (черные стрелки). (C) qRT-PCR показывает значительное увеличение экспрессии Fgf10 у мутантов по сравнению с контролем (*p<0,05). (DE) PCNA-иммуноокрашивание срезов железистого желудка взрослых особей контрольного помета ( R26 rtTA/+ ; tet(O)Fgf10/+ без dox) (D) и мутантных мышей Fgf10 со сверхэкспрессией ( R26 rtTA/ + ; tet(O)Fgf10/+ с доксом) (Е).(F) Количественная оценка процента PCNA-позитивных эпителиальных клеток показала статистически значимое увеличение процента PCNA-позитивных эпителиальных клеток, указывающее на повышенную пролиферацию желудочного эпителия у мышей со сверхэкспрессией мутантного Fgf10 ( R26 rtTA/+ ; tet(O )Fgf10/+ с dox) по сравнению с контрольными однопометниками ( R26 rtTA/+ ; tet(O)Fgf10/+ без dox). Докс дали на 10 дней. Масштабная линейка составляет 50 мкм. M = мезенхима, GE = желудочный эпителий, L = просвет.

https://doi.org/10.1371/journal.pone.0049127.g002

Поскольку хорошо известно, что FGF10 способствует пролиферации в ряде органов, включая желудочно-кишечный тракт [13], [19], [20], [ 23], [24], мы проанализировали пролиферацию желудочного эпителия с помощью иммунного окрашивания PCNA у контрольных однопометников и мутантных мышей. По сравнению с контрольными однопометниками у мутантных железистых желудков наблюдалось значительное увеличение пролиферации эпителия (14.7±1,8% PCNA-позитивных эпителиальных клеток против 22,7±2,6% у мутантов, p = 0,017, n = 5 для каждого генотипа) (рис. 2D-F). Наши данные показали, что сверхэкспрессия FGF10 способствует пролиферации клеток в эпителии железистого желудка взрослых мышей.

Дифференцировка эпителия желудка значительно изменена сверхэкспрессией

Fgf10 во время гомеостаза

Чтобы дополнительно определить роль FGF10 в эпителиальной дифференцировке во время гомеостаза железистого желудка взрослого человека, мы провели иммуноокрашивание маркеров дифференцированных эпителиальных клеток желудка в мутантных и контрольных желудках.Клетки слизистой шейки в железистом желудке идентифицировали с помощью лектина GSI-II, который ранее был установлен в качестве маркера клеток слизистой шейки [25], [26], [27]. Сверхэкспрессия Fgf10 приводила к увеличению на 85% процентного содержания клеток слизистой шейки в эпителии желудка мутантных мышей (рис. 3В) по сравнению с контрольными однопометниками (рис. 3А) (14,4±1,7% против 7,8±0,5%, p = 0,003, n = 5 для каждого генотипа) (рис. 3C). Кроме того, GS-II-положительные клетки располагались ближе к основанию желез у мутантных мышей по сравнению с контрольной группой.Это подтверждает наши гистологические данные и указывает на то, что FGF10 может способствовать дифференцировке линии клеток слизистой шеи. Внутренний фактор (IF) иммуноокрашивал главные клетки в основании желудочных желез. Хотя IF продуцируется и высвобождается париетальными клетками человека, он является установленным маркером главных клеток у грызунов [21], [28], [29]. Наши результаты показали значительное уменьшение количества главных клеток в желудочном эпителии мутантов (рис. 3E) по сравнению с контрольными однопометниками (рис. 3D) (5.2±1,4% против 12,4±1,7%, p = 0,006, n = 5 для каждого генотипа) (рис. 3F). Хромогранин А представляет собой кислый гликопротеин, экспрессируемый во многих типах нейроэндокринных клеток по всему желудочно-кишечному тракту, включая желудок [11], [21], [30], [31]. В желудке хромогранином А отмечено небольшое количество эпителиальных клеток, разбросанных по желудочным железам. Мы не обнаружили существенной разницы в процентном содержании эндокринных клеток в желудочном эпителии между мутантами (рис. 3H) и контролем (рис. 3G) (1.0±0,5% против 1,7±0,3%, p = 0,11, n = 5 для каждого генотипа) (рис. 3I). На фигурах 3J-K показано иммуноокрашивание париетальных клеток H/K-АТФазой в желудочной железе. Наблюдается заметное уменьшение линии париетальных клеток (уменьшение на 35%) у мутантов (рис. 3K) по сравнению с контролем (рис. 3J), как показано на рис. 3L (23,2±4,6% против 35,5±4,3%, p = 0,044). , n = 5 для каждого генотипа). Эти данные свидетельствуют о том, что FGF10 играет роль в дифференцировке клонов эпителиальных клеток слизистой оболочки желудка, главных клеток и париетальных клеток во время гомеостаза железистого желудка взрослых.Сверхэкспрессия Fgf10 не только значительно изменяет количество этих дифференцированных типов эпителиальных клеток, как описано выше, но также изменяет расположение клеток слизистой шейки от шеи до основания желудочной железы.

Рисунок 3. Дифференцировка эпителия желудка значительно изменена сверхэкспрессией Fgf10 во время гомеостаза. и мутантные мыши Fgf10 со сверхэкспрессией ( R26 rtTA/+ ; tet(O)Fgf10/+ с dox) (B,E,H,K).(A-B) Клетки слизистой шеи идентифицированы с помощью GSII, и (C) количественная оценка показывает значительное увеличение мутантных Fgf10 сверхэкспрессирующих мышей по сравнению с контрольными однопометниками (*p<0,05). (D, E) главные клетки отмечены внутренним фактором, а количественная оценка (F) показывает значительное уменьшение числа главных клеток (*p<0,05). (G, H) Эндокринные клетки идентифицируются по хромогранину А, а (I) количественная оценка не демонстрирует значительных изменений в количестве эндокринных клеток. (J,K) Париетальные клетки визуализируются с помощью иммуноокрашивания H/K-АТФазы, а (L) количественная оценка демонстрирует значительное снижение у мышей со сверхэкспрессией мутантного Fgf10 по сравнению с контрольными однопометниками (*p<0.05). Докс дали на 10 дней. Масштабная линейка составляет 50 мкм. GE = желудочный эпителий, L = просвет.

https://doi.org/10.1371/journal.pone.0049127.g003

Fgf10 сверхэкспрессия при гомеостазе не вызывает метаплазию желудочного эпителия

Кишечная метаплазия (КМ) и спазмолитическая полипептид-экспрессирующая метаплазия (СПЭМ) представляют собой метаплазии желудочного эпителия, которые обычно развиваются после острой оксинтической атрофии и приводят к увеличению количества секретирующих слизь клеток: бокаловидных клеток кишечника при КМ или клеток шейки слизистой оболочки при СЭМ [32].В настоящее время считается, что потеря париетальных клеток приводит к трансдифференцировке зрелых главных клеток в дополнение к ингибированию дифференцировки нормальных клеток слизистой шейки в главные клетки [5], [21], [33]. Поскольку мутантные мыши продемонстрировали сходный фенотип со значительной потерей париетальных клеток, увеличением клеток слизистой шеи и уменьшением количества главных клеток, мы стремились исследовать, может ли сверхэкспрессия Fgf10 вызывать метаплазию. Чтобы подтвердить наличие метаплазии у наших мутантных мышей, мы провели иммунное окрашивание на два хорошо зарекомендовавших себя маркера метаплазии как у мышей, так и у людей: CDX2 (IM) [21] и HE4 (IM и SPEM) [6].Оба мутанта (рис. 4C) и однопометные контрольные желудки (рис. 4B) не продемонстрировали заметного окрашивания CDX2 в желудочном эпителии (n = 3 для каждого генотипа). Толстая кишка служила положительным контролем и показала соответствующее ядерное окрашивание для CDX2 (рис. 4А). Точно так же не наблюдалось окрашивания HE4 в желудочном эпителии мутантов (рис. 4F) и контрольных однопометников (рис. 4E) (n = 3 для каждого генотипа). Эпидидимис человека служил положительным контролем и имел видимое цитоплазматическое окрашивание на HE4 (рис. 4D).Эти результаты свидетельствуют о том, что хотя сверхэкспрессия Fgf10 может приводить к SPEM-подобному фенотипу, желудочный эпителий не является метапластическим.

Рисунок 4. Сверхэкспрессия Fgf10 при гомеостазе не вызывает метаплазии желудочного эпителия.

(A–C) CDX2, маркер кишечной метаплазии (IM), иммуноокрашивание в толстой кишке взрослого человека (положительный контроль) (A), контрольный однопометник ( R26 rtTA/+ ; tet(O)Fgf10/+ без dox) (B) и мутантные мыши Fgf10 со сверхэкспрессией ( R26 rtTA/+ ; tet(O)Fgf10/+ с dox) (C).(DF) HE4, маркер экспрессирующей спазмолитический полипептид метаплазии (SPEM), иммуноокрашивание придатка яичка человека (положительный контроль) (D), контрольный однопометник ( R26 rtTA/+ ; tet(O)Fgf10/+ без dox) (E) и мутантные мыши Fgf10 со сверхэкспрессией ( R26 rtTA/+ ; tet(O)Fgf10/+ ) (F). Докс дали на 10 дней. Масштабная линейка составляет 50 мкм.

https://doi.org/10.1371/journal.pone.0049127.g004

Опосредованная FGF10-FGFR2b передача сигналов не требуется для пролиферации и дифференцировки эпителия желудка во время гомеостаза

Чтобы определить важность сигнальной оси FGF10-FGFR2b во время гомеостаза железистого желудка взрослых, мы создали индуцируемых двойных трансгенных гетерозиготных мышей, которые повсеместно экспрессируют доминантно-негативную растворимую форму Fgfr2b ( R26 rtTA/+ ; tet (O)sFgfr2b/+ в дальнейшем).Экспрессию sFgfr2b индуцировали путем кормления доксициклином взрослых (4-недельных) мутантных мышей и контрольных однопометников в течение 1 месяца до умерщвления. Экспрессия sFgfr2b у мутантных мышей была подтверждена с помощью qRT-PCR. Контроли имели почти неопределяемое количество sFgfr2b , в то время как мутанты имели переменную, но устойчивую экспрессию (фиг. 5C). Экспрессия sFgfr2b действует доминантно-негативным образом, связывая все лиганды FGFR2b (FGF-1, -3, -7, -10, -20, -22) и предотвращая их действие.Это было ранее подтверждено в нашей лаборатории, где мы продемонстрировали, что индуцируемая экспрессия sFgfr2b во время эмбрионального развития фенокопирует Fgfr2b -/- эмбрионов [34], тогда как одиночные трансгенные эмбрионы, подвергшиеся воздействию dox, и двойные трансгенные эмбрионы, не подвергшиеся воздействию dox были идентичны эмбрионам дикого типа [35]. В отличие от тяжелого фенотипа, когда FGFR2b инактивируется во время эмбриогенеза, постнатальная экспрессия sFgfr2b приводит только к незначительным дефектам, включая дефекты резцов, более длинные когти и редуцированную белую жировую ткань [36].

Окрашивание гематоксилином и эозином срезов контрольных однопометных (рис. 5А) и мутантных (рис. 5В) железистых желудков взрослых особей выявило нормальную гистологию с соответствующей архитектурой желудочных желез, и они были неотличимы друг от друга. Было показано, что опосредованная FGF10-FGFR2b передача сигналов необходима для эпителиальной пролиферации во время развития как желудка, так и толстой кишки [13], [19], [20]. Чтобы убедиться, что передача сигналов FGF10-FGFR2b также необходима для пролиферации эпителия желудка во время гомеостаза, было проведено иммунное окрашивание на PCNA в контрольных однопометниках (рис. 5D) и мутантных (рис. 5E) железистых желудках взрослых особей.Не было разницы в скорости пролиферации между контрольными однопометниками и мутантами (16,5 ± 1,7% против 15,3 ± 1,5%, p-значение   =   0,313, n   =   5 для каждого генотипа) (рис. 5F).

Рисунок 5. Опосредованная FGF10-FGFR2b передача сигналов не требуется для нормальной гистологии желудка и эпителиальной пролиферации во время гомеостаза.

Окрашивание гематоксилином и эозином срезов железистого желудка взрослых особей контрольного помета ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (A) и мутантных мышей ( R26 rtTA/+ ; tet(O)sFgfr2b/+ с dox) (B) показывает нормальную гистологию желудка.(C) qRT-PCR, подтверждающая устойчивую экспрессию sFgfr2b у мутантов по сравнению с контролями, где уровень sFgfr2b почти не обнаруживается. Иммуноокрашивание PCNA срезов железистого желудка взрослых контрольных однопометников ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (D) и мутантных мышей ( R26 rtTA/+ ; tet(O) sFgfr2b/+ с dox) (E) и (F) количественная оценка процента PCNA-позитивных эпителиальных клеток, показывающая отсутствие значительных изменений в пролиферации желудочного эпителия у мутантных мышей по сравнению с контрольными однопометниками.Докс дали на 1 месяц. Масштабная линейка составляет 50 мкм. M = мезенхима, GE = желудочный эпителий, L = просвет.

https://doi.org/10.1371/journal.pone.0049127.g005

Ранее было показано, что передача сигналов FGF10-FGFR2b необходима для дифференцировки эпителия во время желудочного органогенеза, особенно для развития линии париетальных клеток [13]. ] мы стремились определить, требуется ли передача сигналов, опосредованная FGF10-FGFR2b, для дифференцировки желудочного эпителия во время гомеостаза.Срезы железистого желудка из R26 rtTA/+ ; Мутантные мыши tet(O)sFgfr2b/+ и контрольные однопометники были иммуноокрашены маркерами дифференцированных эпителиальных клеток желудка. Не было разницы в процентном содержании клеток слизистой шейки (7,5±0,8% против 8,0±0,8%, p = 0,35, n = 5 для каждого генотипа) (рис. 6A–C), главных клеток (11,3±1,6% против 12,2±1,5%, p = 0,35, n = 5 для каждого генотипа) (рис. 6D–F), эндокринные клетки (1,9±0,3% против 2,4±0,4%, p = 0,22, n = 5 для каждого генотипа) (рис. 6G-I), или париетальные клетки желудочного эпителия (36.4±2,7% против 37,7±3,5%, p = 0,38, n = 5 для каждого генотипа) (рис. 6J-K), между однопометными контрольными и мутантными желудками. Взятые вместе, эти результаты предполагают, что передача сигналов FGFR2b не требуется для пролиферации и дифференцировки желудочного эпителия во время гомеостаза.

Рисунок 6. Опосредованная FGF10-FGFR2b передача сигналов не требуется для дифференцировки эпителия желудка во время гомеостаза.

Клетки шейки слизистой маркированы иммуноокрашиванием GSII срезов железистого желудка взрослых особей контрольного помета ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (A) и мутантных мышей ( R26 rtTA /+ ; tet(O)sFgfr2b/+ с dox) (B) и (C) количественная оценка не выявила различий в количестве клеток слизистой шейки.Главные клетки идентифицируют иммуноокрашиванием внутреннего фактора срезов железистого желудка взрослых контрольных однопометников ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (D) и мутантных мышей ( R26 rtTA/+ ; tet(O)sFgfr2b/+ с dox) (E) и (F) количественная оценка не выявила значительных изменений в количестве главных клеток. (G, H) Эндокринные клетки идентифицируются по хромогранину А, и (I) количественная оценка не показывает значительных изменений у мышей со сверхэкспрессией мутанта sFgfr2b по сравнению с контрольными однопометниками.Париетальные клетки идентифицируют иммуноокрашиванием H/K-АТФазой срезов железистого желудка взрослых контрольных однопометников ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (J) и мутантных мышей ( R26 rtTA /+ ; tet(O)sFgfr2b/+ с dox) (K) и (L) количественная оценка не выявила значительных изменений количества париетальных клеток. Докс дали на 1 месяц. Масштабная линейка составляет 50 мкм. GE = желудочный эпителий, L = просвет.

https://doi.org/10.1371/journal.pone.0049127.g006

Поскольку продолжительность жизни париетальной клетки составляет 54 дня [37], потребовалось более длительное исследование, чтобы подтвердить необходимость опосредованной FGF10-FGFR2b передачи сигналов для дифференцировки париетальных клеток во время гомеостаза железистого желудка взрослого человека. Чтобы добиться этого, мы индуцировали повсеместную сверхэкспрессию доминантно-негативного sFgfr2b путем кормления доксициклином взрослых (4-недельных) мутантных мышей и контрольных однопометников в течение 3 месяцев до умерщвления. Экспрессия sFgfr2b у мутантных мышей была значительно выше, чем у контрольных, как показано с помощью qRT-PCR (фиг. 7C).Окрашивание гематоксилином и эозином срезов контрольных однопометников (рис. 7А) и мутантных (рис. 7В) железистых желудков взрослых продемонстрировало нормальную гистологию с видимыми париетальными клетками. Не было никакой разницы в процентном содержании париетальных клеток в желудочном эпителии мутантов (рис. 7E) по сравнению с контролем (рис. 7D), о чем свидетельствует иммуноокрашивание H/K-АТФазы (37,9 ± 4,4% против 34,8 ± 1,9%, p- значение = 0,277, n = 3 для каждого генотипа) (рис. 7F). Эти результаты подтверждают, что опосредованная FGF10-FGFR2b передача сигналов не требуется для дифференцировки париетальных клеток во время гомеостаза железистого желудка взрослых.

Рисунок 7. Опосредованная FGF10-FGFR2b передача сигналов не требуется для дифференцировки париетальных клеток во время гомеостаза.

Окрашивание гематоксилином и эозином срезов железистого желудка взрослых особей контрольного помета ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (A) и мутантных мышей ( R26 rtTA/+ ; tet(O)sFgfr2b/+ с dox) (B) показывает нормальную гистологию желудка. (C) qRT-PCR, подтверждающая значительное увеличение экспрессии sFgfr2b у мутантов по сравнению с контролем (*p<0.05). Париетальные клетки идентифицируют иммуноокрашиванием H/K-АТФазой срезов железистого желудка взрослых контрольных однопометников ( R26 +/+ ; tet(O)sFgfr2b/+ с dox) (D) и мутантных мышей ( R26 rtTA /+ ; tet(O)sFgfr2b/+ с dox) (E) и (F) количественная оценка не выявила значительных изменений количества париетальных клеток. Докс дали на 3 месяца. Масштабная линейка составляет 50 мкм. M = мезенхима, GE = желудочный эпителий, L = просвет.

https://дои.org/10.1371/journal.pone.0049127.g007

Обсуждение

Передача сигналов, опосредованная FGF10-FGFR2b, необходима для эмбрионального развития желудка [11], [13], [23]. Однако мало что известно о роли передачи сигналов FGF10-FGFR2b при поддержании зрелого желудочного эпителия. Мы стремились понять передачу сигналов, опосредованную FGF10-FGFR2b, во время гомеостаза железистого желудка взрослых. Двойные трансгенные мыши, повсеместно сверхэкспрессирующие Fgf10 , демонстрируют повышенную эпителиальную пролиферацию и значительно изменяют дифференцировку трех из четырех клонов эпителиальных клеток в желудке.Однако двойные трансгенные мыши, сверхэкспрессирующие растворимую форму Fgfr2b, главного рецептора FGF10, показали, что передача сигналов FGF10-FGFR2b не является необходимой для эпителиальной пролиферации и дифференцировки.

Мы обнаружили, что Fgf10 , его рецепторы, Fgfr1b и Fgfr2b , и большинство других лигандов FGFR2b ( Fgf-1, -7, -22 ) присутствовали в желудке взрослого человека. Эти результаты подтверждаются экспрессией этих генов во время желудочного органогенеза у мышей [11] и куриных эмбрионов [12], [23].Несмотря на некоторые различия в экспрессии между мышиными и куриными эмбрионами, желудочная экспрессия Fgf10 и его основного рецептора Fgfr2b остается консервативной между видами, и оба присутствуют во время развития и гомеостаза. Основным рецептором для FGF10 является FGFR2b [38], [39], и инактивация Fgf10 или Fgfr2b у эмбрионов мышей приводит к удивительно сходным фенотипам [34], [40], тогда как FGF10 связывает FGFR1b с более низким сродством [41]. ]. Однако присутствие как Fgfr1b , так и Fgfr2b , а также некоторых лигандов FGFR2b ( Fgf-1, -7, -10, и -22) во взрослом желудке может обеспечивать некоторую внутреннюю избыточность. в передаче сигналов FGF.Определенно, экспрессия Fgf10 и его рецептора, Fgfr2b , в желудке взрослых предполагает, что передача сигналов FGF10-FGFR2b происходит постнатально.

Многочисленные исследования признали FGF10 в качестве промотора эпителиальной пролиферации во время развития трахеи [42], толстой кишки [19], [20] и желудка [13], [23], а также постнатально во время развития молочной железы [36] и резца [36]. 35] гомеостаз. Многие из них характеризуют подход с потерей функции, демонстрируя снижение эпителиальной пролиферации в Fgf10 -/- [13], [20], [42] и/или Fgfr2b -/- [13], [ 19], а также у трансгенных мышей со сверхэкспрессией растворимого Fgfr2b [35], [36].Только в двух предыдущих исследованиях сообщается о подходе с усилением функции, подобном нашему, при изучении эффектов сверхэкспрессии Fgf10 во время желудочного органогенеза с противоречивыми результатами [11], [23]. Шин и др. продемонстрировали умеренное увеличение пролиферации железистого эпителия в желудке куриного эмбриона с вирусно-опосредованной сверхэкспрессией Fgf10 по сравнению с неинфицированным контролем [23]. Наши результаты согласуются с этими результатами в органогенезе, хотя мы изучаем гораздо более позднюю временную точку, когда мы демонстрируем, что FGF10 оказывает митогенный эффект во время гомеостаза желудка взрослых.

Кроме того, FGF10 играет важную роль в дифференцировке эпителия при развитии многих органов [13], [42], [43], [44]. В частности, во время желудочного органогенеза потеря опосредованной FGF10-FGFR2b передачи сигналов приводит к полному отсутствию париетальных клеток [13]. Это указывает на то, что опосредованная FGF10-FGFR2b передача сигналов необходима для дифференцировки париетальных клеток во время развития желудка, и, тем не менее, сверхэкспрессия Fgf10 в этот же период времени также оказывает негативное влияние на париетальные клетки с 78% снижением на ст. E18.5 [11]. Интересно, что мы обнаружили, что FGF10-FGFR2b-опосредованная передача сигналов не требуется для дифференцировки париетальных клеток во время гомеостаза желудка взрослых, но избыточная экспрессия Fgf10 вызывает такое же снижение линии париетальных клеток, как это происходит во время органогенеза. Т.о., высокие уровни FGF10 подавляют дифференцировку париетальных клеток как во время развития желудка, так и во время гомеостаза, но как только органогенез желудка завершен, передача сигналов, опосредованная FGF10-FGFR2b, по-видимому, не требуется для дифференцировки париетальных клеток.

Эндокринные клетки представляют собой небольшую, но гетерогенную популяцию клеток, секретирующих различные гормоны в желудочном эпителии. Судьба терминальных эндокринных клеток, по-видимому, не зависит от потери опосредованной FGF10-FGFR2b передачи сигналов во время развития [13]; однако эктопическая сверхэкспрессия Fgf10 приводит к значительному подавлению клона эндокринных клеток [11]. В отличие от этих исследований развития, мы не наблюдали каких-либо изменений в дифференцировке эндокринных клеток при сверхэкспрессии либо Fgf10 , либо растворимого Fgfr2b во время гомеостаза желудка.

Опосредованная

FGF10-FGFR2b передача сигналов способствует дифференцировке главных клеток во время органогенеза желудка, о чем свидетельствует снижение количества главных клеток в желудке Fgf10 -/- и Fgfr2b -/- E18.5 [13] и увеличение в главных клетках желудка с эктопической сверхэкспрессией Fgf10 [11]. Напротив, мы наблюдали значительное снижение главных клеток при сверхэкспрессии Fgf10 в железистом гомеостазе желудка взрослых.Мы идентифицировали главные клетки с помощью иммунного окрашивания на внутренний фактор, а эти предыдущие исследования окрашивали на пепсиноген [11], [13], но оба являются хорошо известными маркерами главных клеток у мышей [21], [28], [29], [45]. ] и различия в иммуногистохимическом окрашивании сами по себе вряд ли объясняют это наблюдение. Возможно, что во время гомеостаза уровни Fgf10 оказывают неблагоприятное воздействие на главные клетки, в отличие от стадий развития.

Известно, что передача сигналов, опосредованная FGF10-FGFR2b, не требуется для дифференцировки слизистых клеток во время развития желудка [13], и мы обнаружили, что то же самое верно во время гомеостаза.Однако в предыдущих исследованиях было показано, что FGF10 либо индуцирует количество секретирующих слизь клеток [24], либо смещает расположение клеток в желудочной железе от просвета к основанию железы [11], [23]. Мы наблюдали оба явления во время гомеостаза железистого желудка взрослых. Этот фенотип в сочетании с потерей париетальных клеток часто описывается как «антрализация» и наблюдается при желудочной метаплазии, такой как IM и/или SPEM. Потеря париетальных клеток обычно приводит к метаплазии [4], [32], [33].Во время этого процесса главные клетки трансдифференцируются, теряя экспрессию MIST1 и приобретая экспрессию CDX2 в IM или TFF2 в SPEM [21], [33]. Возможно, уменьшение числа главных клеток в нашей модели связано с трансдифференцировкой, однако для подтверждения этого потребуются дальнейшие исследования.

Мы не первые, кто наблюдал SPEM-подобный фенотип в ассоциации с передачей сигналов FGF10. Спенсер-Ден и др. продемонстрировали непропорционально недоразвитый антральный отдел с увеличенным простым неразветвленным желудочным эпителием как для Fgf10 -/- , так и для Fgfr2b -/- эмбрионов, что указывает на роль опосредованной FGF10-FGFR2b передачи сигналов в содействии антрализации [13].Более того, сверхэкспрессия Fgf10 во время развития желудка приводила к SPEM-подобному фенотипу со сдвигом в локализации мРНК TFF2 у мышей и мРНК cSP у цыплят, в дополнение к уменьшению числа париетальных клеток у мышей. 11], [23]. cSP является маркером просветных эпителиальных клеток у кур, аналогом клеток слизистой шеи у мышей [8]. Ниенг и др. предположили, что антрализация тела в их модели может быть объяснена повышенной доступностью FGF10 в теле по сравнению с нормальным градиентом экспрессии Fgf10 , который выше в антральном отделе и ниже в теле [11].Это также может объяснить SPEM-подобный фенотип, наблюдаемый во время гомеостаза, поскольку Fgf10 повсеместно гиперэкспрессировался в нашей модели. Несмотря на сверхэкспрессию Fgf10 , приводящую к SPEM-подобному фенотипу, хорошо зарекомендовавшие себя маркеры не смогли подтвердить метаплазию во время гомеостаза, как сообщалось аналогичным образом во время развития желудка [11]. Следовательно, мы не можем исключить возможность того, что передача сигналов FGF10-FGFR2b может играть роль в желудочной метаплазии. Фактически, ETV4, нижестоящая мишень FGF10, активируется в образцах гастроаденокарциномы человека и связан со снижением выживаемости [46], [47].Поскольку SPEM часто возникает в результате потери париетальных клеток, а средняя продолжительность жизни париетальных клеток составляет примерно 54 дня [37], только 10 дней избыточной экспрессии Fgf10 могут не вызвать достаточную потерю париетальных клеток и последующую метаплазию. Возможно, для обнаружения маркеров метаплазии в нашей модели гомеостаза требуется более высокий уровень экспрессии Fgf10 и/или более длительное время воздействия. При заражении мышей Helicobacter felis СПЭМ не развивается в течение 4–6 мес [4].К сожалению, нам не удалось сверхэкспрессировать Fgf10 в течение более 10 дней, поскольку у мышей развилась системная токсичность. Необходимы дополнительные исследования, чтобы подтвердить связь между передачей сигналов, опосредованной FGF10-FGFR2b, и метаплазией. Использование специфичной для желудка сверхэкспрессии может быть рассмотрено в будущих исследованиях для продления воздействия.

В заключение, эти результаты впервые демонстрируют роль опосредованной FGF10-FGFR2b передачи сигналов во время гомеостаза железистого желудка взрослых.Сверхэкспрессия Fgf10 влияет как на пролиферацию, так и на дифференцировку желудочного эпителия. FGF10 способствует дифференцировке клеток слизистой оболочки шеи, подавляя дифференцировку париетальных и главных клеток, создавая SPEM-подобный фенотип; но не вызывает метаплазию. Несмотря на доказательства роли опосредованной FGF10-FGFR2b передачи сигналов во время гомеостаза желудка, ингибирование передачи сигналов FGFR2b не нарушало пролиферацию или дифференцировку желудочного эпителия. Это предполагает, что FGF10 может действовать через другой рецептор, такой как FGFR1b, во время гомеостаза желудка.Т.о., передача сигналов, опосредованная FGF10-FGFR2b, не требуется во время гомеостаза железистого желудка взрослых.

Материалы и методы

Заявление об этике

Все экспериментальные протоколы соответствовали рекомендациям, изложенным в Руководстве по уходу и использованию лабораторных животных Национального института здравоохранения. Протокол был одобрен Институциональным комитетом по уходу за животными и их использованию в детской больнице Лос-Анджелеса (протокол IACUC № 193). Все мыши, включенные в это исследование, были гуманно усыплены путем воздействия CO 2 в ингаляционной камере.

Мыши

Все животные содержались в приюте для животных Saban в Научно-исследовательском институте Saban при детской больнице Лос-Анджелеса, Лос-Анджелес, Калифорния. Животных содержали в среде с регулируемой температурой при 12-часовом цикле свет-темнота и давали доступ к корму и воде вволю . Мыши дикого типа представляли собой мышей C57Bl/6 из лаборатории Джексона.

ПКР

РНК выделяли из железистого желудка взрослых мышей дикого типа (C57Bl/6) (n = 3) и Е14.5 цельных эмбрионов мыши дикого типа (n = 2) с использованием набора для выделения РНК Qiagen (Qiagen, Валенсия, Калифорния). Набор для синтеза кДНК iScript TM (BioRad, Hercules, CA) использовали для синтеза кДНК. Все реакции ПЦР проводили в соответствии с инструкциями производителя с использованием либо Taq PCR Master Mix (Qiagen, Valencia, CA), либо 2x MyTaq Red mix (Bioline, Tauton, MA) в термоциклере C1000 TM (BioRad, Hercules, CA). . Праймеры были разработаны специально для связывания интрона с использованием веб-сайта Национального центра биотехнологической информации (NCBI) (http://www.ncbi.nlm.nih.gov/). Использовали следующие последовательности праймеров: (прямая 5′-3′, обратная 5′-3′): Fgfr1b CTTGACGTCGTGGAACGATCT, CCACAGGTCTGGTGACAGTGA; Fgfr2b AACGGGAAGGAGGTTTAAGCAG, GGACAGTGAGCCAGGCAG; Fgf1 ACCTTCGCAGCCCTGACCGA, GACCGCGCTTACAGCTCCCG; Fgf3 CCATGAACAAGAGAGGACGGCTGTATG, TCTGCAGCAGCCGCACCATCTC; Fgf7 TCTGCTCTACAGATCATGC, TAGGTTATTGCCATAGGAA; Fgf10 CACATTGTGCCTCAGCCTTTCC, CCTGCCATTGTGCTGCCAGTTAA; Fgf20 GGGACCTCACAGGAGTAACCCA, TGCGACCCGTGTCTCCATGT; Fgf22 CGCATCTGGAGGGCGACGTG, CCACAGAGTAGACCCGCGACCC.

Анализ экспрессии LacZ

Fgf10 Mlc-nlacZ-v24 мышей [48] (далее Fgf10 lacZ ) содержали на смешанном фоне агути. Образцы кратковременно фиксировали в 4% PFA. Экспрессия lacZ на Fgf10 lacZ/+ (n = 3) и диком типе Fgf10 +/+ мышей (n = 3) железистого желудка взрослых мышей контролировали с помощью β-галактозидазы. /мл диметилформамида в 5 мМ K3Fe(CN)6/5 мМ K4Fe(CN)6/2 мМ MgCl2 в D-PBS (pH 7.4), как описано ранее [49]. Затем эти образцы заливали парафином, делали срезы с интервалом 5 мкм и помещали на предметные стекла. Предметные стекла депарафинизировали, контрастно окрашивали ядерным стойким красным, обезвоживали, очищали с помощью гистоселекции и монтировали с Permount (Fisher Scientific, Fair Lawn, New Jersey).

Поколение R26

rtTA ; tet(O)Fgf10 и R26 rtTA ; мыши tet(O)sFgfr2b

Для получения мышей, которые экспрессируют rtTA под вездесущим промотором Rosa26 (R26), мышей CMV Cre [50] скрещивали с мышами R26 rtTA [51].Респондентную линию tet(O)Fgf10 [52] затем скрещивали с этой конститутивной линией мышей rtTA для получения двойных трансгенных гетерозиготных животных ( R26 rtTA/+ ; tet(O)Fgf10/+ ). Эти мыши повсеместно сверхэкспрессируют Fgf10 при индуцировании доксициклином. Конститутивную линию мышей rtTA также скрещивали с tet(O) растворимой респондерной линией Fgfr2b [53] для получения двойных трансгенных гетерозиготных животных ( R26 rtTA/+ ; tet(O)sFgfr2b/+ ), которые повсеместно экспрессировать доминантно-негативный sFgfr2b [54], как описано и подтверждено ранее [35], [36].Все мыши были созданы на смешанном фоне CD1 и генотипированы, как описано ранее [50], [51], [52], [53]. Индуцируемая повсеместная сверхэкспрессия Fgf10 или sFgfr2b у мутантных мышей была достигнута путем введения корма, содержащего доксициклин (диета для грызунов с 0,0625% доксициклина, Harlan Teklad TD01306) (далее называемая dox).

Для сверхэкспрессии в экспериментах Fgf10 взрослым мышам с двойной трансгенной мутацией (4-недельного возраста) ( R26 rtTA/+ ; tet(O)Fgf10/+) вводили докс в течение 10 дней.Двойные трансгенные однопометники ( R26 rtTA/+ ; tet(O)Fgf10/+) без dox использовали в качестве контроля. В общей сложности три мутанта и три контроля были использованы для исследования гистологии, пролиферации и дифференцировки эпителия и метаплазии.

Что касается сверхэкспрессии sFgfr2b , взрослым мышам с двойной трансгенной мутацией (4-недельного возраста) ( R26 rtTA/+ ; tet(O)sFgfr2b/+) вводили докс в течение 1 или 3 месяцев. . Единичных трансгенных однопометников ( R26 +/+ ; tet(O)sFgfr2b/+) с dox использовали в качестве контроля.Для исследования гистологии, эпителиальной пролиферации и дифференцировки для каждого периода времени использовали всего три мутанта и три контроля.

Коллекция тканей

Взрослый железистый желудок от контрольных и мутантных мышей собирали по завершении введения dox (10 дней для сверхэкспрессии Fgf10 (n = 5 контролей, n = 5 мутантов) и 1 месяц (n = 5 контролей, n = 5 мутанты) и 3 месяца (n = 3 контроля, n = 3 мутанта) для сверхэкспрессии sFgfr2b ).Приблизительно 30 мг ткани сохраняли в РНК Later® (Sigma-Aldrich, Сент-Луис, Миссури) для qRT-PCR. Оставшуюся ткань фиксировали в 10% формалине и заливали в парафин. Железистый желудок взрослых мышей дикого типа (C57Bl/6) (n = 3) также фиксировали в 10% формалине и заливали в парафин. Всю ткань, залитую парафином, делали серийные срезы с интервалом 5 мкм и помещали на предметные стекла для анализа окрашивания.

Экстракция РНК и количественная ОТ-ПЦР (qRT-PCR)

РНК выделяли из железистых желудков контрольных и мутантных мышей с использованием набора Qiagen RNAeasy (Qiagen, Valencia, CA) в соответствии с инструкциями производителя.Nano Drop ND-1000 использовали для определения концентрации очищенной РНК.

РНК (1 мкг) подвергали обратной транскрипции с использованием набора для синтеза кДНК iScript TM (BioRad, Hercules, CA) в соответствии с указаниями производителя. 2 мкл кДНК использовали для каждой из реакций qRT-PCR с использованием праймеров и зондов, разработанных онлайн-программным обеспечением Roche: Probe finder, версия 2.20, https://www.roche-applied%1Escience.com/sis/rtpcr/upl/adc. .jsp. Использовали следующие праймеры и соответствующие зонды (прямой 5′-3′, обратный; 5′-3′, зонд №): Fgf10 CGGGACCAAGAATGAAGACT, AACAACTCCGATTTCCACTGA, зонд 80; sFgfr2b GAAGGAGATCACGGCTTCC, AGACAGATGATACTTCTGGGACTGT, зонд 108.Все реакции qRT-PCR проводили с помощью наборов Roche FastStart TaqMan® Probe Master в соответствии с инструкциями производителя на машине Roche Light Cycler 1.5 Real-Time PCR. Каждую реакцию проводили трижды, и уровни экспрессии представляющих интерес генов нормализовали до уровней Gapdh.

Иммунофлюоресцентное окрашивание

Предметные стекла депарафинизировали и регидратировали последовательным концентрированием этанола до воды. Стадия извлечения антигена выполнялась путем кипячения предметных стекол в микроволновой печи в течение 12 минут в 10 мМ натрий-цитратном буфере с рН = 6.0 (PCNA, GSII, CGA, IF, H/K-АТФаза, HE4). Предметные стекла блокировали универсальным блокирующим раствором с 2% козьей или ослиной сывороткой в ​​течение 30 минут с последующей инкубацией с первичными антителами, разведенными в универсальном блокирующем растворе с 2% козьей или ослиной сывороткой, в течение ночи при 4°С. Первичные антитела включали: ядерный антиген антипролиферативных клеток мыши (PCNA) (1∶100, Vector Laboratories), антихромогранин A кролика (CGA) (1∶100, ABcam), козий анти-внутренний фактор (IF) (1∶ 2000 г., подарок Джейсона Миллса, Вашингтонский университет, Сент-Луис.Louis, Миссури), мышиный анти-H/K-АТФаза β (H/K-АТФаза) (1∶100, ABcam) и кроличий анти-HE4 (1∶50, ABcam). Затем предметные стекла инкубировали со вторичным антителом, разведенным в универсальном блокирующем растворе, в течение одного часа при комнатной температуре. Вторичные антитела включали: конъюгированные с Cy3 козьи антикроличьи или мышиные антитела (1∶200), конъюгированные с Cy3 ослиные антикозьи антитела (1∶200) или лектин GS-II из Griffonia simplicifolia , конъюгат Alexa Fluor® 488 (GS-II). ) (1∶2000, Invitrogen). Слайды монтировали с использованием Vectashield с DAPI (Vector Laboratories).Изображения были получены с помощью цветной камеры, прикрепленной к вертикальному флуоресцентному микроскопу (Leica DM5500).

Иммуногистохимия

Предметные стекла депарафинизировали и регидратировали последовательным концентрированием этанола до воды. Стадия извлечения антигена выполнялась путем кипячения предметных стекол в микроволновой печи в течение 12 минут либо в трис-ЭДТА (10 мМ Трис-Основа, 1 мМ раствор ЭДТА, 0,05% твин 20, pH = 9,0) (FGFR1 и FGFR2), либо в 10 мМ натрий-ЭДТА. цитратный буфер pH = 6,0 (CDX2). Затем предметные стекла инкубировали с 15% H 2 O 2 в 1x PBS в течение 15 минут.Затем предметные стекла блокировали универсальным блокирующим раствором с 2% козьей сывороткой в ​​течение 30 минут с последующей инкубацией с первичными антителами, разведенными в универсальном блокирующем растворе с 2% козьей сывороткой, в течение ночи при 4°С. Используемые первичные антитела включали: кроличьи анти-FGFR1 (1∶100, Flg (C-15) Санта-Крус), кроличьи анти-FGFR2 (1∶100, Bek (C-17) Санта-Крус) и кроличьи анти-CDX2 (1∶ 50, BioGenex, Фремонт, Калифорния). Набор Envision (Dako) использовался для демонстрации слайдов. Предметные стекла инкубировали с меченым полимером-HRP в течение 30 минут при комнатной температуре.Затем слайды выявляли с использованием хромогена DAB+ в субстратном буфере в течение 5 минут. Затем предметные стекла контрастно окрашивали гематоксилином, обезвоживали до 100% EtOH, очищали ксилолом и заливали Permount (Fisher Scientific, Fair Lawn, New Jersey). Изображения были получены с помощью цветной камеры, прикрепленной к вертикальному флуоресцентному микроскопу (Leica DM5500).

Подсчет и количественная оценка клеток

Эпителиальные ядра, PCNA-положительные и H/K-АТФаза-положительные окрашенные клетки подсчитывали полуавтоматически с использованием MetaMorph 7.Программное обеспечение 7.3.0 (Molecular Devices, Саннивейл, Калифорния). Во-первых, синий (DAPI) канал обрабатывался следующим образом: фон вычитался с помощью ручной пороговой обработки, интенсивность нормализовалась путем деления на копию канала с низкочастотным фильтром 20×20, а нормализованные ядра сглаживались с помощью 5×5. медианный фильтр для сохранения границ. Бинарное изображение сглаженных ядер было создано путем автоматической пороговой обработки с использованием алгоритма гистограммы изоданных при визуальном осмотре, чтобы при необходимости вручную настроить пороговое значение.Перекрывающиеся бинарные ядра были разделены с помощью сегментации Watershed с использованием программного обеспечения FoveaPro 3.0 (Reindeer Graphics, Asheville, NC). Для подсчета клеток, положительных по H/K-АТФазе, красный (Cy3) канал обрабатывали так же, как и синий канал, за исключением того, что устаревший эвристический алгоритм больше подходил для определения порога, а непосредственно перед этим был добавлен дополнительный шаг для заполнения всех темных дыр. к сегментации водораздела, чтобы заполнить неокрашенные ядра и предотвратить чрезмерную сегментацию. Для подсчета PCNA-позитивных клеток красный (Cy3) канал предварительно обрабатывали таким же образом, как и для H/K-АТФаза-позитивных клеток, за исключением того, что медиана ядра фильтра была 3×3.Бинарные объекты были подсчитаны с помощью встроенной функции анализа морфометрии MetaMorph. Объектные фильтры были настроены таким образом, чтобы исключить из подсчетов артефакты окрашивания и обработки, а также ядра мезенхимы: эллиптический фактор формы (отношение длины к ширине) ≥3,0 и площадь ≥100 пикселей для эпителиальных ядер, ≥200 пикселей для H/K-АТФазы- положительные клетки и ≥40 пикселей для PCNA-положительных клеток. GSII, CGA и IF-положительные окрашенные клетки подсчитывали вручную с использованием программного обеспечения ImageJ (http://rsbweb.nih.gov/ij/).

Общее количество PCNA, GSII, CGA, IF и H/K-АТФаза-положительных клеток и общее количество эпителиальных клеток подсчитывали отдельно для 3 случайно выбранных полей с высоким увеличением (HPF = 20-кратное увеличение) в теле одной мыши и усредненный. В частности, пять мутантных и пять контрольных мышей подсчитывали для всех сверхэкспрессий Fgf10 и для сверхэкспрессий sFgfr2b , индуцированных в течение одного месяца. Для сверхэкспрессии sFgfr2b , индуцированной в течение трех месяцев, мы проанализировали три мутанта и три контроля.Для каждого образца рассчитывали общее количество положительных клеток клеточного типа на общее количество эпителиальных клеток или процент положительных клеток клеточного типа.

Статистический анализ

Данные представлены как среднее ± стандартная ошибка среднего (SEM). Статистический анализ проводили с использованием одностороннего двухвыборочного равнодисперсионного (гомоскедастического) критерия Стьюдента t (Excel, Microsoft). Значения P <0,05 считались значимыми.

Благодарности

Авторы хотели бы поблагодарить Эстебана Фернандеса, доктора философии, за его помощь в полуавтоматическом подсчете клеток.

Авторские взносы

Задумал и спроектировал эксперименты: ALS FGS DA HRF SB TG. Выполнены опыты: БАС ФГС ДА. Проанализированы данные: БАС ФГС ДА ВПЧ СБ ТГ. Предоставленные реагенты/материалы/инструменты для анализа: ALS HRF SB TG. Написал статью: АЛС ФГС ДА ХРФ СБ ТГ.

Каталожные номера

  1. 1. Ферли Дж., Шин Х.Р., Брей Ф., Форман Д., Мазерс С. и др. (2010) Оценки мирового бремени рака в 2008 г.: GLOBOCAN 2008. Int J Cancer 127: 2893–2917.
  2. 2. Камангар Ф., Дорес Г.М., Андерсон В.Ф. (2006)Модели заболеваемости раком, смертности и распространенности на пяти континентах: определение приоритетов для сокращения различий в раке в разных географических регионах мира. Дж. Клин Онкол 24: 2137–2150.
  3. 3. Zabaleta J (2012)Многофакторная этиология рака желудка. Методы Мол Биол 863: 411–435.
  4. 4. Goldenring JR, Nam KT (2010)Оксинтическая атрофия, метаплазия и рак желудка.Prog Mol Biol Transl Sci 96: 117–131.
  5. 5. Nozaki K, Weis V, Wang TC, Falus A, Goldenring JR (2009)Измененная дифференцировка основных клеток желудка у мышей с дефицитом гистамина. Am J Physiol Gastrointest Liver Physiol 296: G1211–1220.
  6. 6. Нодзаки К., Огава М., Уильямс Дж. А., Лафлер Б. Дж., Нг В. и др. (2008)Молекулярный признак желудочной метаплазии, возникающей в ответ на острую потерю париетальных клеток. Гастроэнтерология 134: 511–522.
  7. 7. Katoh Y, Katoh M (2006)Сигнальный путь Hedgehog и сигнальная сеть желудочно-кишечных стволовых клеток (обзор).Int J Mol Med 18: 1019–1023.
  8. 8. Khurana S, Mills JC (2010)Развитие и дифференцировка слизистой оболочки желудка. Prog Mol Biol Transl Sci 96: 93–115.
  9. 9. McKeehan WL, Wang F, Kan M (1998)Семейство факторов роста гепарансульфат-фибробластов: разнообразие структуры и функции. Prog Nucleic Acid Res Mol Biol 59: 135–176.
  10. 10. Ornitz DM, Itoh N (2001)Факторы роста фибробластов. Геном Биол 2: ОБЗОРЫ3005.
  11. 11. Nyeng P, Norgaard GA, Kobberup S, Jensen J (2007)Передача сигналов FGF10 контролирует морфогенез желудка.Дев Биол 303: 295–310.
  12. 12. Шин М., Ватануки К., Ясуги С. (2005)Экспрессия рецепторов Fgf10 и Fgf во время развития эмбрионального куриного желудка. Gene Expr Patterns 5: 511–516.
  13. 13. Спенсер-Дене Б., Сала Ф.Г., Беллуски С., Гшмайсснер С., Штамп Г. и др. (2006) Развитие желудка зависит от передачи сигналов, опосредованной фактором роста фибробластов 10/рецептором фактора роста фибробластов 2b. Гастроэнтерология 130: 1233–1244.
  14. 14. Фэрбенкс Т.Дж., Канард Р., Дель Морал П.М., Сала Ф.Г., Де Ланге С. и др.(2004)Инвалидация рецептора фактора роста фибробластов 2 IIIb – потенциальная причина семейной атрезии двенадцатиперстной кишки. J Pediatr Surg 39: 872–874.
  15. 15. Kanard RC, Fairbanks TJ, De Langhe SP, Sala FG, Del Moral PM и др. (2005) Фактор роста фибробластов-10 играет регулирующую роль в развитии двенадцатиперстной кишки. J Pediatr Surg 40: 313–316.
  16. 16. Бернс Р.С., Фэрбенкс Т.Дж., Сала Ф., Де Ланге С., Майло А. и др. (2004)Потребность в сигнале фактора роста фибробластов 10 или рецептора фактора роста фибробластов 2-IIIb для развития слепой кишки у мышей.Дев Биол 265: 61–74.
  17. 17. Фэрбенкс Т.Дж., Канард Р.С., Де Ланге С.П., Сала Ф.Г., Дель Морал П.М. и др. (2004)Генетический механизм атрезии слепой кишки: роль сигнального пути Fgf10. J Surg Res 120: 201–209.
  18. 18. Фэрбенкс Т.Дж., Канард Р.С., Дель Морал П.М., Сала Ф.Г., Де Ланге С.П. и др. (2005)Атрезия толстой кишки без окклюзии брыжеечных сосудов. Роль сигнального пути фактора роста фибробластов 10. J Pediatr Surg 40: 390–396.
  19. 19.Fairbanks TJ, Sala FG, Kanard R, Curtis JL, Del Moral PM и др. (2006)Путь фактора роста фибробластов играет регулирующую роль в пролиферации и апоптозе в патогенезе атрезии кишечника. J Pediatr Surg 41: 132–136; обсуждение 132–136.
  20. 20. Сала Ф.Г., Кертис Дж.Л., Велтмаат Дж.М., Дель Мораль П.М., Ле Л.Т. и др. (2006) Фактор роста фибробластов 10 необходим для выживания и пролиферации, но не для дифференцировки кишечных эпителиальных клеток-предшественников во время развития толстой кишки мышей.Дев Биол 299: 373–385.
  21. 21. Lennerz JK, Kim SH, Oates EL, Huh WJ, Doherty JM, et al. (2010) Фактор транскрипции MIST1 является новым маркером клеток желудка человека, экспрессия которого утрачивается при метаплазии, дисплазии и карциноме. Ам Дж. Патол 177: 1514–1533.
  22. 22. Mailleux AA, Kelly R, Veltmaat JM, De Langhe SP, Zaffran S, et al. (2005) Экспрессия Fgf10 идентифицирует предшественники парабронхиальных гладкомышечных клеток и необходима для их вступления в клон гладкомышечных клеток.Развитие 132: 2157–2166.
  23. 23. Shin M, Noji S, Neubuser A, Yasugi S (2006) FGF10 необходим для пролиферации клеток и образования желез в эпителии желудка куриного эмбриона. Дев Биол 294: 11–23.
  24. 24. Tai CC, Curtis JL, Sala FG, Del Moral PM, Chokshi N, et al. (2009) Индукция фактора роста фибробластов 10 (FGF10) в эпителии подвздошных крипт после массивной резекции тонкой кишки предполагает роль FGF10 в адаптации кишечника. Дев Дин 238: 294–301.
  25. 25. Лопес-Диас Л., Хинкль К.Л., Джейн Р.Н., Заврос Ю., Брункан С.С. и др. (2006)Гиперстимуляция париетальных клеток и аутоиммунный гастрит у трансгенных мышей с холерным токсином. Am J Physiol Gastrointest Liver Physiol 290: G970–979.
  26. 26. Рэмси В.Г., Доэрти Дж.М., Чен К.С., Стаппенбек Т.С., Конечны С.Ф. и др. (2007) Для созревания секретирующих слизь желудочных эпителиальных клеток-предшественников в секретирующие пищеварительные ферменты зимогенные клетки требуется Mist1. Развитие 134: 211–222.
  27. 27. Shinohara M, Mao M, Keeley TM, El-Zaatari M, Lee HJ и др. (2010)Передача сигналов костного морфогенетического белка регулирует развитие и пролиферацию эпителиальных клеток желудка у мышей. Гастроэнтерология 139: 2050–2060 e2052.
  28. 28. Ховард Т.А., Мисра Д.Н., Гроув М., Бечич М.Дж., Шао Дж.С. и др. (1996) Экспрессия внутреннего фактора желудка человека не ограничивается париетальными клетками. J Анат 189 (часть 2): 303–313.
  29. 29. Карам С.М., Леблон С.П. (1993)Динамика эпителиальных клеток в теле желудка мыши.III. Внутренняя миграция клеток шейки с последующей прогрессивной трансформацией в зимогенные клетки. Анат Рек 236: 297–313.
  30. 30. Ku SK, Lee HS, Lee JH (2003) Иммуногистохимическое исследование эндокринных клеток желудочно-кишечного тракта у мышей C57BL/6. Анат Хистол Эмбриол 32: 21–28.
  31. 31. Моуланд А.Дж., Беван С., Уайт Дж.Х., Хенди Г.Н. (1994)Ген хромогранина А человека. Молекулярное клонирование, структурный анализ и специфичная для нейроэндокринных клеток экспрессия. J Biol Chem 269: 6918–6926.
  32. 32. Weis VG, Goldenring JR (2009) Текущее понимание SPEM и его положение в предраковом процессе. Рак желудка 12: 189–197.
  33. 33. Goldenring JR, Nam KT, Mills JC (2011)Происхождение преднеопластической метаплазии в желудке: главные клетки появляются из тумана. Exp Cell Res 317: 2759–2764.
  34. 34. Де Мёрлуз Л., Спенсер-Ден Б., Ревест Дж. М., Хаджихосейни М., Розуэлл И. и др. (2000)Важная роль изоформы IIIb рецептора 2 фактора роста фибробластов (FGFR2) в мезенхимально-эпителиальной передаче сигналов во время органогенеза мыши.Развитие 127: 483–492.
  35. 35. Парса С., Куремото К., Зайдель К., Табатабай Р., Маккензи Б. и др. (2010) Передача сигналов с помощью FGFR2b контролирует регенеративную способность резцов взрослых мышей. Развитие 137: 3743–3752.
  36. 36. Парса С., Рамасами С.К., Де Ланге С., Гупте В.В., Хей Дж.Дж. и др. (2008) Поддержание концевых зачатков в молочной железе зависит от передачи сигналов FGFR2b. Дев Биол 317: 121–131.
  37. 37. Карам С.М. (2010) Акцент на париетальных клетках как на обновляющейся клеточной популяции.World J Gastroenterol 16: 538–546.
  38. 38. Igarashi M, Finch PW, Aaronson SA (1998) Характеристика рекомбинантного фактора роста фибробластов человека (FGF)-10 выявила функциональное сходство с фактором роста кератиноцитов (FGF-7). J Biol Chem 273: 13230–13235.
  39. 39. Мики Т., Боттаро Д.П., Флеминг Т.П., Смит К.Л., Берджесс В.Х. и др. (1992) Определение специфичности связывания лиганда путем альтернативного сплайсинга: два различных рецептора фактора роста, кодируемых одним геном.Proc Natl Acad Sci U S A 89: 246–250.
  40. 40. Mailleux AA, Spencer-Dene B, Dillon C, Ndiaye D, Savona-Baron C, et al. (2002)Роль передачи сигналов FGF10/FGFR2b во время развития молочной железы у эмбриона мыши. Развитие 129: 53–60.
  41. 41. Beer HD, Vindevoghel L, Gait MJ, Revest JM, Duan DR и др. (2000) Рецептор 1-IIIb фактора роста фибробластов (FGF) представляет собой встречающийся в природе функциональный рецептор для FGF, который преимущественно экспрессируется в коже и головном мозге.J Biol Chem 275: 16091–16097.
  42. 42. Сала Ф.Г., Дель Морал П.М., Тиоццо С., Алам Д.А., Уорбертон Д. и др. (2011) FGF10 контролирует формирование паттерна колец хряща трахеи посредством Shh. Развитие 138: 273–282.
  43. 43. Bellusci S, Grindley J, Emoto H, Itoh N, Hogan BL (1997)Фактор роста фибробластов 10 (FGF10) и морфогенез ветвления в легком эмбриона мыши. Развитие 124: 4867–4878.
  44. 44. Veltmaat JM, Relaix F, Le LT, Kratochwil K, Sala FG, et al.(2006) Gli3-опосредованные сомитические градиенты экспрессии Fgf10 необходимы для индукции и формирования паттерна эпителия молочных желез вдоль эмбриональных осей. Развитие 133: 2325–2335.
  45. 45. Миллс Дж. К., Шивдасани Р. А. (2011) Эпителиальные стволовые клетки желудка. Гастроэнтерология 140: 412–424.
  46. 46. Кельд Р., Го Б., Дауни П., Камминс Р., Гульманн С. и др. Связанные с PEA3/ETV4 факторы транскрипции в сочетании с активной передачей сигналов ERK связаны с плохим прогнозом при аденокарциноме желудка.Бр Дж Рак 105: 124–130.
  47. 47. Ямамото Х., Хориучи С., Адачи Ю., Танигути Х., Ношо К. и др. (2004) Экспрессия ets-родственного транскрипционного фактора E1AF связана с прогрессированием опухоли и сверхэкспрессией матрилизина при раке желудка человека. Канцерогенез 25: 325–332.
  48. 48. Kelly RG, Brown NA, Buckingham ME (2001)Артериальный полюс сердца мыши формируется из экспрессирующих Fgf10 клеток мезодермы глотки. Ячейка разработчиков 1: 435–440.
  49. 49.Аль Алам Д., Грин М., Табатабай Ирани Р., Парса С., Данопулос С. и др. (2011)Контрастная экспрессия канонических сигнальных репортеров Wnt TOPGAL, BATGAL и Axin2(LacZ) во время развития и восстановления легких мышей. PLoS One 6: e23139.
  50. 50. Schwenk F, Baron U, Rajewsky K (1995) Кре-трансгенная линия мыши для повсеместной делеции сегментов генов, фланкированных loxP, включая делецию в зародышевых клетках. Нуклеиновые кислоты Рез. 23: 5080–5081.
  51. 51. Бельтеки Г., Хей Дж., Кабач Н., Хей К., Сисон К. и др.(2005) Условная и индуцируемая экспрессия трансгена у мышей посредством комбинаторного использования Cre-опосредованной рекомбинации и индукции тетрациклином. Нуклеиновые кислоты Рез. 33: e51.
  52. 52. Clark JC, Tichelaar JW, Wert SE, Itoh N, Perl AK, et al. (2001) FGF-10 нарушает морфогенез легких и вызывает легочные аденомы in vivo. Am J Physiol Lung Cell Mol Physiol 280: L705–715.
  53. 53. Hokuto I, Perl AK, Whitsett JA (2003) Пренатальное, но не постнатальное ингибирование передачи сигналов рецептора фактора роста фибробластов вызывает эмфизему.J Biol Chem 278: 415–421.
  54. 54. Gossen M, Bujard H (1992) Жесткий контроль экспрессии генов в клетках млекопитающих с помощью промоторов, чувствительных к тетрациклину. Proc Natl Acad Sci U S A 89: 5547–5551.

Женщина с хронической болью внизу живота, выделениями из влагалища и бесплодием после пребывания в Мали | Открытый форум по инфекционным заболеваниям

28-летняя бельгийская женщина поступила с болью в подчревной области, выделениями из влагалища, меноррагией, дисменореей, диспареунией и утомляемостью, которые сохранялись в течение 8 лет.Эти жалобы начались через несколько недель после случайного падения в реку Нигер во время поездки в Мали, после чего она заметила зудящую сыпь, локализованную на брюшной стенке. Жалоб на мочеиспускание не было. Различные попытки забеременеть в предыдущие 2 года не увенчались успехом. Она также сообщила о перемежающейся гематохезии, но не о диарее. В течение последних 8 лет пациентка консультировалась у нескольких гинекологов и прошла обширные обследования, в том числе гистеросальпингографию без диагностических результатов.

В анамнезе не было значимых заболеваний, за исключением сенной лихорадки, для которой не требовалось поддерживающего лечения. Дальнейший анамнез путешествия выявил 1-месячное пребывание в Эквадоре 10 лет назад, где пациент плавал в реках.

При физикальном осмотре пальпация гипогастрия умеренно болезненна. Наружные половые органы имели нормальный вид. При бимануальном вагинальном исследовании отмечалась легкая болезненность при движении шейки матки. Осмотр в зеркале не показал воспаления или рыхлости влагалища или шейки матки.Пальцевое ректальное исследование было нормальным. Анализы крови показали гемоглобин 12,6 г/дл, общее количество лейкоцитов 7600/мкл с 50% нейтрофилов, 35% лимфоцитов, 6% эозинофилов, 2% базофилов и 7% моноцитов, а также количество тромбоцитов 328000/мкл. Анализы на сифилис, вирус иммунодефицита человека, Chlamydia trachomatis и гонорею были отрицательными. Осадок мочи показал 18 эритроцитов/мкл, отсутствие лейкоцитов и наличие слизи. Протеинурия не выявлена. Об атипичном воспалении сообщалось в мазке Папаниколау, а биопсия шейки матки, выполненная лечащим гинекологом, показала кальцифицированные структуры в ненекротических гранулемах (рис. 1).

Рисунок 1.

Окраска гематоксилином и эозином на биопсии шейки матки. Два обызвествленных яйца Schistosoma (толстые стрелки) видны внутри ненекротической гранулемы, состоящей из гистиоцитов (тонкая стрелка) и смешанных воспалительных клеток, включая эозинофилы (острие стрелки), лимфоциты, нейтрофилы (синяя стрелка) и плазматические клетки (красная стрелка). Паразит в нижней левой гранулеме частично резорбирован. Масштабная линейка показывает 50 мкм.

Рис. 1.

Окраска гематоксилином и эозином биопсии шейки матки.Два обызвествленных яйца Schistosoma (толстые стрелки) видны внутри ненекротической гранулемы, состоящей из гистиоцитов (тонкая стрелка) и смешанных воспалительных клеток, включая эозинофилы (острие стрелки), лимфоциты, нейтрофилы (синяя стрелка) и плазматические клетки (красная стрелка). Паразит в нижней левой гранулеме частично резорбирован. Масштабная линейка показывает 50 мкм.

КАКОВ ВАШ ДИАГНОЗ?


ОТВЕТ: ГЕНИТАЛЬНЫЙ ШИСТОСОМОЗ

Биопсия шейки матки показала кальцинированные яйца Schistosoma в центре гранулем, содержащих эозинофилы и другие воспалительные клетки (рис. 1).Мы выполнили цервикальные, вагинальные и ректальные надрезы. Обызвествленные яйца Schistosoma (средний размер 106   ×   42 мкм) с конечным шипом были обнаружены в ректальных и цервикальных срезах (рис. 2 и 3), что свидетельствует об инфекции членом группы Schistosoma haematobium . Форма яйца полиморфна, некоторые типы напоминают Schistosoma intercalatum из-за экваториальной выпуклости или гибриды S haematobium × Schistosoma bovis , о которых сообщалось в Сенегале, Корсике и Мали [1].Однако S intercalatum зарегистрирован только в Демократической Республике Конго [2], а размер яиц S intercalatum колеблется от 140 до 240 мкм и, таким образом, намного больше, чем яйца, найденные здесь.

Рис. 2.

Ректальный разрез, неокрашенный влажный препарат. Кластер из яиц Schistosoma с различными стадиями кальцификации (короткая стрелка указывает на продвинутую кальцификацию), с незаметными концевыми шипами (длинная стрелка) и экваториальными выпуклостями.Масштабная линейка показывает 50 мкм.

Рисунок 2.

Ректальный разрез, неокрашенный влажный препарат. Кластер из яиц Schistosoma с различными стадиями кальцификации (короткая стрелка указывает на продвинутую кальцификацию), с незаметными концевыми шипами (длинная стрелка) и экваториальными выпуклостями. Масштабная линейка показывает 50 мкм.

Рис. 3.

Шейный разрез, неокрашенный влажный препарат. Кальцифицированное яйцо Schistosoma с концевым шипом.Масштабная линейка показывает 50 мкм.

Рис. 3.

Шейный разрез, неокрашенный препарат для влажного препарата. Кальцифицированное яйцо Schistosoma с концевым шипом. Масштабная линейка показывает 50 мкм.

Иммуноферментный анализ и реакция непрямой гемагглютинации на Schistosoma были положительными (соотношение 2,26 при референтном диапазоне  <1,00 и 1/320 при референсном диапазоне  <1/160 соответственно). Полимеразная цепная реакция (ПЦР) в реальном времени, нацеленная на специфичную для комплекса S haematobium последовательность Dra I [3] и родоспецифичный ген Schistosoma 28S [4], была положительной в цервикальном мазке и ректальном исследовании. и шейки матки, тогда как ПЦР в реальном времени, выявляющая специфичную для комплекса Schistosoma mansoni последовательность Sm1-7 [1, 5], была отрицательной.Секвенирование частичного продукта 28S ПЦР (225 пар оснований [bp]) не позволило различить S haematobium , S bovis или S intercalatum/Schistosoma guineensis . Быстрая диагностическая мультиплексная обычная ПЦР (RD-PCR [6]) на биопсии шейки матки показала сильную полосу S bovis и слабую полосу S haematobium . Последующее секвенирование фрагмента S bovis (258 п.н.) показало 100% совпадение с S bovis (инвентарный номер GenBank наилучшего совпадения: MK757177.1).

Фрагмент частичной субъединицы цитохромоксидазы I (COI) (417 п.н.) также был секвенирован для биопсии прямой кишки и показал 99,76% идентичность с S haematobium из GenBank (инвентарный номер наилучшего совпадения: MK333538.1). Эти результаты указывают либо на смешанную инфекцию S bovis и S haematobium , либо на инфекцию гибридными формами этих видов. Последний сценарий поддерживается больше всего, учитывая описанную выше морфологию яйца. Кроме того, гибрида S haematobium × S bovis уже были зарегистрированы в нигерийской деревне, которая также расположена в бассейне реки Нигер [6].

Пациенту было назначено лечение празиквантелом по 20 мг/кг 3 раза только в течение 1 дня, которое было повторено через 1 месяц. После этого лечения было отмечено лишь временное облегчение болей в животе и диспареунии. Через пять месяцев после постановки диагноза и лечения циркулирующий анодный антиген сыворотки Schistosoma был слегка положительным при 1,44 пг/мл (нормальное значение <1,0 пг/мл). При постановке диагноза исходное значение не было доступно. Была введена дополнительная однократная доза празиквантела 40 мг/кг.

Шистосомоз — инфекция, вызываемая трематодами из рода Schistosoma , поражающая около 230 миллионов человек во всем мире [7]. Покинув своего промежуточного хозяина, пресноводных улиток, церкарии проникают в кожу, что может привести к появлению сыпи, называемой церкариозным дерматитом или зудом купальщиков. Оглядываясь назад, можно сказать, что сыпь на животе у нашего пациента на следующий день после падения в реку Нигер напоминала зуд купающихся. Через 2–10 недель ювенильные (личиночные) черви мигрируют в брыжеечные или околопузырные вены.Во время этой миграции у неиммунных путешественников могут развиться симптомы острого шистосомоза (или синдрома Катаямы); симптомы характеризуются лихорадкой, кашлем, крапивницей, миалгией и/или абдоминальными симптомами в сочетании с эозинофилией. Взрослые черви выживают в кровеносных сосудах в течение многих лет, ежедневно выделяя от сотен до тысяч яиц. Поздние осложнения обусловлены хронической гранулематозной реакцией на яиц Schistosoma , попавших в ткани, с последующим фиброзным рубцеванием. Schistosoma mansoni , S intercalatum , Schistosoma japonicum и Schistosoma mekongi обычно вызывают гепато-кишечный шистосомоз, иногда приводящий к перипортальному фиброзу с портальной гипертензией, тогда как Suematobium Suematobium

Генитальный шистосомоз — редкий диагноз у возвращающихся путешественников. В публикации 2016 года исследователи обнаружили 44 случая генитального шистосомоза, когда-либо зарегистрированных у женщин-мигрантов и путешественников, прибывающих из эндемичных по Schistosoma стран, причем менее половины из них возвращаются назад [8]. Другие возможные клинические проявления генитального шистосомоза включают поражение промежности или влагалища, цервицит, эндометрит, сальпингит, бесплодие и свищи [8]. В вышеуказанной серии только у 1 пациентки была сочетанная генитально-ректальная локализация [9] с ректовагинальным свищом.Наш пациент упомянул гематохезию, причину, по которой мы сделали ректальные надрезы, показывающие яйца Schistosoma . Инфекция Schistosoma haematobium обычно имеет мочеполовую локализацию, а инфекция S bovis обнаруживается только в кишечнике. Гибридная инфекция объясняет обе локализации одновременно у нашего пациента, что и привело к окончательному диагнозу.

Выводы

Через пять месяцев после приема последней дозы празиквантела жалобы у нашей пациентки полностью исчезли, за исключением периодического зуда половых органов.В настоящее время она запланирована на последующие встречи в центре репродукции. С увеличением туризма в районы, где Schistosoma является эндемичным, у возвращающихся путешественников может быть больше случаев генитального шистосомоза. Наш случай показывает, что диагноз может быть пропущен в течение многих лет, если нет клинической осведомленности.

Благодарности

Мы благодарим доктора Жана-Франсуа Легрева (гинекология и акушерство, больница Брейн-л’Аллёд-Ватерлоо, Бельгия) за предоставление подробной информации об истории болезни пациента, а также Изабель Микалесси и лаборантов за лабораторную работу.

Возможные конфликты интересов. Все авторы: Нет сообщений о конфликте интересов. Все авторы представили форму ICMJE для раскрытия потенциальных конфликтов интересов.

Ссылки

1.

Soentjens

P

,

Cnops

L

,

Huyse

T

и др.

Диагностика и клиническое ведение гибридной инфекции Schistosoma haematobium Schistosoma bovis среди путешественников, возвращающихся из Мали

Clin Infect Dis

2016

;

63

:

1626

9

.2.

Леже

Е

,

Вебстер

JP

.

Гибридизации внутри рода Schistosoma : значение для эволюции, эпидемиологии и контроля

.

Паразитология

2017

;

144

:

65

80

.3.

Cnops

L

,

Tannich

E

,

Polman

K

, и др.

Schistosoma ПЦР в реальном времени как диагностический инструмент для международных путешественников и мигрантов

.

Trop Med Int Health

2012

;

17

:

1208

16

.4.

Cnops

L

,

Soentjens

P

,

Clerinx

J

,

Van Esbroeck

M

3 .

A Schistosoma haematobium специфическая ПЦР в реальном времени для диагностики урогенитального шистосомоза в образцах сыворотки международных путешественников и мигрантов

.

PLoS Negl Trop Dis

2013

;

7

:

e2413

.5.

Wichmann

D

,

Панорамирование

M

,

Quack

T

, и др.

Диагностика шистосомоза путем обнаружения бесклеточной ДНК паразита в плазме крови человека

.

PLoS Negl Trop Dis

2009

;

3

:

e422

.6.

Леже

E

,

Гарба

A

,

Хамиду

AA

, и др.

Интрогрессированные шистосомы животных Schistosoma curassoni и S. bovis естественно заражающие людей

.

Emerg Infect Dis

2016

;

22

:

2212

4

.7. .

Шистосомоз человека

.

Ланцет

2014

;

383

:

2253

64

.8.

Christinet

V

,

Lazdins-Helds

JK

,

Stothard

JR

,

Reinhard-Rupp

3 9.00023 9.00023

Женский генитальный шистосомоз (ФГШ): от сообщений о случаях до призыва к согласованным действиям против этого запущенного гинекологического заболевания

.

Int J Parasitol

2016

;

46

:

395

404

.9.

Кромпец

С

,

Мазик

М

,

Зелински

В

,

Смолик

М

.

Шистосомоз как причина ректовагинальных свищей: краткое описание клинического случая

.

Pol J Chem

1996

;

32

:

1223

7

.

© Автор(ы), 2020. Опубликовано Oxford University Press от имени Американского общества инфекционистов.

Это статья в открытом доступе, распространяемая на условиях лицензии Creative Commons Attribution-NonCommercial-NoDerivs (http://creativecommons.org/licenses/by-nc-nd/4.0/), который разрешает некоммерческое воспроизведение и распространение произведения на любом носителе при условии, что исходное произведение не изменено и не трансформировано каким-либо образом, и что произведение правильно процитировано. Для коммерческого повторного использования, пожалуйста, свяжитесь с [email protected] .

Добавить комментарий

Ваш адрес email не будет опубликован.