В каких продуктах стафилококк: Исследование пищевых продуктов на наличие Staphylococcus aureus » ФГБУ Саратовская МВЛ

Содержание

Исследование пищевых продуктов на наличие Staphylococcus aureus » ФГБУ Саратовская МВЛ

Стафилококки – одна из ведущих причин микробных пищевых отравлений. Стафилококки вызывают множество инфекций в организме человека, в том числе поверхностные и глубокие гнойные инфекции, интоксикации, инфекции мочевых путей.

Важнейшим патогенным стафилококком является Золотистый стафилококк – Staphylococcus aureus – стойкий, высоковирулентный, легко приобретающий устойчивость к антимикробным препаратам возбудитель инфекции. Бактерии рода Staphylococcus – неподвижные, не образующие спор грамположительные кокки диаметром 0,5– 1,5 мкм. Они располагаются поодиночке либо образуют пары, короткие цепочки или неправильной формы гроздья, отчего и получили свое название («стафула» по–гречески означает «виноградная гроздь»).

Пути передачи возбудителя стафилококковой инфекции разнообразны. Staphylococcus aureus может передаваться как воздушно-капельным путем, так и контактно-бытовым, попадать в организм с пищей и питьем.

Золотистый стафилококк может размножаться в продуктах питания. Чаще всего, в кондитерских изделиях и молочных продуктах, в мясных изделиях (полуфабрикаты и колбасы), в рыбе (слабосоленая, консервы).

Сам микроорганизм не представляет угрозы для человека. Он быстро погибает в желудке под воздействием соляной кислоты. Но в процессе жизнедеятельности золотистый стафилококк выделяет энтеротоксин, который накапливается в продуктах питания. Попадая в желудочно-кишечный тракт, этот токсин вызывает симптомы пищевого отравления. Если у человека иммунитет находится в норме, то восприимчивость к патогенному воздействию у организма низкая. Но если состояние микрофлоры, которая первая встает на пути борьбы с патогенными микроорганизмами, ухудшается, то стафилококки приобретают способность преодолевать тканевые барьеры и мигрировать по всему организму, вызывая воспалительный процесс.

В отдел ветеринарно-санитарной экспертизы с января 2015 года поступило более 20 проб пищевых продуктов на наличие Staphylococcus aureus.  Результат исследования отрицательный.

Россельхознадзор — Региональные новости

Стафилококк в йогурте. © ФГУ Ставропольская МВЛ

ФГБУ «Ставропольская межобластная ветеринарная лаборатория» успешно сотрудничает с рядом организаций осуществляющих контроль не только в области сельского хозяйства но и курирующих качество продукции в области пищевой и перерабатывающей промышленности. Одной из них является комитет Ставропольского края по пищевой и перерабатывающей промышленности, торговле и лицензированию. В рамках реализации организованной им программы «Развитие пищевой и прерабатывающей промышленности, потребительского рынка в Ставропольском крае», в отдел пищевой микробиологии и ВСЭ поступила проба йогурта молочного, в котором при исследовании был обнаружен золотистый стафилококк (S.aureus). Наличие этого микроорганизма, согласно нормам Технического регламента Таможенного союза 033/2013 «О безопасности молока и молочной продукции», в продуктах не допускается.

Staphylococcus aureus (золотистый стафилококк) — это весьма распространенный микроорганизм имеющий несколько видов, большинство из которых образует золотистый пигмент.

Некоторые виды золотистого стафилококка могут служить причиной тяжелых пищевых отравлений, так как продуцируют опасное токсическое вещество – энтеротоксин, являющийся непосредственной причиной интоксикации. В настоящее время установлено шесть серологических типов стафилококковых энтеротоксинов: А, В, С, D, Е, F.

Staphylococcus aureus – очень распространен, и его можно найти повсюду. Особенно благоприятны в качестве условий для его размножения пищевые продукты – молоко, мясо. Очень устойчив к любым условиям и способен выживать в замороженных продуктах в течение полугода. Стафилококк не боится кислой среды, высокой температуры, щелочей. Для того чтобы нейтрализовать заражение, нужен долгий процесс кипячения или прожаривания при температуре не ниже 75-80 градусов. Излюбленной средой для размножения Staphylococcus aureus является молоко и все молочные продукты, именно молоко чаще всего становится источником токсикоинфекции. Микроорганизмы могут размножиться при температуре от 16-18 до 37-40 градусов, для осеменения молочного продукта порой достаточно 4-5 часов. Энтеротоксин вырабатывается, как правило, в продуктах, изготовленных из некипяченого или непастеризованного молока. Источником заражения является свежая брынза, сырковая масса, сметана, сыры, изготовленные с помощью сычужного фермента. Также опасны все сладкие кондитерские изделия с кремовой прослойкой, особенно с заварным кремом на молоке. Сахар, влажная молочная среда, крахмал – это благоприятные условия для жизнедеятельности стафилококка. Образование энтеротоксина возможно также в кипяченом и пастеризованном молоке. Известны случаи отравлений мороженым, изготовленным из молока, содержащего энтеротоксин.

Реже стафилококк осеменяет мясо и мясные продукты. Он поражает больных животных с ослабленной иммунной системой или размножается на мясной пище, хранящейся в ненадлежащих условиях. Органолептические свойства молочных, мясных или овощных блюд, осемененных стафилококком, не меняются, поэтому на вкус и запах пища абсолютно не отличается от здоровой, незараженной.

Источником заражения пищевых продуктов патогенными стафилококками является человек. Наиболее частый путь заражения продуктов — воздушно-капельный, поскольку больные стафилококковыми заболеваниями верхних дыхательных путей активно выделяют их в окружающую среду при дыхании, кашле, чиханье. Опасным источником обсеменения продуктов являются работники со стафилококковыми поражениями кожи которые контактным путем загрязняют стафилококками оборудование, инвентарь, посуду.

Источником стафилококковой инфекции являются также животные, больные маститом и другими воспалительными заболеваниями. Продукты животного происхождения могут заражаться стафилококками при жизни животных (молоко при мастите вымени) или при разделке туши.

К профилактическим мероприятиям, предупреждающим обсеменение патогенными стафилококками пищевых продуктов, относятся своевременное выявление лиц с гнойными воспалительными процессами кожи, верхних дыхательных путей и отстранение их от контакта с пищевыми продуктами. Особое место принадлежит соблюдению правил личной гигиены работниками, занятыми изготовлением готовых кулинарных и кремовых изделий.

Чрезвычайно важным является создание условий, препятствующих образованию энтеротоксина в пищевых продуктах. Для хранения оптимальной является температура 2-4 °С, при которой не происходят размножение и накопление энтеротоксина. Большое значение имеет также соблюдение установленных сроков реализации скоропортящихся продуктов.

Не менее важно в профилактике стафилококковых токсикозов обеспечение высокого санитарного уровня, благоустройства и механизации производственных процессов, а также систематическое повышение гигиенических знаний по вопросам профилактики пищевых отравлений.

Стафилококковая пищевая интоксикация | Государственное учреждение «Минский городской центр гигиены и эпидемиологии»

Стафилококковая пищевая интоксикация – это острое заболевание, возникающее вследствие употребления в пищу продуктов, содержащих стафилококковый энтеротоксин, характеризуется преимущественным поражением желудка, внезапным началом, сочетанием синдромов интоксикации и гастроэнтерита.

Возбудители стафилококковой пищевой интоксикации относятся к роду Staphylococcus. Чаще это Staphylococcus aureus – золотистый стафилококк. Сами возбудители пищевых интоксикаций не принимают участие в патогенезе болезни, т.е. накопление микроорганизмов в пищевом продукте лишь обеспечивает выработку токсинов, которые и вызывают проявления заболевания.

Сам возбудитель хорошо сохраняется во внешней среде, характеризуются сравнительно высокой устойчивостью к высушиванию, замораживанию, действию солнечного света и химических веществ. В высушенном состоянии он может сохраняться до 6 месяцев, в пыли – 50–100 дней, может не погибать на протяжении многих часов под действием прямых солнечных лучей. Стафилококк может переносить нагревание при 70-80°С до 20-30 мин, при 150°С – 10 мин, при кипячении – погибает мгновенно (отдельные штаммы переносят нагревание до 100°С в течение получаса).

Размножаться стафилококк способен в интервале от 6,6 до 45°С.

Стафилокковые пищевые отравления чаще связывают с употреблением молока и молочных продуктов (сметана, творог, и т.д.), мясных, рыбных и овощных блюд, тортов, пирожных, рыбных консервов, эпидемиологическое значение имеют мясные полуфабрикаты и готовые пищевые продукты, особенно «комплексные блюда», мясо, куры и продукты приготовленные из них, а также салаты. Стафилококк способен размножаться в пище, не изменяя органолептических свойств (запах, вкус).

Скорость продуцирования стафилококками энтеротоксина зависит не только от массивности первоначального обсеменения и условий хранения пищевых продуктов (время, температура), но и от их химического состава продуктов (содержания углеводов, белков, жиров), кислотности и др.

Энтеротоксины устойчивы к нагреванию (для разрушения энтеротоксина требуется кипячение пищи не менее 2-х часов, что обычно не делают, так как при этом портятся органолептические свойства продуктов).

Источником инфекции могут быть человек или животное (больные и носители). Опасность представляют лица с инфекционными заболеваниями верхних дыхательных путей, так как при этом может происходить обсеменение пищевых продуктов аэрогенным путем, а также лица с заболеваниями и ранами кожи (пиодермии, панариции, нагноившиеся порезы и ожоги и т.д). Животные (коровы, козы, овцы и др.) могут быть отнесены к дополнительным источникам инфекции (фактор передачи – молоко при наличии маститов и мясо). Пищевые продукты могут быть контаминированы стафилококком аэрогенно с отделяемым носоглотки или контактно при попадании возбудителя с кожных покровов человека на инвентарь, посуду, оборудование или непосредственно на продукты питания.

Основные клинические проявления. Инкубационный период при стафилококковой интоксикации короткий – от 30 минут до 6 часов, чаще – 2-4 часа. Болезнь начинается остро, в клинической картине доминируют симптомы гастрита в виде повторной рвоты, наблюдается режущая боль в животе (эпигастральная область или вокруг пупка), напоминающая желудочные колики, характер стула может не меняться или отмечается диарея, повышение температуры тела.

Основными мерами профилактики стафилококкового токсикоза являются:

  • своевременное выявление лиц с воспалительными заболеваниями верхних дыхательных путей и гнойничковыми поражениями кожи и отстранение их от условий приготовления пищи или контакта с готовыми блюдами;
  • своевременный санитарно-ветеринарный контроль за здоровьем дойных и убойных животных и безопасностью животного продовольственного сырья;
  • соблюдение правил личной гигиены;
  • исключение контакта и разделение потоков сырья, полуфабрикатов и готовой продукции
  • соблюдение технологии приготовления пищи (в том числе режимов тепловой обработки), а также обеспечение температурных условий хранения и сроков реализации продуктов.

Стафилококк в вашем доме: откуда берутся опасные штаммы

Микробиологи изучили пути распространения опасных штаммов золотистого стафилококка. Выяснилось, что шаровидная бактерия может задержаться в доме из-за безобидного отбеливателя или любимого питомца. Исследование на эту тему опубликовано в журнале Applied and Environmental Microbiology.

Золотистый стафилококк – шаровидная бактерия, которая вызывает сепсис (заражение крови), пневмонию и другие тяжелые инфекции. Стафилококк может существовать в состоянии покоя на коже, слизистых человека. Носитель даже не будет догадываться о присутствии в своем организме этой опасной бактерии. Но стоит только попасть стафилококку в другую среду, например, в ранку, начинаются серьезные проблемы.

Самым опасным считается золотистый стафилококк MRSA (methicillin-resistant Staphylococcus aureus). Его штамм весьма устойчив ко многим лекарствам. Именно MRSA является частой причиной внутрибольничных инфекций. Присутствие его в медицинском учреждении можно объяснить низким иммунитетом пациентов, там микроорганизмы могут передавать друг другу гены устойчивости ко многим лекарствам. Бороться с такой инфекцией крайне тяжело. 

Оказывается, золотистый стафилококк часто свирепствует и в домашних условиях. Причиной, которая поддерживает жизнь этой бактерии, может быть наличие домашнего питомца. При этом, если в доме есть мыши, тараканы, тогда, наоборот, вероятность появления устойчивых штаммов снижается.

Кроме того, использование обеззараживающих чистящих средств (например, отбеливателей) также помогает золотистому стафилококку повышать устойчивость ко многим лекарствам. Такие штаммы могут заново появляться в доме, провоцируя новые вспышки инфекций. 

Еще одним главным пунктом выработки «иммунитета» у MRSA является прием антибиотиков. Речь идет о лечении мупироцином инфекций кожи и носовых проходов.

Стоит отметить живучесть опасных штаммов. Так, в древней гробнице американские ученые нашли стафилококк. Инфекцию обнаружили в скелете женщины, похороненной в древнем городе Троя более 800 лет назад.

Советы врача: как уберечься от пищевого отравления!

В последнее время в средствах массовой информации появляются сообщения о массовых пищевых отравлениях. Чаще это связано с несоблюдением санитарно-гигиенических требований при производстве и хранении пищевых продуктов. Когда вы едите в кафе или других предприятиях общественного питания, то понятно, что вы в определенной степени рискуете, доверяя свое здоровье другим. Но пищевые отравления случаются и дома.

Что такое пищевые отравления? Как от них уберечься?

Пищевое отравление, как правило, возникает при потреблении продуктов, загрязненных большим количеством бактерий или токсинами продуктов жизнедеятельности этих бактерий. Еда может содержать огромное количество бактерий, но при этом выглядеть свежей, доброкачественной и привлекательной. При определенных условиях микробы имеют свойство очень быстро размножаться — уже через 12 часов с одной бактерии может образоваться около 7 миллиардов. Что же это за определенные условия? Вот они: тепло, влага, время. Бактерии, способные вызвать пищевые отравления, растут и размножаются преимущественно при температуре, близкой к температуре тела человека — 37 0 С. При температуре ниже 10 0 С рост всех опасных для нас бактерий замедляется. При температуре выше 63 0 С большинство бактерий погибает.

Что же это за опасные бактерии? Существует несколько групп бактерий, способных вызвать пищевые отравления: кишечные бактерии (сальмонеллы, дизентерийная палочка, условно болезнетворные энтеробактерии), стафилококки, клостридии (в частности, возбудитель ботулизма). Если сальмонеллы обычно находят в определенных пищевых продуктах (яйца, мясо, птица), то клостридии чаще встречаются в окружающей среде — в воде, почве, выделениях животных. Стафилококки выделяют от больных с воспалениями зева или гнойничками на коже.

Еда с большим содержанием сахара, соли, кислоты, жира, а также сухие продукты не способствуют росту бактерий.

Чрезвычайно благоприятной средой для размножения микробов являются продукты с высоким содержанием белков и влаги. Это изделия и блюда из мяса птицы, рыбы, особенно, если они не прошли надежной кулинарной обработки. Например, куриное мясо недостаточно прожаренное у косточек; использование сырых яиц для приготовления крема; сырое молоко и творог или сметана, изготовленные из него; готовые блюда, приобретенные в торговой сети.

Ни в каком случае не ешьте недожаренну (недоваренную) птицу и мясо. После порционирования или измельчения вареное мясо и рыба подлежат повторной термической обработке. Готовые блюда необходимо употреблять свежими. Если пищевой продукт готовился заранее, его следует перед употреблением перекипятить или прожарить, а не разогреть «до теплого». Не подлежат хранению готовые салаты и детское питание.

Хранить продукты необходимо в соответствии с указаниями на упаковке. Важно избегать соприкосновения сырой продукции и готовых блюд. Для этого блюда помещайте в холодильник в плотно закрытой посуде. Яйца храните в холодильнике. Внутреннюю поверхность холодильника мойте теплым раствором соды. С целью повышения эффективности работы холодильного агрегата систематически размораживайте морозильную камеру.

Необходимо мыть руки перед приготовлением или употреблением пищи и после посещения туалета. Следует также мыть руки после разработки сырых яиц, сырого мяса, птицы.

Даже если продукт на вид чистый, его следует помыть. Тщательно мойте фрукты и овощи, которые употребляете сырыми. Горячей водой с моющими средствами для посуды вымывайте рабочий стол на кухне, разделочные доски и кухонный инвентарь, в том числе те предметы, на которых разрабатывали сырое мясо, птицу, яйца. Пользуйтесь на кухне чистыми полотенцем и тряпкой.

Не подавайте на стол продукты, если сомневаетесь в их качестве.

Помните, что болезнетворные и патогенные микробы не видно невооруженным глазом. Если вы сомневаетесь в качестве пищевого продукта, то лучше его выбросить, чем рисковать своим здоровьем и здоровьем своих близких. Будьте особенно внимательными, когда готовите блюда для гостей. Помните, что блюда, приготовленные с нарушением технологии, могут превратить праздник в трагедию. Не следует готовить блюда для других, если у вас расстройство пищеварения, респираторная инфекция или гнойничковая инфекция кожи.

Соблюдайте чистоту, выполняйте правила приготовления и хранения пищи и здоровья вам гарантировано.

С.Б.Гриняк, врач-терапевт

Еда с сюрпризом: в киевских продуктах питания нашли кишечную палочку и стафилококк

7% продуктов питания, которые продаются в Киеве ежедневно, угрожают жизни и здоровью людей. К такому выводу пришли эксперты Госслужбы по вопросам безопасности пищевых продуктов в ходе проверки, в которой поучаствовало более 2 тыс. образцов. Чаще всего не соответствуют нормам мясо, молочные продукты, кондитерские изделия и алкоголь. Кишечную палочку, стафилококк, листерию, стерины и нитраты киевлянам в столицу завозят из Киевской, Черниговской и Днепропетровской областей. 

Как стало известно KV, 19 декабря в информационном агентстве “Укринформ” состоялась пресс-конференция “СТОП Фальсификат. Освещение результатов выявления фальсифицированных мясо-молочных продуктов, которые реализуются в столице”.

Подписывайтесь на новости “КиевVласть”

 

Как отметил начальник Главного управления Государственной службы Украины по вопросам безопасности пищевых продуктов и защиты потребителей в городе Киеве Олег Рубан, в течение года были проведены мероприятия государственного контроля, во время которых для исследования было отобрано 2896 образцов пищевых продуктов и проб смывов. Также было проведено 10 162 исследования по показателям безопасности в Государственном научно-исследовательском институте.

Чаще всего фальсификаты и некачественные продукты выявляли среди мяса, молочной продукции, кондитерских изделий и алкоголя. 

“В этом году Главное управление Государственной службы Украины по вопросам безопасности пищевых продуктов получило более 5 тыс. соответствующих обращений граждан, касающихся недоброкачественных продуктов питания. Было проведено более 200 тыс. отборов образцов продукции и проведены лабораторные исследования. В 7% продуктов питания были выявлены фальсификаты или другая угроза для жизни и здоровья людей. Это кишечная палочка, золотистый стафилококк, листерия, стерины, нитраты в овощах. Также увеличиваются показатели наличия пальмовых масел в продукции, которая поставляется в школы, садики и больницы. Сегодня наша работа в первую очередь направлена на выявление фальсификатов среди молочной и мясной продукции”, – говорит он. 

Стоит отметить, что с начала года были установлены несоответствия по стеринам в молочных продуктах: масле сливочном “Крестьянское 72,5%” (производитель – ООО “Компания ГАЛАКСИ” из г. Сновск Черниговской области), сыре кисломолочном 9,0% производителя ЧП Матвиенко А.В. из города Тараща Киевской области (поставщик – ООО “Ирклия Новая”).

Все лучшее – детям

Также по словам Рубана, пристальное внимание было уделено безопасности пищевых продуктов в учреждениях дошкольного и среднего образования. С начала года в 248 из них было отобрано более 1,5 тыс. образцов пищевых продуктов и сырья.

Были отобраны пробы в 145 дошкольных учебных заведениях и трех школах, проверено 58 учреждений ООО “ПОНТЕМ.УА” (услуги общественного питания), 17 коммунальных предприятий “Школьное питание”, восемь КП “Школьное”, три КП “Школьное питание Оболонского района”, четыре КП “Зенит”, два – “Школьник”  и по одному заведению КП “Школярик”, “Школьник Шевченковского района”, “Луч”, “Гранат”.

По результатам лабораторных исследований из отобранных образцов 115 (или 7,64%) имели несоответствие по микробиологическим и другим показателям. При этом кишечная палочка была найдена в 74 пробах, стафилококк золотистый – в 20, листерия – в 3, стерины – в 4, превышение содержания нитратов в овощах – в 6 пробах.

Особое внимание в Госпродпотребслужбе обратили на то, что в 16 образцах овощей было установлено превышение содержания нитратов. В КП “Школьное питание Оболонского района” такие овощи поставлял ТД “Фортеця”, производителем овощей была ФГ “Журавушка” (с. Пуховка, Броварского района Киевской области). 

Поставщиком овощей с превышениями нитратов в КП “Школьное питание” был производитель – ООО “АГРО ОВЕН” (пгт Магдалиновка Днепропетровской области).

Как отметил глава столичной Госпродпотребслужбы, по каждому случаю несоответствия, ГУ ГПСС в г. Киеве принимает решения об изъятии продукции из обращения и решения о прекращении производства опасных пищевых продуктов.

Также столичная Госпродпотребслужба направляет информационные письма в Антимонопольный комитет, Национальную полицию и территориальные органы Госпродпотребслужбы о случаях фальсификации традиционных молочных продуктов. Производителей и органы ГПСС информируют также о выявленных показателях относительно листерии.

Откуда проблема

Как отметил глава ОО “Укрпотребконтроль” Максим Гончар, главной проблемой отсутствия качества в продуктах, поставляемых в образовательные учреждения, является несовершенство законодательства. 

“Процедура государственных закупок продуктов питания в школы и садики происходит через систему “Прозорро”. В рамках имплементации ассоциации Украины в ЕС мы отменили обязательную сертификацию продукции. И сейчас выигрывает та компания, которая предложила наименьшую стоимость. Единственный документ, который необходим – паспорт качества, который производитель печатает у себя на принтере. Никаких дополнительных проверок не проводится. Но еще страшнее, когда выигрывает компания-перекупщик, которой директор образовательного учреждения может позвонить и договориться взять продукцию деньгами. А потом говорит родителям – давайте скинемся на питание, потому что нам привезли некачественные продукты. Родители скидываются, повар идет на рынок и покупает там самое дешевое сливочное масло, чтобы сэкономить и себе. И это абсолютно реальный случай. Мы постоянно пресекаем подобное”, – говорит он. 

Также Максим Гончар отметил, что решить проблему некачественных продуктов можно с привлечением потребителей. Еще год назад он анонсировал идею создания мобильного приложения, с помощью которого покупатель смог бы просканировать QR-код на упаковке и посмотреть, сколько раз он был проверен на качество и попадался ли производитель на фальсификате. 

Однако, для этого необходимо обязать производителей печатать на упаковках QR-код и выделить государственное финансирование на разработку приложения. 

Напомним, как ранее писала KV, в ноябре наиболее снизились в цене яблоки – на 2,9%, сахар – на 2,3% и филе куриное – на 1,8%. В то же время больше всего подорожали яйца – на 2,2%, молоко – на 2%, батон – на 1,4%.

Читайте: За первый месяц осени гречка подорожала на 22,3%, а куриные яйца подешевели на 6%

Фото: коллаж KV

КиевVласть

Где живут микробы: 10 самых грязных мест в вашем доме :: Жилье :: РБК Недвижимость

Больше всего микробов живет на тех вещах, которые мы обычно упускаем из виду. Перед следующей уборкой советуем обратить внимание на десять самых грязных мест вашей квартиры

Фото: Vanveenjf/Unsplash

С точки зрения микробной заселенности сиденье унитаза — это не самое опасное место в доме. Есть множество других очагов бактерий, которые ежедневно контактируют с нашим организмом. Например, зубные щетки и игровые геймпады. В конце концов такое взаимодействие приводит к пищевым отравлениям и аллергическим реакциям. Тщательная уборка в этих местах поможет обезопасить семью от заболеваний, вызываемых микроскопическими организмами.

Редакция «РБК-Недвижимости» выбрала десять самых опасных вещей в квартире, которым следует уделить особое внимание.

Игровые рули и джойстики

Пульты от игровых приставок часто и подолгу контактируют с нашими руками, но при этом редко дезинфицируются. То же самое относится к смартфонам, компьютерным клавиатурам и мышкам. А если вы любите еще и перекусить во время игры, опасных бактерий будет намного больше. Тем самым вы создаете для них прекрасную питательную среду. Согласно исследованию ЮНИСЕФ, на каждые 100 кв. см игровых рулей и джойстиков приходится примерно 7,86 тыс. микробов. Это в пять раз больше, чем на ободке унитаза. Чтобы продезинфицировать устройство, извлеките из него батарейки и почистите ненужной зубной щеткой. Она должна быть сухой. После этого протрите поверхность геймпада тканью, смоченной в спиртовом или мыльном растворе.

Подлокотники кресел и дивана

Чистить диваны и кресла нужно не только тогда, когда на обивку пролит напиток или рассыпаны крошки. Со временем там накапливается пыль и огромное количество болезнетворных микроорганизмов, среди которых — пылевые клещи. Эти паразиты могут спровоцировать приступ астмы, аллергию, ринит или дерматит. По данным ЮНИСЕФ, на каждых 100 кв. см подлокотников мягкой мебели обитает около 19,2 тыс. микробов. При этом на самом сиденье их в 12 раз меньше. Против микробов на мебели эффективна паровая очистка. Если у вас нет пароочистителя или паровой швабры, можно воспользоваться обычным пылесосом со щелевой насадкой. Особое внимание при этом уделите впадинам между сиденьем, спинкой и подлокотниками.

Кухонная раковина

Остатки пищи и теплая влажная среда в кухонной раковине — раздолье для микробов и грибков. Протирайте раковину после каждого мытья посуды и хотя бы раз в неделю обрабатывайте ее дезинфицирующим раствором. Особенно тщательно следует обработать слив: он считается самой грязной частью раковины. Не менее опасны поролоновые губки для посуды. Из-за высокой влажности и постоянного контакта с остатками пищи в их порах образуются целые колонии микроорганизмов. В ходе исследования Национального научного фонда США (NSF) 86% губок и тряпок дали положительный результат на дрожжи и плесень. В 75% образцов выявили кишечную палочку, еще в 18% — стафилококк. Эксперты рекомендуют менять губку не реже чем раз в неделю.

Разделочные доски

По подсчетам ученых, на поверхности разделочной доски микробов примерно в 200 раз больше, чем на ободке унитаза. Виной всему сырые рыба и мясо. Они содержат множество болезнетворных бактерий, которые гибнут только при термической обработке. Если у вас деревянная доска, на ней вдобавок может поселиться грибок. Старайтесь дезинфицировать доску не реже одного раза в неделю и каждые два-три месяца покупайте новую. Чтобы обезопасить семью, заведите минимум две разделочные доски: для свежего мяса и продуктов, которые употребляются в сыром виде. Например, для огурцов и листьев салата. А после мойки обязательно протирайте кухонные поверхности сухим полотенцем. Из-за влажности оставшиеся микроорганизмы могут выжить.

Мелкие крошки, пятна от соуса, разводы от пролитого супа, контейнеры с немытыми овощами — все это делает холодильник одним из самых антисанитарных мест в доме. Ученые подсчитали: на 1 кв. см здесь обитает около 7,85 тыс. бактерий, в числе которых есть опасные сальмонелла, листерия и кишечная палочка. Избавиться от них помогает регулярная влажная уборка. Освободите холодильник от продуктов и продезинфицируйте все полки и стенки раствором теплой воды и уксуса. Отдельной обработки требует резиновый уплотнитель, где созданы наиболее благоприятные условия для бактерий. Особенно важно следить за чистотой холодильника в летний период: из-за высоких температур скорость размножения микробов увеличивается.

Ванна и шторка для душа

Как и в случае с раковиной, в ванне больше всего бактерий сосредоточено у канализационного слива. Залейте чистящее средство в сливное отверстие и оставьте на 5–10 минут, после чего смойте водой. Во время следующей уборки также не забудьте обработать смеситель, межплиточные швы, насадку для душа и стык между ванной и стеной. Для этого подойдет раствор соды или лимонной кислоты. Еще один очаг бактерий — виниловая шторка для ванной. Внизу она обычно покрыта желтоватыми разводами — это скопления бактерий. Старайтесь менять занавеску как можно чаще или замените ее тканевой, которую можно стирать в машинке. Кроме того, очень важно следить за уровнем влажности воздуха и регулярно проветривать ванную комнату.

Миски для корма животных

Корм может часами находиться в мисках домашних животных. Это создает питательную среду для бактерий и негативно отражается на здоровье питомцев и их хозяев. В кормушках и поилках ученые обнаружили 473,82 тыс. бактерий на 10 кв. см. Особенно опасными считаются пластиковые и керамические миски: в них микробиологи нашли кишечную палочку и стафилококк. Наиболее безвредны изделия из нержавеющей стали и стекла. Миска для корма животных требует ежедневной чистки. Тщательно удалите остатки пищи с помощью горячей воды и моющего средства. Раз в неделю кормушку также необходимо замачивать в растворе отбеливателя. Залейте ее дезинфицирующей жидкостью на 10 минут, затем промойте водой и высушите на воздухе.

Дверные ручки и выключатели

Из-за частого и неизбежного использования дверные ручки становятся одним из наиболее грязных мест в доме. Это же относится к выключателям света и мебельным ручкам. Ученые из Вустерского политехнического института в США обнаружили 1,32 тыс. бактериальных колоний на 27 дверных ручках при оживленном университетском кампусе. Интересно, что уровень опасности напрямую зависит от типа ручки и материала, из которого она изготовлена. Британские исследователи выяснили: больше всего микробов скапливается на ручках рычажного типа. При этом медные ручки эффективно подавляют развитие бактерий. Возьмите за правило дезинфицировать их не реже одного раза в неделю. Для этого подойдут антибактериальные салфетки или спиртовой раствор.

По данным ученых из Манчестерского университета, на зубной щетке обитает более 100 млн бактерий, в том числе кишечная палочка и стафилококк. Она поглощает все виды микробов, летающих в ванной комнате. Например, при смывании унитаза образуется водно-воздушный аэрозоль, насыщенный бактериями. Лучший способ минимизировать риск их распространения — это закрывать крышку перед каждым смыванием и хранить зубную щетку подальше от унитаза. Дорожный футляр для этих целей не подойдет. В нем щетка надолго останется влажной, что увеличит риск возникновения новых бактерий. Держатель для зубной щетки необходимо мыть теплой водой и мылом не реже одного-двух раз в неделю. После этого протрите его дезинфицирующей салфеткой.

Спальный матрас

Матрас буквально кишит пылевыми клещами, грибковыми спорами и бактериями. Основа их рациона — хлопья мертвой кожи. К тому же тут тепло, темно и влажно. Ученые советуют менять матрас через каждые семь-восемь лет. За такой период в нем успевает накопиться в среднем 4,5 кг кожных роговых чешуек. Это провоцирует аллергические реакции — заложенность носа, слезы, чихание, обострение астмы. Вот почему так важно регулярно пылесосить матрас и очищать подушки от пыли. Чтобы продлить «жизнь» матраса, не забывайте регулярно менять постельное белье. Его следует стирать при высокой температуре и гладить утюгом. Для защиты матраса можно также использовать специальные чехлы с влагонепроницаемой поверхностью.

Стафилококковое (Staph) пищевое отравление | Безопасность пищевых продуктов

Что такое пищевое отравление стафилококком?

Пищевое отравление стафилококком — это желудочно-кишечное заболевание, вызываемое употреблением в пищу продуктов, загрязненных токсинами, вырабатываемыми бактериями Staphylococcus aureus (Staph) .

Около 25% людей и животных имеют стафилококк на коже и в носу. Обычно он не вызывает заболеваний у здоровых людей, но стафилококк обладает способностью вырабатывать токсины, которые могут вызвать пищевое отравление.

Как люди заражаются пищевым отравлением стафилококком?

Люди, являющиеся носителями стафилококка, могут заразить пищу, если не вымыть руки перед тем, как прикоснуться к ней. Если пища загрязнена стафилококком, бактерии могут размножаться в ней и производить токсины, которые могут вызвать заболевание. Бактерии стафилококка погибают при приготовлении пищи, но токсины не уничтожаются и по-прежнему могут вызывать болезни.

Пищевые продукты, которые не были приготовлены после обработки, такие как нарезанное мясо, пудинги, выпечка и бутерброды, особенно опасны, если они загрязнены стафилококком.

Пища, загрязненная токсином стафилококка, не должна иметь неприятного запаха и выглядеть испорченной.

Каковы симптомы пищевого отравления стафилококком?

  • Пищевое отравление стафилококком характеризуется внезапной тошнотой, рвотой и спазмами желудка. У большинства людей также бывает понос.
  • Симптомы обычно развиваются в течение от 30 минут до 8 часов после еды или питья продукта, содержащего токсин стафилококка, и длятся не более 1 дня. Тяжелое заболевание встречается редко.
  • Болезнь не может передаваться от одного человека к другому.

Как мне узнать, есть ли у меня пищевое отравление Staph.

Заподозрить пищевое отравление Staph можно на основании типа симптомов и их быстрого разрешения. Хотя лабораторные тесты могут обнаружить стафилококк, продуцирующий токсины, в стуле, рвоте и продуктах питания, эти тесты обычно не назначаются, кроме как во время вспышки. Если вы подозреваете, что у вас пищевое отравление Staph, и вы испытываете серьезные симптомы, обратитесь к врачу.

Как лечится пищевое отравление стафилококком?

Самым важным лечением является обильное питье.Ваш лечащий врач может дать вам лекарство от рвоты и тошноты. Людям с тяжелым заболеванием может потребоваться внутривенное введение жидкости.

Антибиотики бесполезны при лечении этого заболевания, потому что антибиотики не влияют на токсин.

Как я могу предотвратить пищевое отравление стафилококком?

Лучший способ избежать пищевого отравления Staph — это предотвратить хранение пищи при небезопасной температуре (от 40 ° F до 140 ° F) более 2 часов.

Бактерии могут быстро размножаться, если оставить их при комнатной температуре или в «опасной зоне» между 40 ° F и 140 ° F.Никогда не оставляйте скоропортящиеся продукты более чем на 2 часа (или на 1 час, если на улице жарче 90 ° F).

Не забывайте всегда следовать этим советам по безопасности пищевых продуктов:

  • Используйте пищевой термометр и готовьте продукты до минимальной безопасной внутренней температуры (внешний значок).
  • Храните горячую пищу горячей (140 ° F или более), а холодную — холодной (40 ° F или ниже).
  • Храните приготовленную пищу в широких неглубоких контейнерах и охладите в течение 2 часов (или 1 часа, если на улице жарче 90 ° F).

Следующие советы, которые являются частью четырех шагов к безопасности пищевых продуктов — чистка, разделение, приготовление и охлаждение — также могут помочь защитить вас и ваших близких от пищевого отравления:

  • Мойте руки водой с мылом в течение 20 секунд до, во время и после приготовления пищи, а также перед едой.
  • Не готовьте пищу, если вы больны диареей или рвотой.
  • Надевайте перчатки при приготовлении пищи, если у вас есть раны или инфекции на руках или запястьях.

Пищевое отравление стафилококком | Michigan Medicine

Обзор темы

Что такое пищевое отравление стафилококком?

Пищевое отравление стафилококком — это тип пищевого отравления, вызываемый бактерией Staphylococcus aureus ( S. aureus ). Бактерии размножаются в продуктах питания и производят токсины, особенно если пища хранится при комнатной температуре. Токсины могут присутствовать в опасных количествах в продуктах без признаков порчи, например, неприятного запаха.

Что вызывает пищевое отравление стафилококком?

Большинство людей отравляются стафилококком, употребляя зараженную пищу. Наиболее частая причина загрязнения заключается в том, что пища недостаточно горячая [140 ° F (60 ° C) или выше] или достаточно холодная [40 ° F (4 ° C) или ниже].

Продукты, связанные с пищевым отравлением стафилококком, включают:

  • Мясо.
  • Птица и яичные продукты.
  • Салаты, такие как яйца, тунец, курица, картофель и макароны.
  • Выпечка, такая как выпечка с кремовой начинкой, кремовые пироги и шоколадные эклеры.
  • Начинки для сэндвичей.
  • Молоко и молочные продукты.

Каковы симптомы?

Симптомы пищевого отравления стафилококком включают тошноту, рвоту, рвоту, спазмы желудка и диарею. В более тяжелых случаях может наблюдаться обезвоживание, головная боль, мышечные спазмы, а также изменения артериального давления и частоты пульса.

Обычно симптомы проявляются быстро.Насколько они серьезны, зависит от вашей восприимчивости к токсину, количества употребляемой вами зараженной пищи, количества проглоченного токсина и вашего общего состояния здоровья. Состояние обычно проходит через 2 дня. Но нет ничего необычного в том, что полное выздоровление занимает 3 дня, а в тяжелых случаях иногда и дольше.

Как диагностируется пищевое отравление стафилококком?

Пищевое отравление стафилококком диагностируется на основании истории болезни и медицинского осмотра. Ваш врач задаст вам вопросы о ваших симптомах, вашей рабочей и домашней обстановке, а также о продуктах, которые вы недавно ели, и о том, заболели ли другие люди из-за того, что употребляли те же продукты.Посев кала и анализы крови могут быть выполнены, если ваши симптомы серьезны или для исключения других причин.

Как лечится?

Вы лечите пищевое отравление стафилококком, устраняя любые осложнения, пока они не пройдут. Обезвоживание, вызванное диареей и рвотой, является наиболее частым осложнением. Не принимайте лекарства, в том числе антибиотики и другие методы лечения, если их не рекомендует врач.

Чтобы предотвратить обезвоживание, часто делайте глотки напитка для регидратации (например, Pedialyte).Старайтесь выпивать чашку воды или напитка для регидратации при каждом большом жидком стуле. Сода и фруктовые соки содержат слишком много сахара и недостаточно важных электролитов, которые теряются во время диареи, и их не следует использовать для регидратации.

Постарайтесь как можно больше придерживаться своей обычной диеты. Соблюдение обычной диеты поможет вам получать достаточно питания. Врачи считают, что нормальное питание также поможет вам быстрее почувствовать себя лучше. Но старайтесь избегать продуктов с высоким содержанием жира и сахара.Также избегайте острой пищи, алкоголя и кофе в течение 2 дней после исчезновения всех симптомов.

Как можно предотвратить пищевое отравление стафилококком?

Следующие шаги могут помочь предотвратить пищевое отравление стафилококком (адаптировано из Центров США по контролю и профилактике заболеваний).

  • Магазин надежно. Упаковывайте сырое мясо, птицу или рыбу отдельно от других пищевых продуктов. После покупок сразу же поезжайте домой, чтобы можно было правильно хранить все продукты.
  • Готовьте пищу безопасно.Мойте руки до и после еды. Также мойте их после посещения туалета или смены подгузников. Вымойте свежие фрукты и овощи, хорошо ополоснув их проточной водой. По возможности используйте две разделочные доски: одну для свежих продуктов, а другую для сырого мяса, птицы и морепродуктов. Вы также можете мыть ножи и разделочные доски в посудомоечной машине, чтобы продезинфицировать их.
  • Храните продукты безопасно. Готовьте, охлаждайте или замораживайте мясо, птицу, яйца, рыбу и готовые к употреблению продукты в течение 2 часов.Убедитесь, что в вашем холодильнике установлена ​​температура 40 ° F (4 ° C) или ниже.
  • Подавайте пищу безопасно. Держите приготовленную горячую пищу горячей [140 ° F (60 ° C) или выше], а холодную — холодной [40 ° F (4 ° C) или ниже].
  • Следуйте этикеткам на упаковке пищевых продуктов. Этикетки на упаковке пищевых продуктов содержат информацию о том, когда использовать пищу и как ее хранить. Чтение этикеток на пищевых продуктах и ​​следование инструкциям по безопасности снизят ваши шансы заболеть пищевым отравлением.
  • В случае сомнений выбросить.Если вы не уверены, что еда безопасна, не ешьте ее. Повторный нагрев загрязненной пищи не сделает ее безопасной. Не пробуйте подозрительную пищу. Он может хорошо пахнуть и выглядеть, но все же небезопасен для употребления.

Важно уделять особое внимание приготовлению и хранению пищи в теплые месяцы, когда еда часто подается на улице. Бактерии растут быстрее в более теплую погоду, поэтому пища может быстрее испортиться и, возможно, вызвать болезнь. Не оставляйте еду на открытом воздухе более чем на 1 час, если температура превышает 32 ° C (90 ° F), и никогда не оставляйте ее на открытом воздухе более чем на 2 часа.

Золотистый стафилококк — обзор

Золотистый стафилококк часто встречается в мясных продуктах, но обычно в низких концентрациях. Некоторые примеры приведены в таблицах 1 и 2. Данные представлены для обнаружения микроорганизма и токсина обычными методами, но сообщаемые показатели распространенности выше при использовании молекулярных методов, таких как полимеразная цепная реакция (ПЦР).

Таблица 1. Примеры распространенности Staphylococcus aureus a на мясных продуктах или в них, а также распространенность энтеротоксин-положительных штаммов среди изолятов из таких продуктов

901 901 США
Продукт Доля образцов + ve (% ) Изолирует энтеротоксин + ve (%)
Сырая свинина, Франция 57.7 34,6
Копченая ветчина розничной торговли, Франция 11,1 0
Свежее мясо, Италия 26,1 21,4
Фарш 3116
полуфабрикаты из свежего мяса, Италия 10,6 53,7
Ферментированные колбасы, США ND 0
Рыбные продукты, Индия 21 41 901 до есть мясо, Корея 2.1 100
Сырая рыба, Корея 19,8 50
Говядина без костей, Южная Африка 15,8–24,4 ND
ND
ND
ND
Цыпленок, США 25,0 ND
Турция, США 24,6 ND
Турция, США 77 ND
Курица, США 41 ND
Говядина, США 37 ND
Обрезка говядины без костей, США 4.2 ND
Обрезь из говядины без костей, Австралия 4,0 ND
Обрезь из говядины без костей, Новая Зеландия 8,2 ND
62 без костей 901

Сокращение: ND, Не определено.

Источник : Атанасова В., Майндл А., Ринг С., 2001. Распространенность Staphylococcus aureus и стафилококковых энтеротоксинов в сырой свинине и сырой копченой ветчине — сравнение классической детекции культивирования и ПДРФ-ПЦР.Международный журнал пищевой микробиологии 68, 105–113; Бхаргава К., Ван X., Донабедиан С., и др. , 2011. Метициллин-резистентный Staphylococcus aureus в розничной продаже мяса, Детройт, Мичиган, США. Emerging Infectious Diseases 17, 1135–1137; Босилевац, Дж. М., Герни, М. Н., Брихта-Хархай, Д. М., Артур, Т. М., Кухмари, М., 2007. Микробиологическая характеристика импортной и отечественной бескостной говяжьей обрези, используемой для говяжьего фарша. Journal of Food Protection 70, 440–449; Левин, П., Роуз, Б., Грин, С., Рэнсом, Г., Хилл, В., 2001. Тестирование на патогены готовых к употреблению мяса и продуктов из птицы, собранных на контролируемых государством предприятиях в Соединенных Штатах, с 1990 по 1999 год. Журнал of Food Protection 64, 1188–1193; Normanno, G., Firinu, A., Virgilio, S., et al. , 2005. Коагулаза-положительные стафилококки и золотистый стафилококк в пищевых продуктах, продаваемых в Италии. Международный журнал пищевой микробиологии 98, 73–79; О, С.К., Ли, Н., Чо, Ю.С., и др., 2007. Распространение токсигенного Staphylococcus aureus в готовых к употреблению продуктах питания в Корее. Journal of Food Protection 70, 1153–1158; Шейл, К., Люс, Дж. Ф. Р., Вентер, П., Байс, Э. М., 2005. Распространение Staphylococcus sp. На говядине из цехов обвалки скотобойни. Пищевая микробиология 22, 433–438; Саймон, С.С., Санджив, С., 2005. Распространенность энтеротоксигенного Staphylococcus aureus в продуктах рыболовства и рабочих рыбоперерабатывающих заводов. Food Control 18, 1565–1568; и Уотерс, А.E., Contente-Cuomo, T., Buchhagen, J., et al. , 2011. Staphylococcus aureus с множественной лекарственной устойчивостью в мясе и птице США. Клинические инфекционные болезни 52, 1–4.

Заболеваемость Staphylococcus aureus и анализ ассоциированных бактериальных сообществ на поверхности пищевой промышленности

Abstract

Биопленки являются частой причиной загрязнения пищевых продуктов нежелательными бактериями, такими как патогенные бактерии. Золотистый стафилококк — одна из основных бактерий, вызывающих пищевые заболевания человека.Поэтому было проведено исследование, предназначенное для определения присутствия S. aureus на поверхностях, контактирующих с пищевыми продуктами, в среде молочных продуктов, мяса и морепродуктов, а также для выявления сосуществующей микробиоты. Всего было собрано 442 образца, и присутствие S. aureus было подтверждено в 6,1% образцов. Шестьдесят три изолята S. aureus были выделены и типированы методом случайной амплификации полиморфной ДНК (RAPD). Профили были сгруппированы в четыре группы, которые были связаны с конкретной пищевой средой.Все изоляты несли некоторые потенциальные факторы вирулентности, такие как гены продукции энтеротоксина, гены, связанные с образованием биопленок, устойчивость к антибиотикам или лизогения. Отпечатки бактериальных сообществ, сосуществующих с S. aureus , с помощью ПЦР-денатурирующего градиентного гель-электрофореза (ПЦР-DGGE) выявили присутствие бактерий, либо участвующих в порче пищевых продуктов, либо вызывающих озабоченность в отношении безопасности пищевых продуктов во всех пищевых средах. Таким образом, поверхности пищевой промышленности могут быть резервуаром для S. aureus , образуя сложные сообщества с нежелательными бактериями в многовидовых биопленках.Неравномерные микробиологические условия были обнаружены в каждом секторе пищевых продуктов, что указывает на необходимость улучшения гигиенических условий на предприятиях пищевой промышленности, особенно удаления бактериальных биопленок, для повышения безопасности пищевых продуктов.

ВВЕДЕНИЕ

Плохая гигиена на предприятиях пищевой промышленности может привести к загрязнению пищевых продуктов патогенами, что означает серьезный риск для здоровья потребителей. Более того, полное устранение патогенов из окружающей среды пищевой промышленности является сложной задачей, отчасти потому, что бактерии могут прикрепляться к поверхностям, контактирующим с пищевыми продуктами, и образовывать биопленки, где они выживают даже после очистки и дезинфекции (3, 46).Биопленки — это наиболее распространенный бактериальный образ жизни в природе. После первоначального прикрепления клеток к поверхности они начинают размножаться и секретировать устойчивую матрицу внеклеточных полимерных веществ (EPS), в которую клетки обернуты. Биопленки — серьезная проблема во многих секторах пищевой промышленности. В молочной среде бактерии, наиболее часто связанные с поверхностями, контактирующими с пищевыми продуктами, включают Enterobacter , Lactobacillus , Listeria , Micrococcus , Streptococcus , Bacillus , Staphylococcus 0006 и .Они могут попасть в оборудование для переработки молока при прямом контакте с загрязнителями в среде молочной фермы, а также через воду, используемую в доильных машинах. Процедуры безразборной мойки (CIP) обычно используются на линиях переработки молока, но они имеют ограниченную эффективность против остаточных микроорганизмов, которые могут снова расти и образовывать новые биопленки (2). Основными патогенами, подлежащими контролю в мясной промышленности, являются Staphylococcus aureus , Salmonella spp., Campylobacter spp., энтерогеморрагическая Escherichia coli O157: H7 и Listeria monocytogenes . Лучшая стратегия повышения безопасности мясных продуктов — это надлежащая гигиена и применение технологий противомикробного вмешательства на этапах до сбора урожая, после сбора урожая, обработки, хранения, распределения и потребления. Патогенные бактерии, такие как Vibrio spp., E. coli , Clostridium spp., L. monocytogenes и S. aureus , среди других, также могут иногда обнаруживаться в рыбных продуктах (19).Некоторые из этих бактерий могут присутствовать в естественной среде, но многие другие попадают в пищевую цепочку в результате плохих гигиенических условий во время обработки и хранения.

S. aureus — один из основных бактериальных агентов, вызывающих пищевые заболевания человека. Этот микроорганизм может вызвать пищевое отравление из-за выработки энтеротоксинов (24). Люди являются обычными бессимптомными носителями энтеротоксигенного S. aureus в носу, горле и коже. Таким образом, люди, работающие с пищевыми продуктами, могут быть важным источником загрязнения пищевых продуктов.Способность образовывать биопленки позволяет S. aureus выживать в агрессивных средах, таких как поверхности пищевой промышленности (13), и это увеличивает повторное заражение пищевых продуктов.

В последние годы широкое использование антибиотиков вызвало экспоненциальный рост случаев устойчивости к антибиотикам у нескольких групп бактерий. Таким образом, штаммы S. aureus с множественной лекарственной устойчивостью довольно распространены в больницах и на фермах, но также были обнаружены у сельскохозяйственных животных и в таких продуктах питания, как мясо, молоко и молочные продукты, а также в рыбных продуктах (23).Пищевая цепь считается потенциальным путем передачи устойчивых к антибиотикам бактерий человеку.

Настоящая работа направлена ​​на оценку гигиенических условий поверхностей, контактирующих с пищевыми продуктами, в молочной, мясной и морепродуктовой промышленности путем скрининга на наличие S. aureus . Детерминанты вирулентности, такие как устойчивость к антибиотикам, гены, кодирующие энтеротоксины, и способность к образованию биопленок были проанализированы на изолятах. Также оценивался статус лизогении, поскольку некоторые гены, кодирующие вирулентные факторы, находятся в фагах.Кроме того, ассоциированные микробные сообщества, присутствующие в образцах окружающей среды, в которых было обнаружено S. aureus , были исследованы с помощью ПЦР-денатурирующего градиентного гель-электрофореза (DGGE) для лучшей идентификации микробных рисков безопасности пищевых продуктов в этих пищевых средах.

МАТЕРИАЛЫ И МЕТОДЫ

Бактериальные штаммы, среды и условия роста.

Бактериальные штаммы, используемые в качестве положительного контроля для ПЦР, перечислены в. S. aureus Sa9 (11) и S.aureus ATCC 15981, с одной стороны, и Staphylococcus epidermidis F12 (7), с другой, были использованы в качестве положительного и отрицательного контроля, соответственно, для всех биохимических тестов (активность ДНКазы, ферментация маннитола и тест коагулазы) (см. ниже). S. aureus ATCC 25923 использовали в качестве контроля чувствительности к антибиотикам. Все штаммы обычно культивировали в триптическом соевом бульоне (TSB) при 37 ° C или в триптическом соевом агаре (TSA). Бактериальные запасы хранили при -80 ° C в TSB с добавлением глицерина (конечная концентрация 20% [об. / Об.]).

Таблица 1

Праймеры и бактериальные штаммы, использованные в ПЦР, проведенных в этой работе

27

9 0478 CCTTTGGAAACGGTTAAAACG CTAC1 62 72 9016GGTAT9 SEh2 GTCTAT AAGATATAGCGATAAGTGC ИАП AAACGTAAGAGAGGTGG
Ген или реакция Контроль S. aureus штамм Праймер Последовательность праймера (5’– 3 ‘) ампликона размер (п.о.) Ссылочный ген
16S рРНК 27FYM AGAGTTTGATYMTGGCTCAG 1 499 45
1492R ‘ GGTTACCTTGTTACGACTT
V2-V3 область гена 16S рРНК F357-GC CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGTACGGGAGGCAGCAG 161 29
F357 TACGGGAGGCAGCAG
90 162 R518 ATTACCGCGGCTGCTGG
RAPD-ПЦР OPL5 ACGCAGGCAC 17
RAPD5 AACGCGCAAC
Р1 CCGCAGCCAA
ERIC2 AAGTAAGTGACTGGGGTGAGCG 41
AP7 GTGGATGCGA 41
S TCACGATGCA TCACGATGCA
27
127 1
SEA4 TCTGAACCTTCCCATCAAAAAC
СЕБ АТСС 14458 SEB1 TCGCATCAAACTGACAAACG 477
SEB4 GCAGGTACTCTATAAGTGCCTGC
сек SEC3 CTCAAGAACTAGACATAAAAGCTAGG 271
SEC4 TCAAAATCGGATTAACATTATCC
sed ATCC47 13565 ATCC47 13565 319
SED4 TTAATGCTATATCTTATAGGGTAAACATC
см ATCC 27664 SEE2 TAACTTACCGTGGACCCTTC 178
SEE3 CAGTACCTATAGATAAAGTTAAAACAAGC
SEG б АТСС 19095 SEG1 AAGTAGACATTTTTGGCGTTCC 287 32
SEG2 AGAACCATCAAACTCGTATAGC
SEH B
SEh3 GACCTTTACTTATTTCGCTGTC
сеи б SEI1 GGTGATATTGGTGTAGGTAAC 454
SEI2 ATCCATATTCTTTGCCTTTACCAG
МСАН АТСС 15981 МСАН-F CCTAACTAACGAAAGGTAG +1315 43
МСАН-R
ИАП-F 381
ИАП-R GGCAATATG ATCAAGATAC
BAP + V329 SASP-6 м CCCTATATCGAAGGTGTAGAATTGCAC 971 6
SASP-7c GCTGTTGAAGTTAATACTGTACCTGC

Дизайн выборки.

Всего было отобрано 442 образца с различных поверхностей, контактирующих с пищевыми продуктами, на предприятиях молочной, мясной и морской промышленности (146, 124 и 172 соответственно). Отбор проб проводился за 18 посещений с февраля 2010 г. по февраль 2011 г. Образцы были взяты в асептических условиях с поверхности, покрывающей приблизительно 100 см 2 , с использованием стерильных губок для отбора проб, смоченных нейтрализующим бульоном LPT (Laboratorios Microkit SL, Мадрид, Испания), а затем транспортированы при 4 ° C в лабораторию для немедленной обработки.

Микробиологический анализ.

Губки для отбора проб смешивали со 100 мл пептонной воды и взбивали в мастикаторе стоматолога (IUL Instruments, Барселона, Испания). Затем 0,1 мл суспензии образца наносили на агар Baird-Parker (BP), дополненный эмульсией теллурита яичного желтка (Biolife, Милан, Италия, и Scharlab, Барселона, Испания). Планшеты инкубировали при 37 ° C в течение 48 часов. Выделение и идентификация S. aureus проводились путем случайного отбора нескольких предполагаемых S.aureus колоний каждого образца. Колонии выделяли повторными пересевами, а затем изоляты тестировали на активность ДНКазы и ферментацию маннита (30). Тест на коагулазу также был выполнен в соответствии с инструкциями поставщика (Bactident Coagulase; Merck, Мадрид, Испания). Все предполагаемые изоляты S. aureus были подтверждены амплификацией ПЦР и секвенированием (см. Ниже) гена 16S рРНК ().

Общее количество жизнеспособных клеток получали путем посева соответствующих 10-кратных разведений суспензий образцов на агаре для подсчета планшетов (PCA; Scharlau, Барселона, Испания) с последующей инкубацией при 30 ° C в течение 48-72 часов.

Присутствие резидентных профагов в штаммах S. aureus проверяли после индукции митомицина С, как описано ранее (16). Чувствительность к противомикробным препаратам определяли с использованием метода дисковой диффузии и концентраций, указанных в CLSI (5). Были использованы следующие 10 антибиотиков: триметоприм-сульфаметоксазол (1,25 / 23,75 мкг), рифампицин (5 мкг), оксациллин (1 мкг), клиндамицин (2 мкг), эритромицин (15 мкг), энрофлоксацин (5 мкг), ванкомицин (5 мкг). мкг), ципрофлоксацин (5 мкг), стрептомицин (10 мкг) и хинупристин-далфопристин (15 мкг) (Oxoid, Hampshire, United Kingdom).Продукция слизи штаммов S. aureus определялась методом конголезского красного агара (CRA), согласно Freeman et al. (10).

Манипуляции с ДНК.

ДНК

экстрагировали из предполагаемых изолятов S. aureus с использованием коммерческого набора GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich, Мадрид, Испания) в соответствии с рекомендациями производителя. Полную геномную ДНК из положительных образцов для S. aureus выделяли с помощью мини-набора для анализа ДНК QIAamp (Qiagen, GmbH, Hilden, Германия) в соответствии с оптимизированным протоколом (28) с дополнительной стадией ферментативного лизиса бактерий.Это в основном состояло из предыдущей обработки осадка бактериальных клеток лизоцимом 30 мг / мл (Sigma), 20 единицами мутанолизина (Sigma) и 50 мкг / мл лизостафина (Sigma) при 37 ° C в течение 60 мин. ПЦР выполняли в термоциклере (Bio-Rad, Hercules, CA) с использованием набора PureTaq Ready-To-Go PCR Beads (GE Healthcare, Мюнхен, Германия) и праймеров, указанных в. Все продукты ПЦР разделяли электрофорезом в 2% агарозных гелях, окрашивали бромидом этидия и визуализировали в УФ-свете с помощью системы документации Gel Doc 2000, оснащенной программным обеспечением Quantity One (Bio-Rad Laboratories, Hercules, CA).Лэддер ДНК размером 500 п.н. был включен во все гели.

Автоматическое секвенирование продуктов ПЦР выполняли с использованием секвенатора генов ABI Prism (Applied Biosystems, Foster City, CA) в Secugen S.L. (Мадрид, Испания). Нуклеотидные последовательности идентифицировали путем сравнения с последовательностями, доступными в базе данных GenBank, с использованием алгоритма BLAST.

Геномный фингерпринт

изолятов S. aureus .

Случайная амплификация профилей полиморфной ДНК (RAPD) была получена для каждого изолята с праймерами OPL5, RAPD5, P1, ERIC2, AP7 и S () с использованием ранее описанного метода (21).Структуры полос RAPD-PCR сканировали и анализировали с использованием коэффициента корреляции момента произведения Пирсона. Кластерный анализ проводился методом невзвешенных парных групп со средними арифметическими (UPGMA) (39).

Анализ DGGE.

Область V2-V3 гена 16S рРНК амплифицировали с помощью специфичных для эубактерий праймеров F357-GC и R518 (), используя в качестве матрицы тотальную геномную ДНК из S. aureus -положительных образцов окружающей среды.

Реакционные смеси содержали 0.25 мкМ каждого праймера, 200 мкМ каждого дезоксинуклеозидтрифосфата (Amersham Bioscience, Упсала, Швеция) и 2,5 ед. Полимеразы Taq (Eppendorf, Гамбург, Германия). Продукты ПЦР разделяли в 8% полиакриламидных гелях с использованием градиента денатурирования формамида мочевины от 40 до 50%. Электрофорез проводили в приборе Dcode System (Bio-Rad) при 85 В в 0,5-кратном буфере трис-ацетат-ЭДТА (ТАЕ) при постоянной температуре 60 ° C в течение 16 часов. Гели визуализировали окрашиванием бромистым этидием, как описано выше.

Полосы, наблюдаемые DGGE, были первоначально идентифицированы путем сравнения с полосами маркера DGGE, созданного с использованием хромосомной ДНК чистых культур видов S. aureus , Staphylococcus sciuri , Enterococcus faecium , Enterococcus faecalis и Macrococcus caseolyticus , ранее выделенный из некоторых исследуемых образцов. ДНК получали с помощью набора GenElute Bacterial Genomic DNA и использовали для амплификации ПЦР с использованием тех же праймеров, которые описаны выше.Ампликоны очищали с использованием колонок GenElute PCR Clean-Up (Sigma-Aldrich) и смешивали равные количества для получения маркера DGGE.

Доминантные полосы, которые не соответствовали ни одной из полос, присутствующих в маркере DGGE, вырезали из акриламидных гелей и использовали в качестве матриц для анализа секвенирования. Вырезанные полосы ДНК ресуспендировали в 100 мкл стерильной сверхчистой воды и оставляли на ночь при 4 ° C. Затем элюированную ДНК использовали для проведения вторичной ПЦР-амплификации с использованием праймеров F357 (без зажима GC) и R518 ().Продукты ПЦР очищали с использованием колонок GenElute PCR Clean-Up и секвенировали, как указано выше. Последовательности сравнивали с теми, что присутствуют в базе данных GenBank, с использованием алгоритма BLAST, и идентичность изолятов определялась на основе наивысших баллов. К видовому уровню были отнесены только последовательности с процентом сходства 97% и выше.

РЕЗУЛЬТАТЫ

Идентификация

S. aureus на поверхностях, контактирующих с пищевыми продуктами, и анализ ассоциированных бактериальных сообществ.

Всего было собрано 442 образца с поверхностей, контактирующих с пищевыми продуктами, на трех предприятиях молочной, трех мясной и двух рыбной промышленности (). Отбор проб производился после применения стандартных процедур очистки и дезинфекции. Присутствие S. aureus в этих образцах определяли путем посева на агар ВР с последующим подтверждением с помощью биохимических тестов. ПЦР-амплификация и секвенирование гена 16S рРНК всех предполагаемых изолятов S. aureus были также выполнены для дальнейшего подтверждения.Таким образом, было обнаружено, что S. aureus присутствует в 27 образцах (4, 6 и 17 из предприятий молочной, мясной и морской промышленности, соответственно), что означает 6,1% случаев в мире. Уровни заболеваемости 2,73%, 3,22% и 9,88% были обнаружены на поверхностях, контактирующих с молочными продуктами, мясом и морепродуктами, соответственно. Всего из этих образцов было выделено 63 изолята. Из них 5 (с именами от IPLA1 до IPLA5, где IPLA означает Instituto de Productos Lácteos de Asturias) были получены из молочного сектора и 13 (с именами от IPLA6 до IPLA18) были получены с поверхностей, контактирующих с мясом, тогда как 45 изолятов (с именами от IIM201 до IIM250, где IIM указывает, что Instituto de Investigaciones Marinas) были получены из морепродуктов ().

Таблица 2

Описание образца, общее количество жизнеспособных клеток и S. aureus единиц a

1 Приемный бак 9047 C 9047 9047 9047 9047 9047 9047 72 6,1 904 8.5E2 ± 3.1E2
Пищевая промышленность (номер участка) Происхождение Название образца Кол-во КОЕ / см 2 (если не указано иное) методом гальваники b
S. aureus штамм (и)
PCA BP
A 7.8E3 ± 2.3E2 1.1E2 ± 4.2E1 IPLA1
B 1.4E4 ± 2.4E1 1.4E2 ± 4.8E1 IPLA2
9.3E2 ± 4.2E1 <10 IPLA3, IPLA4
D 7.0E2 ± 6.9E1 <10 IPLA167 0 1 IPLA167 901 556 ND IPLA6
434 ND IPLA7
7E6 ± 1.4E5 1.7E3 ± 1.9E2 IPLA8, IPLA9, IPLA10, IPLA11, IPLA12
Мясо (2) Пластиковая шторка 1 F 1.1.9167 ± E 3.3E2 IPLA13, IPLA14
Мясо (3) Пластиковая шторка 2 G 5.7E4 ± 9.8E3 1.9E3 ± 1.3E2 IPLA162 IPLA162 H 3.2E5 ± 4,2E4 1,2E2 ± 4,6E1 IPLA17
IPLA18
для морепродуктов E5 ± 5.0E4 4.7E4 ± 1.7E4 IIM201, IIM202, IIM203, IIM204
Санитарный доступ I 1.2E2 ± 2.1E2 1.2162 IIE2
Вилочный погрузчик 2 Zcom.3 6.4E4 ± 3.0E4 7.1E3 ± 3.7E3 IIM209, IIM210, IIM211, IIM212,
Этаж 1 J <10 <10 Этаж 2 K 5.0E1 ± 2.3E1 <10 IIM215
Бункер L 9.3E1 ± 3.2E1 9.3E1 ± 3.2E1 Конвейерная лента 1A.5a 2.3E1 ± 1.5E1 <10 IIM217
Сливная труба M 3.1E3 ± 2.6E2 3.1E3 ± 1.2E2 IIM2 * N 1.9E2 ± 7.4E1 * <10 * IIM221
Морепродукты (2) Неизвестно 2 9016 II2 , IIM224, IIM225, IIM226, IIM227
Морепродукты (3) Конвейерная лента 1 O 1.9E3 ± 8.8E2 1.6E2 ± 1.8E2 IIM228, IIM229, IIM230, IIM231, IIM232, IIM233, IIM250
Вилочный погрузчик1 4,8162 P 2,8162 P E2 IIM234, IIM235, IIM236
Q 5.6E2 ± 7.9E1 1.8E2 ± 1.2E1 IIM237
3.0E2 ± 9.5E1 IIM238, IIM239, IIM240
Щеточное оборудование S 4.4E1 ± 1.8E1 3.2E1 ± 1.1E1 IIM241, IIM239 901 902 4.5E1 ± 2.7E1 IIM243, IIM244
Конвейерная лента 2 U 1.1E2 ± 9.6E1 3.8E1 ± 2.2E1 II24, II24, II 24M , IIM248 IIM249,

Общее количество бактерий на PCA также определялось для оценки бактериальной нагрузки в образцах, в которых S.aureus . Уровни подсчета варьировались от 10 2 до 10 4 КОЕ / см 2 в пробах из молочной промышленности, от 10 5 до 10 7 КОЕ / см 2 на поверхностях, контактирующих с мясом, и от 10 1 до 10 3 КОЕ / см 2 на поверхностях в индустрии морепродуктов (). В целом общее количество бактерий сильно коррелировало с количеством бактерий S. aureus , особенно в молочной и рыбной промышленности. Таким образом, самые высокие уровни загрязнения, обнаруженные в каждом секторе пищевых продуктов, коррелировали с самыми высокими показателями АД.

Микробиота, сосуществующая с S. aureus , была идентифицирована с помощью отпечатков пальцев ПЦР-DGGE в сочетании с анализом последовательности доминирующих ампликонов в 21 из 27 образцов (4 из молочной промышленности, 4 из мясной промышленности и 13 из индустрии морепродуктов) . Как показано на фиг.4, в профилях DGGE наблюдалось несколько заметных полос от двух до шести. Как и ожидалось, S. aureus (полоса 2) присутствовали во всех образцах. Leuconostoc citreum (полоса 1) был наиболее частым партнером, обнаруженным в 15 (71%) образцах, что указывает на широкое распространение этого вида в этих трех пищевых секторах, особенно в молочной промышленности.Микробное разнообразие, обнаруженное в образцах молочных продуктов, также включает Enterococcus faecium (полоса 4), Pseudomonas sp. (полоса 5), Acinetobacter (полоса 6), Lactobacillus plantarum (полоса 9) и Macrococcus caseolyticus (полоса 12). Что касается мясной промышленности, следует отметить, что Acinetobacter и L. plantarum присутствовали во всех образцах, тогда как Morganella psychorotolerans (полоса 7), Serratia sp.(полоса 14), Streptococcus sp. (полоса 15) и Bacillus cereus (полоса 16) также были обнаружены в некоторых случаях. Несмотря на большое количество образцов, собранных в индустрии морепродуктов, микробное разнообразие в профилях DGGE было ниже, чем наблюдаемое в молочном и мясном секторах, хотя такие бактерии, как Streptococcus uberis (полоса 8), Staphylococcus epidermidis (полоса 3), Pseudoalteromonas piscicida (полоса 10), Campylobacter sp.(полоса 11) и Psychrobacter sp. (полоса 13) были обнаружены только в образцах, собранных в этой пищевой среде.

Профили DGGE микробных популяций, сосуществующих с Staphylococcus aureus на поверхностях пищевой промышленности, с использованием ампликонов вариабельной области V3 бактериального гена 16S рРНК. Полосы обозначены в таблице справа. Mk: опознавательный маркер DGGE. Lc , Leuconostoc ; фунтов , Lactobacillus ; Str , Streptococcus .

Генетическое разнообразие изолятов.

Для определения генетического разнообразия изолятов S. aureus и изучения его предполагаемой взаимосвязи с конкретной пищевой средой все 63 изолята были проанализированы с помощью генотипирования RAPD-PCR с использованием шести различных праймеров (). На основе профилей RAPD изоляты были сгруппированы в два основных кластера (I и II) (). Каждый из этих кластеров был далее подразделен на два подкластера (Ia, Ib, IIc и IId). Каждый подкластер почти соответствовал происхождению изолятов.Кластер I включал большинство изолятов из индустрии морепродуктов (с процентом сходства 67%). Кластер II, имеющий 62% сходства с кластером I, включал все остальные изоляты из сектора морепродуктов, а также все изоляты из молочной и мясной промышленности. Несмотря на различное происхождение, все молочные и мясные изоляты были сгруппированы в подкластер IId и показали сходство более 71%. Напротив, в этот подкластер не был включен изолят, полученный из морепродуктов.

Дендрограмма, полученная кластерным анализом профилей RAPD-PCR изолятов Staphylococcus aureus с поверхностей пищевой промышленности с использованием метода UPGMA и коэффициента корреляции моментов продукта Пирсона.Пунктирная линия представляет собой пороговое значение подобия 95%, установленное для различения деформаций.

На основе этих результатов было установлено пороговое значение 95%, так что все шаблоны с подобием выше, чем это значение, считались идентичными. В этом отношении изоляты морепродуктов (45) дали 18 образцов RAPD-PCR, изоляты мяса (13) имели 9 общих образцов, а изоляты молочных продуктов (5) имели 3 различных образца. Все изоляты с одним и тем же паттерном считались клонами, то есть генетически близкородственными штаммами.

Наличие потенциальных факторов вирулентности у

штаммов S. aureus .

Затем был выбран один изолят, представляющий каждый из 30 различных профилей RAPD-PCR, и протестирован на наличие генов, кодирующих энтеротоксин, потенциального образования биопленок и лизогении. Гены стафилококкового энтеротоксина (SE) были обнаружены с помощью двух мультиплексных ПЦР для генов , с одной стороны, и генов seg-sei , с другой. В целом, 27 штаммов (90%) были положительными по гену sea , seg , seh или sei ().Присутствие генов sea (63%), seg (40%) и sei (77%) было широко распространено в изолятах из всех пищевых секторов. В частности, изоляты, сгруппированные в подкластеры Ia и IIc (все из морепродуктов), показали самую высокую частоту генов sei (данные не показаны). Напротив, ни один изолят подкластера Ia не содержал ген seh , хотя этот ген был ограничен средой мяса и морепродуктов (17%). Всего 20 (66%) изолятов содержали от двух до четырех генов SE и, следовательно, были потенциальными продуцентами более чем одного энтеротоксина.Гены seb , sec , sed и see не были обнаружены ни в одном из изолятов. Некоторые штаммы, не продуцирующие энтеротоксин (IPLA7, IPLA16 и IPLA18), были выделены из мясной среды.

Таблица 3

Наличие факторов вирулентности у штаммов S. aureus из различных пищевых сред

904 904 9015
Промышленность Количество штаммов Частота указанной характеристики (% штаммов)
Ген энтеротоксина
Промежуточная устойчивость к антибиотикам a
Lysogeny Ген, ассоциированный с образованием биопленок
sea 9000 905 seb 9000 902 seb 9000 902 seb см. сегмент seh sei OX ENR CIP STR 59 icaA 5 icaA 5 icaA Молочная 3 100 90 162 33 67 33 67 60 100 100 100 100 44 33 33 11 11 33 54 100 100 0 39 6 100 17 91 100 100 40 13 77 3 3 3 27 81 100 100

Способность этих изолятов образовывать биопленки оценивали путем визуального осмотра образования слизи на чашках CRA.Все изоляты образовывали черные колонии, которые считаются представителями сильных биопленкообразователей. Также была проведена ПЦР-амплификация некоторых генов, участвующих в формировании биопленок ( icaA , icaD и bap ). Все изоляты были положительными по генам icaA и icaD , тогда как ген bap не был обнаружен ни в одном изоляте ().

Лизогению также тестировали на 30 штаммах, представляющих каждый различный профиль RAPD-PCR.Наличие профагов выявлено у 18 штаммов (60%). Ни один из других штаммов (два штамма из молочной промышленности, шесть из мясной среды и четыре из индустрии морепродуктов) не выделял фагов, способных заразить какой-либо из штаммов, протестированных в исследовании. Хотя лизогения была широко распространена у изолятов из всех пищевых сред, примечательно, что самый высокий процент наблюдался у изолятов из сектора морепродуктов ().

Чувствительность к противомикробным препаратам.

То же 30 S.Изоляты aureus также были исследованы на чувствительность к 10 антибиотикам, обычно используемым в медицинской и ветеринарной практике. Всего 21 штамм (70%) оказался чувствительным ко всем протестированным антимикробным препаратам. Однако промежуточная устойчивость наблюдалась у штаммов, выделенных из трех пищевых секторов (). Промежуточная устойчивость наблюдалась к стрептомицину (восемь изолятов) и оксациллину, энрофлоксацину и ципрофлоксацину (по одному изоляту) ().

ОБСУЖДЕНИЕ

Патогенность пищевого происхождения S.aureus связано со способностью некоторых штаммов продуцировать энтеротоксины (24). Устойчивость к противомикробным препаратам, особенно к β-лактамным антибиотикам, также вызывает серьезную озабоченность как возникающая проблема в пищевой среде (23). Адгезия и образование биопленок также являются важными факторами вирулентности для S. aureus , поскольку они способствуют заселению пищевых сред (3). Фактически, биопленки, образующиеся на поверхностях обработки пищевых продуктов, повышают устойчивость к дезинфицирующим средствам, тем самым увеличивая риск перекрестного заражения пищевых продуктов.Следует отметить, что образование биопленки S. aureus может быть усилено некоторыми условиями обработки, используемыми в пищевой промышленности, такими как субоптимальная температура роста или комбинированное присутствие соли и глюкозы (37).

Настоящее исследование предоставляет информацию о заболеваемости S. aureus в молочной, мясной и рыбной промышленности. S. aureus был выделен из 27 из 442 образцов, что дает общую заболеваемость 6,1%. S. aureus уже был обнаружен в более высокой доле (11.7%) с поверхностей, контактирующих с пищевыми продуктами, мясоперерабатывающих предприятий (14). В другом предыдущем исследовании (33) сообщалось о еще более высокой заболеваемости (15,5%) в оборудовании предприятий по переработке свинины; однако отбор проб проводился не после дезинфекции поверхностей, а через 5 часов работы.

Уровень загрязнения поверхностей, контактирующих с пищевыми продуктами, S. aureus предполагает, что необходимо улучшить обращение с домашним скотом, а также очистку и дезинфекцию объектов пищевой промышленности. В этом отношении необходимо отметить, что все изоляты продемонстрировали потенциальную способность образовывать биопленки, что может позволить им прилипать к различным поверхностям, контактирующим с пищевыми продуктами.Эти биопленки могут быть потенциальным источником загрязнения пищевых продуктов, вероятно, из-за неудовлетворительного применения дезинфицирующих средств против клеток, связанных с биопленкой (42).

Все штаммов S. aureus , выделенных в этом исследовании, по-видимому, зависели от продукции полисахаридного межклеточного адгезина (PIA) для образования биопленок, поскольку они несли гены icaA и icaD , тогда как ген bap , связанный с ica -независимого образования биопленок не обнаружено (31).Однако бактериальные биопленки обычно состоят из нескольких различных видов, среди которых могут быть патогенные бактерии или бактерии, вызывающие порчу. Было обнаружено, что S. aureus образует смешанные биопленки с другими бактериями во всех пищевых средах. Микроорганизмы, сосуществующие с S. aureus на поверхностях пищевой промышленности, были идентифицированы с помощью PCR-DGGE для выявления любых других рисков для безопасности пищевых продуктов. В основном они имели экологическое происхождение и, скорее всего, переносились поступающими сырыми пищевыми продуктами.Таким образом, консорциумы были специфичны для каждой пищевой среды, за исключением L. citreum , который присутствовал во всех пищевых секторах. Некоторые бактериальные ампликоны принадлежали к родам, обычно встречающимся в почве и воде ( Pseudomonas sp., Acinetobacter sp., Psychrobacter sp. И Serratia sp.), Включая эндоспорообразующие бактерии, такие как B. cereus . .

Также стоит отметить присутствие ДНК распространенных патогенных бактерий, таких как B.cereus , S. uberis или представители рода Campylobacter в некоторых образцах. Присутствие этих бактерий на поверхностях, контактирующих с пищевыми продуктами, следует рассматривать как повод для беспокойства, поскольку они также могут загрязнять пищевые продукты, обрабатываемые на этих объектах. E. faecium обычно встречается в большом количестве традиционных сыров, но присутствие нескольких предполагаемых факторов вирулентности, которые способствуют распространению в организме человека и провоцируют инфекцию, усилило беспокойство по поводу этих бактерий (8).Два образца из морепродуктов включали Campylobacter sp., Род, часто выделяемый из продуктов птицеводства, а иногда и из мидий и других моллюсков. Предположительно источником этого загрязнения являются чайки, кормящиеся вблизи водоемов с морепродуктами (40). Наконец, Bacillus cereus признан серьезной проблемой и важным загрязнителем в условиях пищевой промышленности, например, на предприятиях по переработке красного мяса, где он обычно выделяется с различных поверхностей предприятий по производству пищевых продуктов (20).

Обнаружены также бактерии, которые могут быть причиной порчи пищевых продуктов. Это было в случае L. citreum , обычно обнаруживаемого в сырах, который был выделен из всех трех секторов пищевой промышленности. Этот вид был идентифицирован как источник порчи мясных продуктов (18) и рыбных продуктов в вакуумной упаковке (25). Широко распространенное присутствие L. citreum на поверхностях, контактирующих с пищей, можно объяснить его способностью продуцировать различные внеклеточные глюканы, которые могут участвовать в образовании биопленок (22). L. plantarum , который обычно содержится в некоторых ферментированных пищевых продуктах (молочных, мясных и овощных), также был обнаружен в пробах из молочной и мясной среды. Этот микроорганизм также может вызывать порчу мясных продуктов, но, что наиболее важно, он может образовывать смешанные биопленки с патогенными бактериями, такими как L. monocytogenes (42). Другая бактерия порчи, M. Psyrotolerans , была обнаружена на поверхностях, контактирующих с мясом. Эта бактерия может производить токсичные концентрации гистамина даже при хранении пищевых продуктов в охлажденном виде (9).

Изучение генетических взаимоотношений между изолятами от каждой пищевой промышленности может предоставить интересные данные об источниках заражения. Анализ RAPD-PCR показал клональное распределение изолятов, которое, вероятно, связано с источником заражения. Замечательная генетическая взаимосвязь между молочными и мясными штаммами (подкластер IId) позволила нам задуматься о животном происхождении этих штаммов. S. aureus является основным компонентом микробиоты кожи животных, откуда он может распространяться на пищевые продукты или перерабатывающие предприятия как в молочной, так и в мясной промышленности.Напротив, генетические различия, наблюдаемые среди изолятов из морепродуктов, можно объяснить контаминацией, имевшей место во время обработки и обработки, с человеческими носителями в качестве основного источника (38). Распространение S. aureus в пищевой среде может вызвать загрязнение пищевых продуктов, что подразумевает некоторый риск стафилококкового пищевого отравления в молочных, мясных и рыбных продуктах, которые поддерживают рост S. aureus .

Четкие генетические различия наблюдались между изолятами, полученными из морепродуктов, и изолятов из молочной и мясной среды.Было обнаружено, что эти различия коррелировали с присутствием некоторых факторов вирулентности, при этом наибольшая частота встречаемости генов sei и лизогении наблюдалась у изолятов из морепродуктов. Явные генетические различия наблюдались также среди изолятов из морепродуктов в зависимости от происхождения образцов, при этом изоляты из каждого предприятия были сгруппированы в разные подкластеры (Ia, Ib и IIc). Устойчивость к антибиотикам была гораздо более частой у штаммов из молочной промышленности, чем у штаммов из мяса и морепродуктов.Вполне вероятно, что они подверглись большему воздействию некоторых антибиотиков (используемых в ветеринарной практике), чем изоляты, полученные из морепродуктов.

Было обнаружено, что большинство штаммов (90%) являются потенциально энтеротоксигенными и, следовательно, патогенными, поскольку они несут по крайней мере один ген SE, который может быть источником стафилококкового пищевого отравления. В настоящее время доказано, что девять различных серологических типов SE (SEA-SEE и SEG-SEJ) обладают рвотной активностью (35). Сообщалось, что классические стафилококковые энтеротоксины (от SEA до SEE) вызывают 95% стафилококковых пищевых отравлений.Среди них SEA является наиболее распространенным явлением при пищевых отравлениях, связанных с стафилококком (35). В этой работе штаммы из молочной и рыбной промышленности показали самую высокую распространенность гена sea . Следовательно, присутствие гена sea в многочисленных изолятах подразумевает высокий риск для потребителей. Следует отметить, что большинство штаммов были носителями мульти-SE. Это относится к девяти штаммам (один из молочной промышленности и восемь из среды морепродуктов), несущих три гена SE, и к одному штамму (IPLA17, из мясной промышленности), несущему четыре гена SE.Также была обнаружена высокая частота генов seg-sei . Ранее сообщалось, что ген sei часто встречается в изолятах от субклинического мастита крупного рогатого скота (15) и мясных продуктов (36). В этом исследовании этот ген также присутствовал во всех штаммах морепродуктов. Однако считается, что SEG и SEI играют незначительную роль в пищевых отравлениях. Напротив, предыдущий отчет показал, что значительная часть изолятов от стафилококковых пищевых отравлений в Южной Корее имеет seg-sei генов, либо отдельно, либо с другими генами SE (4).

Лизогенный статус, продемонстрированный 60% штаммов, представляет собой возможный дополнительный фактор риска для здоровья. Бактериофаги играют важную роль в патогенности S. aureus либо за счет дополнительных факторов вирулентности, таких как лейкоцидин Пантона-Валентайна (PVL) (кодируется опероном luk -PV), стафилокиназа (кодируется sak ). , энтеротоксин A (кодируется sea ) и эксфолиативный токсин A (кодируется eta ), или путем прерывания генов хромосомной вирулентности, например, для β-гемолизина ( hlb ) и липазы ( geh ).Кроме того, фаги способствуют адаптации патогена к условиям хозяина. Наши данные подтверждают предыдущие исследования, указывающие на широкое распространение профагов у штаммов S. aureus различного происхождения (12).

S. aureus приобрел во всем мире множественную лекарственную устойчивость. Это признано экологической опасностью для продуктов питания и здоровья человека, но частота случаев заболевания сильно различается в зависимости от различных факторов. В этом исследовании было обнаружено, что все штаммы чувствительны к ряду противомикробных препаратов, используемых в животных, производящих продукты питания, или в медицине, таких как триметоприм-сульфаметоксазол, эритромицин, клиндамицин, рифампицин и ванкомицин.

Особую озабоченность вызывает наличие метициллин-устойчивого S. aureus (MRSA). Штаммы MRSA были обнаружены у сельскохозяйственных животных (23) и различных пищевых продуктов (34). В этом исследовании ни один из штаммов не показал устойчивости к ß-лактамам, но один штамм, выделенный из молочной среды (IPLA3), показал промежуточную устойчивость к оксациллину, результат, который был подтвержден амплификацией гена mecA (данные не показаны). . Промежуточная устойчивость к аминогликозиду стрептомицину также наблюдалась у восьми штаммов из всех трех пищевых сред.Кроме того, один изолят из мясоперерабатывающей промышленности показал промежуточную устойчивость к фторхинолонам, ципрофлоксацину и энрофлоксацину, которые обычно используются против инфекций, вызывающих тяжелые потери у крупного рогатого скота, свиней, птицы и рыбы.

Эти результаты согласуются с предыдущими сообщениями, в которых частота устойчивости к антибиотикам среди штаммов S. aureus , выделенных из пищевых продуктов, была не очень высокой, за исключением пенициллина (26). Напротив, ряд исследований показал, что S.aureus из разных пищевых продуктов показали относительно высокие показатели устойчивости к различным антибиотикам (44). Интересно, что исследование, проведенное в соседнем географическом регионе (34), показало, что 38% изолятов были устойчивы к оксациллину, но только 0,68% показали присутствие гена mecA .

В заключение, это исследование показало, что гигиенические методы, применяемые в молочной, мясной и морской промышленности, не позволяют полностью удалить патогенные и другие нежелательные бактерии.Фактически, любая из поверхностей, контактирующих с пищей, поддерживает рост не только S. aureus , но и других микроорганизмов, а это означает, что любые из них подходят для развития биопленок. Следует отметить, что энтеротоксигенные штаммы S. aureus присутствовали в каждом из этих пищевых секторов. Заболеваемость была относительно низкой в ​​молочной и мясной промышленности, но было бы очень желательно, чтобы они не присутствовали, чтобы предотвратить заражение пищевых продуктов. Пища, если она присутствует, может быть заражена, и существует некоторый риск отравления стафилококком.В случае производства морепродуктов частота энтеротоксигенных штаммов S. aureus была намного выше, и поэтому риск пищевого отравления также был намного выше. Коагулаза-положительные стафилококки (CAS; в основном S. aureus ) используются в качестве критерия производственной гигиены в некоторых молочных продуктах и ​​морепродуктах. Кроме того, поверхности пищевой промышленности, по-видимому, были резервуаром для других пищевых патогенных бактерий, а также для некоторых микроорганизмов, вызывающих порчу пищевых продуктов, сосуществующих с S. aureus .В свою очередь, присутствие S. aureus в биопленках смешанных видов может также усилить колонизацию и устойчивость этой бактерии в пищевой среде. Таким образом, эти результаты указывают на необходимость улучшения гигиенических условий при производстве пищевых продуктов.

Характеристика золотистого стафилококка, выделенного из пищевых продуктов в Западном Алжире

Настоящее исследование направлено на характеристику изолятов золотистого стафилококка из пищевых продуктов, собранных в западном Алжире.В общей сложности 153 изолята S. aureus из различных сырых и обработанных пищевых продуктов были получены и идентифицированы с помощью матричной лазерной десорбции и ионизационной времяпролетной масс-спектрометрии. Изоляты были охарактеризованы тестом на чувствительность к противомикробным препаратам и обнаружением токсинового гена. Метициллин-резистентные изоляты золотистого стафилококка (MRSA) были идентифицированы путем обнаружения гена mecA и охарактеризованы методом mec-типирования кассетной стафилококковой хромосомы (SCCmec). Мы обнаружили, что 30,9% (153/495) образцов пищевых продуктов были заражены S.aureus. Тридцать три (21,5%) изолята S. aureus были идентифицированы как MRSA, и 16,9% (26/153) несли ген mecA. Было идентифицировано три типа SCCmec, из которых тип IV был наиболее распространенным (69,2%), за ним следуют тип V (15,3%) и тип II (7,6%). Два изолята MRSA не были типизированы с помощью типирования SCCmec. Ни один из исследованных изолятов не содержал mecC. Кроме того, 14,3% (22/153) изолятов были токсигенными S. aureus. Ген цитотоксина pvl был обнаружен у 11,1% изолятов S. aureus. Этот ген выявляли чаще (76.4%) в изолятах MRSA, чем в изолятах чувствительного к метициллину Staphylococcus aureus (MSSA). Ген tsst-1, кодирующий токсин синдрома токсического шока, был выделен редко (3,2%) и только в изолятах MSSA. Согласно результатам теста дисковой диффузии, 70 изолятов были устойчивы только к одному противомикробному препарату, а 51 (33,3%) изолят — к множественной лекарственной устойчивости. Остальные 32 изолята были чувствительны ко всем антибиотикам. Наше исследование впервые подчеркивает высокую распространенность изолятов S. aureus с множественной лекарственной устойчивостью, несущих pvl или tsst-1, обнаруженных в пищевых продуктах в Алжире.Нельзя игнорировать риск передачи MRSA через пищевую цепочку, особенно в сырой пище.

Ключевые слова: Алжир; MRSA; SCCmec; Золотистый стафилококк; продовольственные товары; гены вирулентности.

Staph Aureus Foodborne

ЧТО ТАКОЕ

STAPH. AUREUS FOODBORNE?

Золотистый стафилококк — частая причина болезней пищевого происхождения, не охватываемая некоторыми программами эпидемиологического надзора.Некоторые штаммы Staphylococcus aureus вызывают стафилококковое пищевое отравление за счет выработки термостабильных стафилококковых токсинов. Считается, что все люди подвержены этому типу бактериальной интоксикации. Однако интенсивность симптомов может варьироваться в зависимости от количества проглоченной зараженной пищи и восприимчивости человека к токсину.

КАКИЕ СИМПТОМЫ?

Начало симптомов стафилококкового пищевого отравления составляет от 30 минут до семи часов (в среднем от двух до четырех часов) после употребления продуктов, содержащих предварительно сформированные токсины.Распространенными симптомами являются тошнота, рвота, спазмы в животе, прострация и диарея. Восстановление обычно занимает около двух дней.

Золотистый стафилококк также вызывает кожные абсцессы, пневмонию, бактериемию, эндокардит и синдром токсического шока. Эти инфекции не возникают из-за пищевого происхождения и обычно требуют лечения антибиотиками и госпитализации.

КАК ПЕРЕДАЕТСЯ?

Золотистый стафилококк — это обычная бактерия, обнаруживаемая на коже и в носу почти у 50 процентов здоровых людей и животных. Staph. aureus плохо конкурирует с другими организмами, поэтому вспышки обычно не связаны с сырыми продуктами, в которых присутствует большое количество других бактерий. Исключение может составлять молоко от маститных коров, так как Staph. aureus является причиной мастита.

Типичные продукты, связанные с Staph. Вспышки aureus включают продукты с высоким содержанием белка, с которыми обращаются во время обработки или подготовки.

  • Ферментированное мясо и сыр могут быть вовлечены, если ферментация не происходит быстро, хотя это бывает редко, когда используются коммерческие концентраты культур.
  • Хлебобулочные изделия с кремовой начинкой иногда подвергаются воздействию, так как они обрабатываются во время введения кремовой начинки, а также потому, что более высокое содержание сахара может препятствовать росту других организмов.
  • Приготовленная птица, яйца и морепродукты, которые обрабатываются во время приготовления или хранятся при неправильных температурах перед употреблением, также относятся к Staph. aureus вспышек.
  • Сухие макаронные изделия были причиной вспышек болезни, так как сухое тесто обычно экструдируется при высоких температурах, которые способствуют росту Staph.aureus , и потому оборудование трудно чистить.

Токсины, производимые Staph. aureus очень термостойкие. Например, вспышки вызвали даже консервированные грибы. При уборке грибы хранили в рассоле, что подавляло рост конкурентной флоры. Токсин образовался во время хранения до консервирования и оставался активным даже после процесса консервирования.

КАК ЭТО УПРАВЛЯЕТСЯ?

Контроль времени и температуры для предотвращения роста микроорганизмов является основной мерой борьбы с Staph.aureus. Продукты также могут быть разработаны для предотвращения роста. Личная гигиена также важна для предотвращения загрязнения продукта работниками, работающими с пищевыми продуктами. Важно отметить, что нагревание пищи после образования токсина не будет эффективным средством контроля.

Пределы температуры, pH и активности воды для роста шире, чем для производства токсинов, а анаэробные условия (недостаток кислорода) еще больше ограничивают производство токсинов. Например, Staph. aureus может расти при температуре от 7 до 48 ° C, а токсин вырабатывается при температуре от 10 до 48 ° C.Минимальная активность воды для роста составляет 0,83 аэробно и 0,90 анаэробно, в то время как токсин ограничен аэробно на 0,87 и анаэробно на 0,92. Диапазон pH для роста составляет 4-10, в то время как нижний предел выработки токсина составляет 4,5 аэробно и 5,0 анаэробно (Международная комиссия по микробиологическим спецификациям пищевых продуктов, 1996).

Для получения помощи по этой теме или по другим вопросам безопасности пищевых продуктов для вашего предприятия, пожалуйста, свяжитесь с нами.

ССЫЛКИ И ДОПОЛНИТЕЛЬНАЯ ИНФОРМАЦИЯ

  • FDA
  • CDC
  • ICMSF.Микроорганизмы в пищевых продуктах 5, Микробиологические характеристики пищевых патогенов. Blackie Academic and Professional, Нью-Йорк. 1996.

Золотистый стафилококк

Составлено: Джули А. Альбрехт, доктор философии, доцент

Организм: Staphylococcus aureus (обычно называемый «стафилококком») является частью естественной микрофлоры человека. Бактерии увеличиваются в количестве на прыщах, язвах и при простуде. Бактерии лучше всего растут при температуре нашего тела.Staph может быстро размножаться в пище, хранящейся при комнатной температуре, а токсин может вырабатываться микроорганизмами, растущими в пище. Этот токсин называется энтеротоксином, потому что он вызывает гастроэнтерит или воспаление слизистой оболочки кишечного тракта. Тщательное приготовление уничтожает бактерии Staphylococcus aureus , но этот токсин очень устойчив к нагреванию, охлаждению и замораживанию.

Источники организма:

  • Люди (кожа, инфицированные порезы, прыщи, носовой ход, горло)

Сопутствующие продукты:

  • Салаты (яйцо, тунец, курица, картофель, макароны)
  • Выпечка (выпечка с кремом, пирожки с кремом, эклеры)
  • Ветчина

Характеристики микроорганизма: Грамположительные факультативные аэробные сферические бактерии, продуцирующие очень термостойкий токсин

Условия выращивания:

  • Диапазон температур: 4-46 ° C (39-115 ° F) для роста и производства токсинов
  • Оптимальная температура: 37 ° C (98.6 ° F)
  • Диапазон pH: 4,8-8,0
  • Самый низкий зарегистрированный A w для роста: 0,86
  • Солеустойчивость: 10-20%
  • Толерантность к сахару: 50-60%
  • Допуск к нитритам

Болезнь: Болезнь: Стафилококковая пищевая интоксикация возникает в результате употребления пищи, загрязненной токсином, вырабатываемым Staphylococcus aureus .

Симптомы включают:

  • Сильные спазмы в животе
  • Диарея
  • Тошнота
  • Рвота

Время начала действия:

Инфекционная доза:

  • Токсин вырабатывается, когда популяция Staphylococcus aureus превышает 10 6 КОЕ / грамм пищи.Менее 1,0 мкг токсина в пище вызывает симптомы стафилококковой интоксикации.

Продолжительность симптомов:

Управление:

  • Надлежащие методы мытья рук при работе с пищевыми продуктами.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *